Download Ticagrelor Protects the Heart Against Reperfusion Injury and

Ticagrelor Protects the Heart Against Reperfusion Injury
and Improves Remodeling After Myocardial Infarction
Yumei Ye, Gilad D. Birnbaum, Jose R. Perez-Polo, Manjyot K. Nanhwan,
Sven Nylander, Yochai Birnbaum
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
Objective—In addition to P2Y12 receptor antagonism, ticagrelor inhibits adenosine cell uptake. Prior data show that 7-day
pretreatment with ticagrelor limits infarct size. We explored the acute effects of ticagrelor and clopidogrel on infarct size
and potential long-term effects on heart function.
Approach and Results—Rats underwent 30-minute ischemia per 24-hour reperfusion. (1) Ticagrelor (10 or 30 mg/kg) or
clopidogrel (12.5 mg/kg) was given via intraperitoneal injection 5 minutes before reperfusion. (2) Rats received ticagrelor
acute (intraperitoneal; 30 mg/kg), chronic (oral; 300 mg/kg per day) for 4 weeks starting 1 day after reperfusion or the
combination (acute+chronic). Another group received clopidogrel (intraperitoneal [12.5 mg/kg]+oral [62.5 mg/kg per
day]) for 4 weeks. (1) Ticagrelor dose-dependently reduced infarct size, 10 mg/kg (31.5%±1.8%; P<0.001) and 30 mg/
kg (21.4%±2.6%; P<0.001) versus control (45.3±1.7%), whereas clopidogrel had no effect (42.4%±2.6%). Ticagrelor,
but not clopidogrel, increased myocardial adenosine levels, increased phosphorylation of Akt, endothelial NO synthase,
and extracellular-signal-regulated kinase 1/2 4 hours after reperfusion and decreased apoptosis. (2) After 4 weeks,
left ventricular ejection fraction was reduced in the vehicle-treated group (44.8%±3.5%) versus sham (77.6%±0.9%).
All ticagrelor treatments improved left ventricular ejection fraction, acute (69.5%±1.6%), chronic (69.2%±1.0%),
and acute+chronic (76.3%±1.2%), whereas clopidogrel had no effect (37.4%±3.7%). Ticagrelor, but not clopidogrel,
attenuated fibrosis and decreased collagen-III mRNA levels 4 weeks after ischemia/reperfusion. Ticagrelor, but not
clopidogrel, attenuated the increase in proinflammatory tumor necrosis factor-α, interleukin-1β, and interleukin-18, and
increased anti-inflammatory 15-epi-lipoxin-A4 levels.
Conclusions—Ticagrelor, but not clopidogrel, administered just before reperfusion protects against reperfusion injury. This
acute treatment or chronic ticagrelor for 4 weeks or their combination improved heart function, whereas clopidogrel,
despite achieving a similar degree of platelet inhibition, had no effect. (Arterioscler Thromb Vasc Biol. 2015;35:
1805-1814. DOI: 10.1161/ATVBAHA.115.305655.)
Key Words: adenosine ◼ aspirin ◼ platelet inhibitors ◼ prostaglandin-endoperoxide synthases ◼ reperfusion injury
I
n patients with acute coronary syndromes (ACSs), P2Y12
receptor antagonists reduce the incidence of cardiovascular
events.1 A combination of aspirin with P2Y12 receptor antagonists is recommended by the guidelines for patients with
ACS, including ST-segment–elevation myocardial infarction
(STEMI).2–6 P2Y12 receptor antagonists block ADP-induced
platelet aggregation, which is one of the main amplification
pathways of platelet activation.1 The multicenter, randomized,
placebo-controlled Platelet inhibition and patient Outcomes
(PLATO) trial showed that added to aspirin, ticagrelor is
associated with lower incidence of cardiovascular mortality,
myocardial infarction, or stroke compared with clopidogrel in
patients with ACS.7,8 Although the increased benefit was originally ascribed to better and more consistent platelet inhibition,
ticagrelor, in addition to its P2Y12 receptor–blocking properties, inhibits interstitial adenosine cell reuptake, via inhibition
of the equilibrative nucleoside transporter 1, thereby increasing extracellular adenosine levels.9–12
Adenosine is a major mediator of myocardial protection
against ischemia–reperfusion injury and is essential for the
myocardial protection by ischemic preconditioning and various
pharmacological preconditioning.13,14 We have recently shown
that 7-day oral pretreatment with ticagrelor, but not clopidogrel, limits myocardial infarct size (IS) in rats subjected to
30-minute coronary artery ligation followed by 24-hour reperfusion.15 Importantly, the degree of platelet inhibition was comparable between the clopidogrel and ticagrelor arms indicating
a P2Y12- and platelet-independent cardioprotective effect of
ticagrelor. Indeed, the protective effect was mediated by adenosine receptor activation with downstream phosphorylation of
protein kinase B (Akt), endothelial NO synthase, and activation
of cyclooxygenase-2 (COX2).15 Thus, the data support that in
Received on: April 1, 2015; final version accepted on: May 18, 2015.
From the Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston (Y.Y., J.R.P.-P., M.K.N., Y.B.); Section of
Cardiology, Baylor College of Medicine, Houston, TX (G.D.B., Y.B.); and AstraZeneca R&D, Mölndal, Sweden (S.N.).
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.115.305655/-/DC1.
Correspondence to Yochai Birnbaum, MD, One Baylor Plaza, MS: BCM620, Houston, TX 77030. E-mail [email protected]
© 2015 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
1805
DOI: 10.1161/ATVBAHA.115.305655
1806 Arterioscler Thromb Vasc Biol August 2015
Nonstandard Abbreviations and Acronyms
ACS
COX2
FGF-2
IL
IS
MIP-2
pPCI
STEMI
TNFα
acute coronary syndrome
cyclooxygenase-2
fibroblast growth factor-2
interleukin
infarct size
macrophage inflammatory protein-2
primary percutaneous coronary intervention
ST-segment–elevation myocardial infarction
tumor necrosis factor-α
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
addition to platelet inhibition, ticagrelor, but not clopidogrel,
has protective effects against ischemia–reperfusion that may
help explain the differences in clinical benefit in the PLATO
trial.7,8 However, a recent multicenter, randomized, double-blind
clinical trial did not show a clear clinical benefit in patients with
STEMI receiving ticagrelor en route to the hospital versus in
the catheterization laboratory.16 As the study was not powered
for benefit on cardiovascular events, it is inconclusive about the
hypothesis that administration of ticagrelor after onset of ischemia (in contrast to pretreatment just before reperfusion) can
ameliorate reperfusion injury. In addition, as the median time
difference between the prehospital and the in-hospital ticagrelor administration groups was only 31 minutes,16 it is plausible
that ticagrelor absorption was insufficient and therefore, blood
levels at the time of primary percutaneous coronary intervention (pPCI) were too low to protect the heart against reperfusion injury. Here, we asked (1) whether ticagrelor, administered
intraperitoneal just before reperfusion, could limit IS in the rat
and (2) whether ticagrelor can ameliorate adverse remodeling
after infarction dependently or independently of its IS-limiting
effect, and, thereby, improve heart function.
Materials and Methods
Materials and methods are available in the online-only Data
Supplement.
Results
Ticagrelor, but Not Clopidogrel,
Attenuates Reperfusion Injury
Rats underwent 30-minute coronary artery ligation followed
by reperfusion. Ticagrelor (10 or 30 mg/kg), clopidogrel (12.5
mg/kg), or vehicle was given intraperitoneally 5 minutes
before reperfusion. Area at risk was assessed by blue dye and
IS by 2,3,5-triphenyltetrazolium chloride staining 24 hours
after reperfusion. One rat in the ticagrelor 30 mg/kg and 1 in
the clopidogrel group died during surgery (before administration of the study drugs). Hemodynamic data are presented in
Figure IA in the online-only Data Supplement (heart rate) and
Figure IB (mean blood pressure). Body weight and the size
of the area at risk were comparable among groups (Table).
Ticagrelor dose-dependently reduced IS, expressed as percentage of the left ventricular weight (Table) or percentage of
the area at risk (Figure 1A), whereas clopidogrel had no effect.
IS (percentage of the area at risk) was significantly smaller in
the ticagrelor 30 mg/kg than in the ticagrelor 10 mg/kg group
(P=0.019). Ticagrelor plasma exposure 2 hours after reperfusion was 1.12±0.03 μmol/L in the ticagrelor 30 mg/kg group.
Both ticagrelor (10 and 30 mg/kg) and clopidogrel significantly inhibited ADP-induced platelet aggregation compared
with the control group (Figure 1B). The effect of ticagrelor 30
mg/kg was significantly greater than that of ticagrelor 10 mg/
kg. The difference in level of inhibition between the clopidogrel (64.2%) and ticagrelor 30 mg/kg (61.5%) groups was not
significant, suggesting that both drugs were equally effective
in inhibiting P2Y12 and platelet aggregation at these doses.
In addition, 2 hours after reperfusion, tail vein bleeding time
was equally prolonged by ticagrelor 30 mg/kg and clopidogrel
(Figure 1C). Ticagrelor 30 mg/kg, but not clopidogrel, increased
myocardial adenosine levels, a pharmacological marker of
equilibrative nucleoside transporter 1 inhibition (Figure 1D).
The reperfusion injury induced an increased phosphorylation (enzyme activity) of the prosurvival mediators Akt
(P-Akt), endothelial NO synthase (P-eNOS), and extracellular-signal-regulated kinase (ERK) 1/2 (P-ERK 1/2) 2 hours
after reperfusion in the border zone, whereas the total enzyme
levels remained constant (Figure 2). Ticagrelor, but not clopidogrel, further increased the levels of P-Akt, P-endothelial
NO synthase, and P-ERK 1/2 compared with the vehicle
group (Figure 2).
The reperfusion injury also induced an increase in the
COX2 mRNA levels 2 hours after reperfusion, which remained
unaffected by both ticagrelor and clopidogrel (Figure 3A).
However, ticagrelor significantly increased, whereas clopidogrel tended to decrease (P=0.05) COX2-dependent
6-keto-PGF1α production compared with the vehicle group
(Figure 3B).
Twenty-four hours after reperfusion, apoptosis in the previously ischemic zone increased compared with the shamoperated animals (Figure 3C). Ticagrelor, but not clopidogrel,
significantly decreased the number of apoptotic cells.
Ticagrelor, but Not Clopidogrel, Improved
Remodeling After Ischemia–Reperfusion Injury
Next, we asked whether ticagrelor ameliorates adverse
remodeling after infarction dependently or independently of
Table. Body Weight, the Size of the Ischemic Area at Risk,
and Infarct Size in the Control, TIC-Treated and CLOP-Treated
Groups
Control
(n=8)
P Value
for the
Differences
TIC 10 mg/ TIC 30 mg/ CLOP 12.5
Among
kg (n=8) kg (n=8) mg/kg (n=8) Groups
Body weight, g 268±15
265±13
271±12
281±20
0.901
AR (percentage 31.6±0.6
of LV)
30.6±0.7
31.0±0.7
32.1±2.1
0.813
IS (percentage 14.3±0.6†
of LV)
9.6±0.5*
6.6±0.8* 13.5±1.1†
<0.001
AR indicates area at risk; CLOP, clopidogrel; IS, infarct size; LV, left ventricular;
and TIC, ticagrelor.
*P<0.002 vs control and
†P<0.001 vs TIC 30 mg/kg. The P value for the difference in IS between
TIC10 and TIC30 is 0.061.
Ye et al Ticagrelor Protects Against Reperfusion Injury 1807
Figure 1. Acute intraperitoneal (IP) treatment with ticagrelor ([TIC] 10 and 30 mg/
kg) and clopidogrel ([CLOP] 12.5 mg/kg) 5
minutes before reperfusion. A, Infarct size
(% of the ischemic area at risk 24 hours
after reperfusion). *P<0.002 vs control;
†P<0.02 vs TIC30. B, Platelet aggregation,
induced by 15 µmol/L ADP in platelet-rich
plasma 2 hours after reperfusion (n=4 per
group). *P<0.001 vs control; †P<0.002 vs
TIC30. C, Tail vein bleeding time (seconds)
2 hours after reperfusion (n=6 per group).
*P<0.001 vs control. D, Myocardial adenosine levels 2 hours after reperfusion (n=6
per group). *P<0.001 vs control; †P<0.001
vs TIC30. Control; vehicle-treated, TIC10,
TIC30, and CLOP12.5; Acute TIC (10 and
30 mg/kg) or CLOP (12.5 mg/kg) IP 5 minutes before reperfusion. P values shown in
the graphs are for the overall differences
among groups (ANOVA).
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
its IS-limiting effect. This question was addressed by comparing the effect of acute treatment with chronic treatment
initiated the day after reperfusion on heart function 4 weeks
after reperfusion. We also evaluated whether the combined
acute+chronic treatment would be additive.
At the end of the 4-week treatment period there were no
significant differences in heart rate, body weight, and heart
weight among the treatment groups (Table II in the Data
Supplement).
Echocardiographic data are presented in Figure 4 and
Figure II in the online-only Data Supplement. Left ventricular internal diameter in diastole and systole significantly
increased in the rats subjected to ischemia–reperfusion,
whereas fractional shortening and left ventricular ejection
fraction decreased. Acute or chronic (initiated the day after
reperfusion) ticagrelor treatment normalized left ventricular
internal diameter in diastole (Figure 4A). The effect of the
combined acute+chronic ticagrelor treatment was comparable
with that of acute and chronic alone. In contrast, clopidogrel
(acute+chronic) had no effect at all. Ticagrelor, but not clopidogrel, also attenuated the increase in left ventricular internal
diameter in systole but unlike data for left ventricular internal
diameter in diastole with a significant additive effect of the
combination (Figure 4B). Ticagrelor, but not clopidogrel, also
improved the calculated parameters: left ventricular ejection
fraction and fractional shortening (Figure 4C and 4D). For left
ventricular ejection fraction and fractional shortening, there
was a numeric additive effect of the combination that did not
reach statistical significance.
Ticagrelor plasma exposure after 7-day oral therapy was
1.43±0.05 and 4.21±0.09 μmol/L in the 150 and 300 mg/kg
per day group, respectively. In parallel, ticagrelor significantly
inhibited ADP-induced platelet aggregation by 53.5% and
69.7%, respectively. The level of inhibition, at 300 mg/kg per
day, was equal to that of clopidogrel (70.9%; Figure 5A).
Myocardial fibrosis increased in the rats that underwent
ischemia–reperfusion injury when evaluated 4 weeks after
reperfusion. All 3 ticagrelor regimes, but not clopidogrel,
reduced fibrosis with significantly greater reduction with
chronic versus acute treatment (P=0.002), and there was no
additional effect of the combination (Figure 5B; Figure III in
the online-only Data Supplement). Collagen III mRNA levels
increased significantly in the group exposed to ischemia–reperfusion. All 3 ticagrelor regimes significantly decreased collagen III mRNA levels with no significant difference between
treatments, whereas clopidogrel had no effect (Figure 5C).
The mRNA levels of the proinflammatory mediators,
tumor necrosis factor-α (TNFα), interleukin (IL)-1β, and
IL-18, increased in the myocardial border zone 4 weeks after
reperfusion (Figure 6A–6C). All 3 ticagrelor regimens significantly reduced the levels of all these mediators with no
significant difference among treatments, whereas clopidogrel
had no effect.
Myocardial levels of the anti-inflammatory eicosanoid
15-epi-lipoxin A4 remained unchanged 4 weeks after reperfusion (7.3±0.7 versus 7.6±0.3 pg/µg). Chronic (17.2±0.5 pg/µg;
P<0.001) or combined acute+chronic ticagrelor treatment
(17.4±0.7 pg/µg; P<0.001) significantly increased 15-epilipoxin A4 levels, whereas clopidogrel (7.3±0.6 pg/µg; P=1.0)
and acute ticagrelor (8.3±0.7 pg/µg) had no effect.
Myocardial macrophage inflammatory protein-2 (MIP-2;
Figure 6D) and fibroblast growth factor-2 (FGF-2; Figure 6E)
levels increased 4 weeks after reperfusion. Acute ticagrelor
treatment tended to reduce MIP-2 levels (P=0.93) and significantly reduced FGF-2 levels (P=0.02). Chronic ticagrelor
significantly reduced MIP-2 and FGF-2 levels, with no significant additional effect of the combination. Clopidogrel had no
effect on MIP-2 levels (P=1.00 versus vehicle), but completely
normalized FGF-2 levels (P=1.0 versus the sham group).
Discussion
The main findings of the present study are that acute ticagrelor treatment just before reperfusion increased myocardial
adenosine levels, augmented the phosphorylation of the prosurvival kinases Akt and ERK 1/2 and endothelial NO synthase, and limited myocardial IS. This cardioprotective effect
1808 Arterioscler Thromb Vasc Biol August 2015
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
Figure 2. Ischemic zone heart tissue enzyme protein expression 2 hours after reperfusion. A, Samples of immunoblots and densitometric
analysis of P-Akt (B), total Akt (C), P-endothelial NO synthase (eNOS; D), total eNOS (E), P-extracellular-signal-regulated kinase (ERK) 1/2
(F), and total ERK 1/2 (G; n=4 per group). *P<0.022 vs control; †P<0.001 vs ticagrelor (TIC) 30. Sham, sham-operated; control, vehicletreated; TIC30; and clopidogrel (CLOP) 12.5; acute TIC (30 mg/kg) or CLOP (12.5 mg/kg) intraperitoneal 5 minutes before reperfusion. P
values shown in the graphs are for the overall differences among groups (ANOVA).
of a single acute dose of ticagrelor translated into an improved
heart function and reduced fibrosis and collagen III expression 4 weeks later. Similar effects on heart function fibrosis
and collagen III, along with attenuation of the increase in proinflammatory mediators, was seen with chronic oral ticagrelor therapy, started the day after reperfusion, and with the
combination of acute and chronic oral treatment. In contrast,
clopidogrel, despite achieving similar degree of inhibition of
platelet aggregation, did not display any acute cardioprotective effect or improved long-term heart function.
The mean maximal ticagrelor plasma exposure (Cmax)
reported in patients after 4 weeks of treatment with the standard dose of 90 mg BID is 1.4 μmol/L with a SD of 0.7
μmol/L.15,17 Thus, the experiments reported here were conducted at clinically relevant ticagrelor plasma exposure levels
(1.12 and 1.43 μmol/L in 30 mg/kg IP and 150 mg/kg per day
oral), except for a slightly supratherapeutic exposure after 300
mg/kg per day oral (4.21 μmol/L). Considering the lack of
effect seen for clopidogrel, dosed to a similar platelet inhibition, suggests that the protective effects seen with ticagrelor
are independent of platelet and P2Y12 inhibition.
The current data confirm our previous findings that ticagrelor, but not clopidogrel, increases myocardial adenosine
levels.15 Higher plasma adenosine levels have also been documented in patients with ACS treated with ticagrelor than in
those receiving clopidogrel.10 Adenosine mediates myocardial
Ye et al Ticagrelor Protects Against Reperfusion Injury 1809
Figure 3. Acute intraperitoneal (IP) treatment with ticagrelor ([TIC] 30 mg/kg) and
clopidogrel ([CLOP] 12.5 mg/kg) 5 minutes
before reperfusion. A, Ischemic zone heart
tissue cyclooxygenase-2 (COX2) mRNA
levels 2 hours after reperfusion (n=4 per
group). *P<0.002 vs vehicle; †P<0.001 vs
TIC30. B, Ischemic zone heart tissue COX2
activity 2 hours after reperfusion (n=4
per group). *P<0.05 vs vehicle; †P<0.002
vs TIC30. C, Ischemic zone heart tissue
apoptosis 24 hours after reperfusion (n=5
per group). *P<0.001 vs control; †P<0.001
vs TIC30. Sham, sham-operated; control,
vehicle-treated; TIC30; and CLOP12.5;
acute TIC (30 mg/kg) or CLOP (12.5 mg/kg)
IP 5 minutes before reperfusion. P values
shown in the graphs are for the overall differences among groups (ANOVA).
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
protection by ischemic preconditioning and various pharmacological preconditioning.13,14 We have recently shown that the
protective effects of ticagrelor pretreatment against ischemia–
reperfusion injury are dependent on adenosine receptor activation.15 In addition to its role in preconditioning, adenosine is
also essential for the cardioprotective effect of postconditioning.14 Two large multicenter studies (the Acute Myocardial
Infarction Study of Adenosine [AMISTAD] I and AMISTAD
II) demonstrated that high-dose intravenous infusion of adenosine, started before reperfusion, significantly reduced IS in
patients with anterior wall STEMI.18,19 However, the primary
end point of new congestive heart failure beginning >24 hours
after randomization, the first rehospitalization for heart failure,
or death from any cause within 6 months was not reduced by
adenosine therapy in the AMISTAD-II trial,19 whereas there
was a trend toward increasing adverse clinical end points with
adenosine in the smaller AMISTAD-I trial.18 In AMISTAD-II
intravenous administration of adenosine was associated with
an increased rate of hypotension19 that may explain the dissociation between the favorable effect on IS and the lack of
Figure 4. Heart function 4 weeks after
reperfusion. A, Left ventricular internal
diameter in diastole (LVIDd). B, LV internal
diameter in systole (LVIDs). C, Fractional
shortening (FS). D, LV ejection fraction
(LVEF; n=7–8 per group; Table II in the
online-only Data Supplement). *P<0.001 vs
control with ischemia–reperfusion; †P<0.04
vs ticagrelor (TIC)-intraperitoneal (IP)+oral.
Sham, sham-operated; control, vehicletreated; TIC-IP, acute TIC (30 mg/kg) IP 5
minutes before reperfusion; TIC-oral, oral
TIC (300 mg/kg per day) for 4 weeks, initiated the day after reperfusion; TIC-IP+oral,
TIC-acute+TIC-chronic; clopidogrel
(CLOP)-IP+oral, CLOP acute+chronic for
4 weeks (12.5 mg/kg IP+62.5 mg/kg per
day oral). P values shown in the graphs are
for the overall differences among groups
(ANOVA).
1810 Arterioscler Thromb Vasc Biol August 2015
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
Figure 5. A, Platelet aggregation, induced by 15 µmol/L ADP in
platelet-rich plasma. *P<0.001 vs control (n=4 per group). Control; vehicle, ticagrelor (TIC) 300, and clopidogrel (CLOP) 62.5;
oral TIC (300 mg/kg per day) or CLOP (62.5 mg/kg per day) for 7
days. B, Myocardial fibrosis 4 weeks after reperfusion. *P<0.001
vs control; †P<0.002 vs TIC intraperitoneal (IP)+oral (n=7 per
group; Table II in the online-only Data Supplement). C, Myocardial collagen III mRNA expression 4 weeks after reperfusion.
*P<0.001 vs vehicle; †P<0.001 vs TIC IP+oral (n=4–5 per group).
P values shown in the graphs are for the overall differences
among groups (ANOVA).
benefit concerning clinical outcomes. Nevertheless, in a retrospective analysis of patients who achieved reperfusion within
3.17 hours of onset of symptoms, adenosine, compared with
placebo, significantly reduced mortality.20 Two recent clinical
trials did not show to demonstrate beneficial effects of intracoronary adenosine before reperfusion on myocardial IS.21,22
A likely explanation is that the short half-life of adenosine
in the circulation makes intracoronary bolus injections ineffective.14 In contrast to intravenous adenosine, ticagrelor
increases adenosine levels at sites with increased production
by preventing its reuptake. The effect should be sustained as
long as sufficient ticagrelor exposure is present.9–12
In a previous study we showed that 7-day pretreatment with
ticagrelor upregulated COX2 expression and activity.15 The
protective effect of ticagrelor pretreatment was blocked with
specific COX2 inhibitors, as well as aspirin.15 In the present
study, acute ticagrelor treatment just before reperfusion did not
increase COX2 mRNA levels 2 hours after reperfusion. The
role of COX2 in mediating the second window of protection by
ischemic preconditioning and various pharmacological agents
is well established.23 Yet, the significance of COX2 in mediating
the protective effects of postconditioning against reperfusion
injury is less certain.23,24 Here, we show that although COX2
mRNA levels were not changed by ticagrelor and clopidogrel
2 hours after reperfusion, ticagrelor significantly increased
COX2 activity. Statins induce adenosine receptor–dependent
COX2 activation via S-nitrosylation.25,26 This mode of COX2
activation is probably a prompt response, before COX2 mRNA
and protein expression are increased. It remains to be explored
whether ticagrelor-induced COX2 activation, described here,
works via the same or similar mechanism.
Unlike ticagrelor, acute clopidogrel treatment failed to
limit IS, which further supports the lack of cardioprotective
effect of clopidogrel in our previous study evaluating 7-day
pretreatment.15 Yang et al27 reported that 2-day pretreatment
with clopidogrel and intravenous cangrelor, started before
reperfusion, reduced IS in rabbits subjected to 30 minutes of
ischemia per 3 hours of reperfusion. However, clopidogrel
had no effect when administered only 24 hours before ischemia. They report that the protective effect was independent
of the antiplatelet effects of the drugs, but was attenuated by
adenosine receptor blockers and phosphoinositide 3-kinase/
Akt inhibitors.27 The differences between the study by Yang
et al and our studies are unclear. Cangrelor and clopidogrel,
in contrast to ticagrelor, do not inhibit cellular adenosine
uptake via equilibrative nucleoside transporter 1.9 Differences
between species (rats versus rabbits), dose, or the length of
reperfusion (3 versus 24 hours) may be the explanation. Wang
et al,28 however, compared the effect of intravenous ticagrelor
and clopidogrel, added to intravenous thrombolytic therapy
with tissue-type plasminogen activator in dogs with electrolytic injury–induced intracoronary thrombus. They found
that ticagrelor, but not clopidogrel, limits myocardial IS. As
both ticagrelor and clopidogrel were dosed to complete inhibition of ex vivo ADP-induced aggregation, as in our study,
they also raised the possibility that the beneficial effect could
be mediated by mechanisms independent of platelet inhibition, including inhibition of vascular P2Y12 receptors or via
adenosine uptake inhibition.28 Patti et al29 compared the effect
of a 600- versus a 300-mg loading dose of clopidogrel on IS
in patients who underwent pPCI for STEMI. The high dose
of clopidogrel was associated with lower levels of creatine
kinase MB and troponin-I, better TIMI (thrombolysis in myocardial infarction) flow grade, and improved left ventricular
ejection fraction at discharge. However, these results may be
attributed to better and more rapid platelet inhibition. In our
model, myocardial infarction is induced by mechanical ligation of the coronary artery; and hence, the role of platelet inhibition is probably less significant.
Importantly, we found that the acute cardioprotective
effect against reperfusion injury mediated by ticagrelor translated into improved heart function 4 weeks later. Surprisingly,
Ye et al Ticagrelor Protects Against Reperfusion Injury 1811
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
Figure 6. Acute intraperitoneal (IP) treatment with ticagrelor ([TIC] 30 mg/kg) 5 minutes before reperfusion, oral TIC (300 mg/kg per day)
for 4 weeks initiated the day after reperfusion, TIC IP+oral or clopidogrel (CLOP) IP+oral (12.5 mg/kg+62.5 mg/kg per day). Myocardial
mRNA levels of tumor necrosis factor (TNF)-α (A), interleukin (IL)-1β (B), and IL-18 (C), myocardial protein levels of macrophage inflammatory protein 2 (MIP-2; D), and fibroblast growth factor-2 (FGF-2; E) 4 weeks after reperfusion. *P<0.015 vs control; †P<0.002 vs TIC
IP+oral (n=4 per group). Sham, sham-operated; control, vehicle-treated; TIC-IP, acute TIC (30 mg/kg) IP 5 minutes before reperfusion;
TIC-oral, chronic oral TIC (300 mg/kg per day) for 4 weeks, initiated the day after reperfusion; TIC-IP+oral, TIC-acute+TIC-chronic; CLOPIP+oral, CLOP IP+oral for 4 weeks (12.5 mg/kg+62.5 mg/kg per day). P values shown in the graphs are for the overall differences among
groups (ANOVA).
a similar beneficial effect on heart function was seen with
chronic treatment initiated 1 day after reperfusion, thus independent of its IS-limiting effect, with minor additive effect
when acute and chronic treatments were combined. In contrast, Yang et al27 reported that the protective effect of cangrelor was lost when the drug infusion started 10 minutes after
reperfusion compared with drug infusion before reperfusion.
As differences in angiographic findings, secondary to
greater platelet inhibition, cannot explain the differences in
clinical outcomes between ticagrelor and clopidogrel in the
PLATO trial,30,31 our study may provide an alternative explanation. In addition to its antiplatelet effects, ticagrelor provides cardioprotection against ischemia–reperfusion injury
and improve long-term remodeling after infarction. The recent
Administration of Ticagrelor in the Cath Laboratory or in the
Ambulance for New ST-Elevation Myocardial Infarction to
Open the Coronary Artery (ATLANTIC) trial failed to show a
clear clinical benefit in patients with STEMI undergoing pPCI
and receiving ticagrelor en route to the hospital versus in the
catheterization laboratory.16 The myocardial reperfusion in
angioplasty of patients with STEMI loaded with ticagrelor or
clopidogrel (MICAMI-TICLO) trial31 showed that ticagrelor
loading before pPCI for STEMI did not improve angiographic
findings or ST-segment elevation resolution, as compared with
clopidogrel loading. In both trials, the time from drug loading
to intervention was short (31–43 minutes).16,31 It is plausible
that the time between dose and pPCI in the in-ambulance study
arm was insufficient to allow significant ticagrelor exposure
at the time of pPCI to induce adenosine-dependent protection
against the acute reperfusion injury, as shown in the current
rat study. The MICAMI-TICLO trial was relatively small and
did not follow the patients for clinical outcomes.31 However,
both groups in the ATLANTIC trial received chronic ticagrelor treatment; hence, both groups benefited from the long-term
effects of the drug. Therefore, no between-group difference
could be seen.16 Considering our data, which show a benefit
of both acute and chronic treatments, and these clinical data,
which have not been able to make the comparison, the relative benefit from acute and chronic ticagrelor treatments in
patients remains to be defined.
A single dose of ticagrelor, administered intraperitoneally
before reperfusion, reduced IS, and as a consequence, inflammation, fibrosis, and remodeling 4 weeks after infarction. In
contrast, the effect of the 4-week chronic treatment cannot be
attributed to direct protection against reperfusion injury, as at
the time therapy started, cell death because of ischemia and
reperfusion was completed. It is thus plausible that ticagrelor,
via its adenosine augmentation effects, ameliorated inflammation and attenuated adverse remodeling. It is clear that these
favorable effects are independent of the antiplatelet properties
1812 Arterioscler Thromb Vasc Biol August 2015
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
of ticagrelor, as clopidogrel had no effect on inflammation,
fibrosis, and remodeling despite achieving a similar degree
of platelet aggregation inhibition. TNFα,32,33 IL-1β,33,34 and
IL-1834–36 are involved in myocardial ischemia–reperfusion
injury and remodeling. Thus, the reduction of these proinflammatory mediators induced by ticagrelor may explain the favorable effects on fibrosis and remodeling. It has been reported
that activation of the adenosine A1 receptors attenuates the
prohypertrophic effects of TNFα on cardiomyocytes,37 and
that adenosine suppresses TNFα expression.38 Ticagrelor
increased myocardial levels of 15-epi-lipoxin A4, an eicosanoid mediator with potent anti-inflammation effects,15 that
has been shown to inhibit TNFα and IL1β secretion and to
attenuate the effects of TNFα.39–41 Future studies are needed to
explore whether the effects of ticagrelor on the expression of
the proinflammatory mediators are dependent on the upregulation of 15-epi-lipoxin A4 levels. As the synthesis of 15-epilipoxin A4 is dependent on COX2, these anti-inflammatory
effects of ticagrelor might be COX2 dependent and could be
potentially inhibited by high-dose aspirin.15
MIP-2 is a proinflammatory chemokine that increases
after ischemia–reperfusion injury and infarction and may be
involved in adverse cardiac remodeling.42,43 Here, we show
that ticagrelor, but not clopidogrel, attenuates the increase in
MIP-2 4 weeks after myocardial infarction. However, FGF-2
induces cardioprotection,44 has a role as a chemotactic factor for stem cell homing after myocardial injury,45 induces
angiogenesis,46,47 and improves remodeling after myocardial
infarction in the rat.48–50 The significance of the ticagrelorinduced attenuation and clopidogrel-induced normalization
of the increase in FGF-2 levels 4 weeks after infarction is
unclear. Although ticagrelor attenuated adverse remodeling
after infarction, clopidogrel had no effect. It is possible that
4 weeks after infarction, healing was better in the ticagrelortreated animals and therefore, the stimulus for FGF-2 release
was decreased. In contrast, as clopidogrel had no effect on
adverse remodeling, its normalization of the FGF-2 levels
may have adverse effects. Further studies are needed to clarify
the effects of these drugs on FGF-2 release over time after
infarction and their pathophysiologic significance.
Here, we are showing that acute administration of ticagrelor before reperfusion reduces myocardial IS. The challenge
in the clinical setting is how to get sufficient drug exposure before pPCI, as the average time between first medical
encounter and reperfusion is relatively short. Parenteral (intravenous) or chewable formulation should probably be developed for this purpose. This may be less a problem in non–ST
elevation ACSs, as the time from first medical encounter to
PCI is longer. One may question the role of chronic treatment if the initial acute effects could be achieved by reaching adequate drug exposure at the time of reperfusion. In our
models, the only parameter that showed greater improvement
with the acute and chronic ticagrelor treatments as compared
with acute treatment alone or chronic treatment alone was left
ventricular internal diameter in systole. However, the animals
in our models do not have atherosclerosis and coronary occlusion was induced by mechanical ligation of the artery. Thus,
the role of platelet aggregation in mediating acute reperfusion
injury, and over the long run, new coronary lesions, including
acute thrombotic occlusion of coronary arteries, is much less
important in our model than in the clinical setting. Thus, in
the current model, we do not compare the effects of outcomes
of chronic antiplatelet inhibition with ticagrelor versus clopidogrel, but only study acute cardioprotection and subsequent
effects on remodeling. Importantly, our experiments indicate
that even if optimal ticagrelor exposure cannot be achieved at
the time of pPCI, oral therapy started after reperfusion could
still improve heart function. This effect on remodeling after
infarction should be further studied. It is plausible that the
effects of chronic exposure on remodeling after infarction
(along with better and more reliable antiplatelet effects) are
the explanation of the superiority of ticagrelor over clopidogrel in the PLATO trial.
Based on the results of the current study, we have initiated
a clinical trial comparing the effects of ticagrelor and another
P2Y12 receptor antagonist on myocardial IS in patients with
first anterior STEMI undergoing pPCI. Further studies are
probably needed to search for alternative mode of administration (chewable, intravenous, or even higher loading dose)
to achieve effective ticagrelor blood levels by the time reperfusion occurs. Additional studies are needed to evaluate the
effects of ticagrelor treatment on cardiac remodeling and heart
function after myocardial infarction.
In addition to ticagrelor, 2 other antiplatelet agents, dipyridamole51,52 and cilostazol,53 also prevent the reuptake of adenosine and have been shown to limit myocardial IS. However,
both also inhibit phosphodiesterase-III, increasing intracellular levels of cAMP making comparisons difficult. Also in addition to ticagrelor, the other P2Y12 antagonists, clopidogrel and
prasugrel, can attenuate platelet–leukocyte interactions and
modulate inflammatory response.54 Yet, in our model, ticagrelor, but not clopidogrel, limited IS and improved postinfarction remodeling, despite similar platelet inhibition by both
drugs. No data are available for prasugrel in this regard.
Limitations
The number of animals in each group is small (especially
when compared with the number of patients in each group
in clinical trials). However, these sample sizes are commonly used in animal studies and are based on experience and
sample size calculation. The animals used in bench research
are more homogeneous (age, sex, weight, and genetic background) than the typical patient populations and they are
exposed to exactly same insult (ischemic time, reperfusion
time, etc). The results of the current study should be verified
in other animal models and in clinical trials before they are
implemented for patient care.
In conclusion, ticagrelor, administered just before reperfusion, provided acute cardioprotection and limited IS.
This acute cardioprotective effect translates into long-term
improved heart function. In addition, also chronic ticagrelor treatment initiated the day after reperfusion improved
heart function independently of the acute IS-limiting effect.
Clopidogrel, despite achieving similar degree of platelet inhibition, had no acute or chronic cardioprotective effects. The
results should be confirmed in appropriate clinical studies, as
Ye et al Ticagrelor Protects Against Reperfusion Injury 1813
frequently, positive findings from animal models are not translated to clinical benefits in patients.55
Sources of Funding
This study was supported by an Investigator Initiated grant from
AstraZeneca. Partial support was provided by the John S. Dunn
Foundation.
Disclosures
Y. Ye and Dr Birnbaum received research grants from Astra Zeneca,
BMS, Boehringer Ingelheim. S. Nylander is an employee of Astra
Zeneca. The other authors report no conflicts.
References
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
1. Eikelboom JW, Hirsh J, Spencer FA, Baglin TP, Weitz JI. Antiplatelet
drugs: Antithrombotic Therapy and Prevention of Thrombosis, 9th
ed: American College of Chest Physicians Evidence-Based Clinical
Practice Guidelines. Chest. 2012;141(2 Suppl):e89S–119S. doi: 10.1378/
chest.11-2293.
2. Hamm CW, Bassand JP, Agewall S, et al; ESC Committee for Practice
Guidelines. ESC Guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation:
The Task Force for the management of acute coronary syndromes (ACS)
in patients presenting without persistent ST-segment elevation of the
European Society of Cardiology (ESC). Eur Heart J. 2011;32:2999–3054.
doi: 10.1093/eurheartj/ehr236.
3. Jneid H, Anderson JL, Wright RS, et al. 2012 ACCF/AHA focused update
of the guideline for the management of patients with unstable angina/
non-ST-elevation myocardial infarction (updating the 2007 guideline and
replacing the 2011 focused update): a report of the American College Of
Cardiology Foundation/American Heart Association Task Force on practice guidelines. Circulation. 2012;126:875–910
4. Steg PG, James SK, Atar D, et al. ESC guidelines for the management of
acute myocardial infarction in patients presenting with ST-segment elevation. Eur Heart J. 2012;33:2569–2619.
5.Thygesen K, Alpert JS, Jaffe AS, et al; Joint ESC/ACCF/AHA/WHF
Task Force for Universal Definition of Myocardial Infarction; Authors/
Task Force Members Chairpersons; Biomarker Subcommittee; ECG
Subcommittee; Imaging Subcommittee; Classification Subcommittee;
Intervention Subcommittee; Trials & Registries Subcommittee; Trials &
Registries Subcommittee; Trials & Registries Subcommittee; Trials &
Registries Subcommittee; ESC Committee for Practice Guidelines (CPG);
Document Reviewers. Third universal definition of myocardial infarction.
J Am Coll Cardiol. 2012;60:1581–1598. doi: 10.1016/j.jacc.2012.08.001.
6.Vandvik PO, Lincoff AM, Gore JM, Gutterman DD, Sonnenberg FA,
Alonso-Coello P, Akl EA, Lansberg MG, Guyatt GH, Spencer FA;
American College of Chest Physicians. Primary and secondary prevention of cardiovascular disease: Antithrombotic Therapy and Prevention
of Thrombosis, 9th ed: American College of Chest Physicians EvidenceBased Clinical Practice Guidelines. Chest. 2012;141(2 Suppl):e637S–
e668S. doi: 10.1378/chest.11-2306.
7. Wallentin L, Becker RC, Budaj A, et al; PLATO Investigators. Ticagrelor
versus clopidogrel in patients with acute coronary syndromes. N Engl J
Med. 2009;361:1045–1057. doi: 10.1056/NEJMoa0904327.
8.Cannon CP, Harrington RA, James S, et al; PLATelet inhibition and
patient Outcomes Investigators. Comparison of ticagrelor with clopidogrel
in patients with a planned invasive strategy for acute coronary syndromes
(PLATO): a randomised double-blind study. Lancet. 2010;375:283–293.
doi: 10.1016/S0140-6736(09)62191-7.
9.Armstrong D, Summers C, Ewart L, Nylander S, Sidaway JE, van
Giezen JJ. Characterization of the adenosine pharmacology of ticagrelor reveals therapeutically relevant inhibition of equilibrative nucleoside
transporter 1. J Cardiovasc Pharmacol Ther. 2014;19:209–219. doi:
10.1177/1074248413511693.
10. Bonello L, Laine M, Kipson N, Mancini J, Helal O, Fromonot J, Gariboldi
V, Condo J, Thuny F, Frere C, Camoin-Jau L, Paganelli F, Dignat-George F,
Guieu R. Ticagrelor increases adenosine plasma concentration in patients
with an acute coronary syndrome. J Am Coll Cardiol. 2014;63:872–877.
doi: 10.1016/j.jacc.2013.09.067.
11. van Giezen JJ, Sidaway J, Glaves P, Kirk I, Björkman JA. Ticagrelor inhibits adenosine uptake in vitro and enhances adenosine-mediated hyperemia
responses in a canine model. J Cardiovasc Pharmacol Ther. 2012;17:164–
172. doi: 10.1177/1074248411410883.
12.Cattaneo M, Schulz R, Nylander S. Adenosine-mediated effects of
ticagrelor: evidence and potential clinical relevance. J Am Coll Cardiol.
2014;63:2503–2509. doi: 10.1016/j.jacc.2014.03.031.
13. Kitakaze M, Minamino T, Node K, Takashima S, Funaya H, Kuzuya T,
Hori M. Adenosine and cardioprotection in the diseased heart. Jpn Circ J.
1999;63:231–243.
14.Kloner RA. Current state of clinical translation of cardioprotective
agents for acute myocardial infarction. Circ Res. 2013;113:451–463. doi:
10.1161/CIRCRESAHA.112.300627.
15. Nanhwan MK, Ling S, Kodakandla M, Nylander S, Ye Y, Birnbaum Y.
Chronic treatment with ticagrelor limits myocardial infarct size: an adenosine and cyclooxygenase-2-dependent effect. Arterioscler Thromb Vasc
Biol. 2014;34:2078–2085. doi: 10.1161/ATVBAHA.114.304002.
16. Montalescot G, van ‘t Hof AW. Prehospital ticagrelor in ST-segment elevation myocardial infarction. N Engl J Med. 2014;371:2339. doi: 10.1056/
NEJMc1412729.
17. Storey RF, Husted S, Harrington RA, Heptinstall S, Wilcox RG, Peters G,
Wickens M, Emanuelsson H, Gurbel P, Grande P, Cannon CP. Inhibition
of platelet aggregation by AZD6140, a reversible oral P2Y12 receptor
antagonist, compared with clopidogrel in patients with acute coronary
syndromes. J Am Coll Cardiol. 2007;50:1852–1856. doi: 10.1016/j.
jacc.2007.07.058.
18.Mahaffey KW, Puma JA, Barbagelata NA, DiCarli MF, Leesar MA,
Browne KF, Eisenberg PR, Bolli R, Casas AC, Molina-Viamonte V,
Orlandi C, Blevins R, Gibbons RJ, Califf RM, Granger CB. Adenosine
as an adjunct to thrombolytic therapy for acute myocardial infarction:
results of a multicenter, randomized, placebo-controlled trial: the Acute
Myocardial Infarction STudy of ADenosine (AMISTAD) trial. J Am Coll
Cardiol. 1999;34:1711–1720.
19.Ross AM, Gibbons RJ, Stone GW, Kloner RA, Alexander RW;
AMISTAD-II Investigators. A randomized, double-blinded, placebocontrolled multicenter trial of adenosine as an adjunct to reperfusion in
the treatment of acute myocardial infarction (AMISTAD-II). J Am Coll
Cardiol. 2005;45:1775–1780. doi: 10.1016/j.jacc.2005.02.061.
20. Kloner RA, Forman MB, Gibbons RJ, Ross AM, Alexander RW, Stone
GW. Impact of time to therapy and reperfusion modality on the efficacy
of adenosine in acute myocardial infarction: the AMISTAD-2 trial. Eur
Heart J. 2006;27:2400–2405. doi: 10.1093/eurheartj/ehl094.
21. Desmet W, Bogaert J, Dubois C, Sinnaeve P, Adriaenssens T, Pappas C,
Ganame J, Dymarkowski S, Janssens S, Belmans A, Van de Werf F. Highdose intracoronary adenosine for myocardial salvage in patients with acute
ST-segment elevation myocardial infarction. Eur Heart J. 2011;32:867–
877. doi: 10.1093/eurheartj/ehq492.
22. Fokkema ML, Vlaar PJ, Vogelzang M, Gu YL, Kampinga MA, de Smet
BJ, Jessurun GA, Anthonio RL, van den Heuvel AF, Tan ES, Zijlstra F.
Effect of high-dose intracoronary adenosine administration during primary percutaneous coronary intervention in acute myocardial infarction: a
randomized controlled trial. Circ Cardiovasc Interv. 2009;2:323–329. doi:
10.1161/CIRCINTERVENTIONS.109.858977.109.858977.
23. Hausenloy DJ, Yellon DM. Survival kinases in ischemic preconditioning
and postconditioning. Cardiovasc Res. 2006;70:240–253. doi: 10.1016/j.
cardiores.2006.01.017.
24. Penna C, Mancardi D, Tullio F, Pagliaro P. Postconditioning and intermittent bradykinin induced cardioprotection require cyclooxygenase
activation and prostacyclin release during reperfusion. Basic Res Cardiol.
2008;103:368–377. doi: 10.1007/s00395-007-0695-7.
25.Kim SF, Huri DA, Snyder SH. Inducible nitric oxide synthase binds,
S-nitrosylates, and activates cyclooxygenase-2. Science. 2005;310:1966–
1970. doi: 10.1126/science.1119407.
26. Atar S, Ye Y, Lin Y, Freeberg SY, Nishi SP, Rosanio S, Huang MH, Uretsky
BF, Perez-Polo JR, Birnbaum Y. Atorvastatin-induced cardioprotection is
mediated by increasing inducible nitric oxide synthase and consequent
S-nitrosylation of cyclooxygenase-2. Am J Physiol Heart Circ Physiol.
2006;290:H1960–H1968. doi: 10.1152/ajpheart.01137.2005.
27. Yang XM, Liu Y, Cui L, Yang X, Liu Y, Tandon N, Kambayashi J, Downey
JM, Cohen MV. Platelet P2Y₁₂ blockers confer direct postconditioninglike protection in reperfused rabbit hearts. J Cardiovasc Pharmacol Ther.
2013;18:251–262. doi: 10.1177/1074248412467692.
28. Wang K, Zhou X, Huang Y, Khalil M, Wiktor D, van Giezen JJ, Penn MS.
Adjunctive treatment with ticagrelor, but not clopidogrel, added to tPA
enables sustained coronary artery recanalisation with recovery of myocardium perfusion in a canine coronary thrombosis model. Thromb Haemost.
2010;104:609–617. doi: 10.1160/TH09-12-0823.
1814 Arterioscler Thromb Vasc Biol August 2015
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
29.Patti G, Bárczi G, Orlic D, Mangiacapra F, Colonna G, Pasceri V,
Barbato E, Merkely B, Edes I, Ostojic M, Wijns W, Di Sciascio G.
Outcome comparison of 600- and 300-mg loading doses of clopidogrel
in patients undergoing primary percutaneous coronary intervention for
ST-segment elevation myocardial infarction: results from the ARMYDA-6
MI (Antiplatelet therapy for Reduction of MYocardial Damage during
Angioplasty-Myocardial Infarction) randomized study. J Am Coll Cardiol.
2011;58:1592–1599. doi: 10.1016/j.jacc.2011.06.044.
30. Kunadian V, James SK, Wojdyla DM, Zorkun C, Wu J, Storey RF, Steg
PG, Katus H, Emanuelsson H, Horrow J, Maya J, Wallentin L, Harrington
RA, Gibson CM. Angiographic outcomes in the PLATO Trial (Platelet
Inhibition and Patient Outcomes). JACC Cardiovasc Interv. 2013;6:671–
683. doi: 10.1016/j.jcin.2013.03.014.
31.Winter JL, Lindefjeld DS, Veas N, Guarda E, Valdebenito M, Méndez
M, Pérez O, Zuanic K, Mestas M, Martínez A. Angiographic and electrocardiographic parameters of myocardial reperfusion in angioplasty of
patients with ST elevation acute myocardial infarction loaded with ticagrelor or clopidogrel (MICAMI-TICLO trial). Cardiovasc Revasc Med.
2014;15:284–288. doi: 10.1016/j.carrev.2014.07.001.
32. Berthonneche C, Sulpice T, Boucher F, Gouraud L, de Leiris J, O’Connor
SE, Herbert JM, Janiak P. New insights into the pathological role of TNFalpha in early cardiac dysfunction and subsequent heart failure after infarction in rats. Am J Physiol Heart Circ Physiol. 2004;287:H340–H350. doi:
10.1152/ajpheart.01210.2003.
33. Gurantz D, Cowling RT, Varki N, Frikovsky E, Moore CD, Greenberg BH.
IL-1beta and TNF-alpha upregulate angiotensin II type 1 (AT1) receptors
on cardiac fibroblasts and are associated with increased AT1 density in
the post-MI heart. J Mol Cell Cardiol. 2005;38:505–515. doi: 10.1016/j.
yjmcc.2004.12.015.
34. Sandanger Ø, Ranheim T, Vinge LE, et al. The NLRP3 inflammasome is
up-regulated in cardiac fibroblasts and mediates myocardial ischaemiareperfusion injury. Cardiovasc Res. 2013;99:164–174. doi: 10.1093/cvr/
cvt091.
35.O’Brien LC, Mezzaroma E, Van Tassell BW, Marchetti C, Carbone S,
Abbate A, Toldo S. Interleukin-18 as a therapeutic target in acute myocardial infarction and heart failure. Mol Med. 2014;20:221–229. doi:
10.2119/molmed.2014.00034.
36. LaFramboise WA, Bombach KL, Dhir RJ, Muha N, Cullen RF, Pogozelski
AR, Turk D, George JD, Guthrie RD, Magovern JA. Molecular dynamics
of the compensatory response to myocardial infarct. J Mol Cell Cardiol.
2005;38:103–117. doi: 10.1016/j.yjmcc.2004.09.011.
37. Liao Y, Lin L, Lu D, Fu Y, Bin J, Xu D, Kitakaze M. Activation of adenosine A1 receptor attenuates tumor necrosis factor-α induced hypertrophy of cardiomyocytes. Biomed Pharmacother. 2011;65:491–495. doi:
10.1016/j.biopha.2011.06.008.
38. Wagner DR, Combes A, McTiernan C, Sanders VJ, Lemster B, Feldman
AM. Adenosine inhibits lipopolysaccharide-induced cardiac expression of
tumor necrosis factor-alpha. Circ Res. 1998;82:47–56.
39. Hu S, Mao-Ying QL, Wang J, Wang ZF, Mi WL, Wang XW, Jiang JW,
Huang YL, Wu GC, Wang YQ. Lipoxins and aspirin-triggered lipoxin
alleviate bone cancer pain in association with suppressing expression of
spinal proinflammatory cytokines. J Neuroinflammation. 2012;9:278. doi:
10.1186/1742-2094-9-278.
40. Ariel A, Chiang N, Arita M, Petasis NA, Serhan CN. Aspirin-triggered
lipoxin A4 and B4 analogs block extracellular signal-regulated kinasedependent TNF-alpha secretion from human T cells. J Immunol.
2003;170:6266–6272.
41.Hachicha M, Pouliot M, Petasis NA, Serhan CN. Lipoxin (LX)A4 and
aspirin-triggered 15-epi-LXA4 inhibit tumor necrosis factor 1alpha-initiated neutrophil responses and trafficking: regulators of a cytokine-chemokine axis. J Exp Med. 1999;189:1923–1930.
42. Natarajan R, Salloum FN, Fisher BJ, Ownby ED, Kukreja RC, Fowler AA
3rd. Activation of hypoxia-inducible factor-1 via prolyl-4 hydoxylase-2
gene silencing attenuates acute inflammatory responses in postischemic
myocardium. Am J Physiol Heart Circ Physiol. 2007;293:H1571–H1580.
doi: 10.1152/ajpheart.00291.2007.
43. Göser S, Andrassy M, Buss SJ, Leuschner F, Volz CH, Ottl R, Zittrich S,
Blaudeck N, Hardt SE, Pfitzer G, Rose NR, Katus HA, Kaya Z. Cardiac
troponin I but not cardiac troponin T induces severe autoimmune inflammation in the myocardium. Circulation. 2006;114:1693–1702. doi:
10.1161/CIRCULATIONAHA.106.635664.
44. Manning JR, Carpenter G, Porter DR, House SL, Pietras DA, Doetschman
T, Schultz Jel J. Fibroblast growth factor-2-induced cardioprotection
against myocardial infarction occurs via the interplay between nitric
oxide, protein kinase signaling, and ATP-sensitive potassium channels.
Growth Factors. 2012;30:124–139. doi: 10.3109/08977194.2012.656759.
45. Di Scipio F, Sprio AE, Folino A, Carere ME, Salamone P, Yang Z, Berrone
M, Prat M, Losano G, Rastaldo R, Berta GN. Injured cardiomyocytes promote dental pulp mesenchymal stem cell homing. Biochim Biophys Acta.
2014;1840:2152–2161. doi: 10.1016/j.bbagen.2014.03.005.
46.Fathi E, Nassiri SM, Atyabi N, Ahmadi SH, Imani M, Farahzadi R,
Rabbani S, Akhlaghpour S, Sahebjam M, Taheri M. Induction of angiogenesis via topical delivery of basic-fibroblast growth factor from polyvinyl alcohol-dextran blend hydrogel in an ovine model of acute myocardial
infarction. J Tissue Eng Regen Med. 2013;7:697–707. doi: 10.1002/
term.1460.
47. Zhao T, Zhao W, Chen Y, Ahokas RA, Sun Y. Acidic and basic fibroblast
growth factors involved in cardiac angiogenesis following infarction. Int J
Cardiol. 2011;152:307–313. doi: 10.1016/j.ijcard.2010.07.024.
48. Mewhort HE, Turnbull JD, Meijndert HC, Ngu JM, Fedak PW. Epicardial
infarct repair with basic fibroblast growth factor-enhanced CorMatrixECM biomaterial attenuates postischemic cardiac remodeling. J Thorac
Cardiovasc Surg. 2014;147:1650–1659. doi: 10.1016/j.jtcvs.2013.08.005.
49. Virag JA, Rolle ML, Reece J, Hardouin S, Feigl EO, Murry CE. Fibroblast
growth factor-2 regulates myocardial infarct repair: effects on cell proliferation, scar contraction, and ventricular function. Am J Pathol.
2007;171:1431–1440. doi: 10.2353/ajpath.2007.070003.
50. Yao HC, Liu T, Meng XY, Han QF, Zhang M, Wang LX. Effect of basic
fibroblast growth factor on the myocardial expression of hypoxia-inducible factor-1α and vascular endothelial growth factor following acute
myocardial infarction. Heart Lung Circ. 2013;22:946–951. doi: 10.1016/j.
hlc.2013.04.111.
51.Ye Y, Lin Y, Perez-Polo R, Huang MH, Hughes MG, McAdoo DJ,
Manickavasagam S, Uretsky BF, Birnbaum Y. Enhanced cardioprotection against ischemia-reperfusion injury with a dipyridamole and
low-dose atorvastatin combination. Am J Physiol Heart Circ Physiol.
2007;293:H813–H818. doi: 10.1152/ajpheart.00210.2007.
52.Ye Y, Long B, Qian J, Perez-Polo JR, Birnbaum Y. Dipyridamole with
low-dose aspirin augments the infarct size-limiting effects of simvastatin. Cardiovasc Drugs Ther. 2010;24:391–399. doi: 10.1007/
s10557-010-6252-x.
53.Manickavasagam S, Ye Y, Lin Y, Perez-Polo RJ, Huang MH, Lui CY,
Hughes MG, McAdoo DJ, Uretsky BF, Birnbaum Y. The cardioprotective effect of a statin and cilostazol combination: relationship to Akt and
endothelial nitric oxide synthase activation. Cardiovasc Drugs Ther.
2007;21:321–330. doi: 10.1007/s10557-007-6036-0.
54. Schrottmaier WC, Kral JB, Badrnya S, Assinger A. Aspirin and P2Y12
Inhibitors in platelet-mediated activation of neutrophils and monocytes.
Thromb Haemost. 2015;114:. doi: 10.1160/TH14-11-0943.
55.Hausenloy DJ, Baxter G, Bell R, et al. Translating novel strategies for
cardioprotection: the Hatter Workshop Recommendations. Basic Res
Cardiol. 2010;105:677–686. doi: 10.1007/s00395-010-0121-4.
Significance
This study shows that in addition to its antiplatelet effects, ticagrelor reduces myocardial infarct size when administered before reperfusion.
Moreover, even if started 1 day after infarction, ticagrelor, but not clopidogrel, improves remodeling and attenuates inflammation and fibrosis.
Downloaded from http://atvb.ahajournals.org/ by guest on May 11, 2017
Ticagrelor Protects the Heart Against Reperfusion Injury and Improves Remodeling After
Myocardial Infarction
Yumei Ye, Gilad D. Birnbaum, Jose R. Perez-Polo, Manjyot K. Nanhwan, Sven Nylander and
Yochai Birnbaum
Arterioscler Thromb Vasc Biol. 2015;35:1805-1814; originally published online June 4, 2015;
doi: 10.1161/ATVBAHA.115.305655
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2015 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/35/8/1805
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2015/06/04/ATVBAHA.115.305655.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Ticagrelor Protects the Heart Against Reperfusion Injury and
Improves Remodeling After Myocardial Infarction
Running title: Ticagrelor Protects Against Reperfusion Injury
Yumei Ye, MD1; Gilad D. Birnbaum2; Jose R Perez-Polo, PhD1; Manjyot
K Nanhwan, MD1; Sven Nylander, PhD3; Yochai Birnbaum, MD1,2
Materials and Methods:
Animal care
This study was approved by The University of Texas Medical Branch IACUC and conducted in
accordance with ‘The Guide for the Care and Use of Laboratory Animals’ published by the US
National Institutes of Health (NIH Publication No. 85-23, revised 1996). Male Sprague-Dawley
rats were used in the study.
Materials
Ticagrelor was provided by AstraZeneca and clopidogrel was purchased from Bristol-Myers
Squibb/ Sanofi Pharmaceuticals. Anti-β-actin antibodies were from Sigma (St Louis, MO).
ELISA kits for 6-keto-PGF1α and cPLA2 activity, immunoassay kit for 15-epi-LXA4 was from
Oxford Biomedical Research (Rochester Hills, MI), FGF-2 (Fibroblastic growth factor-2, basic
fibroblastic growth factor) EIA kit from R&D (Minneapolis, MN), and EIA kit for MIP-2
(macrophage inflammatory protein-2) ELISA kit from Invitrogen (Grand Island, NY). Anti-AKT
and anti-phospho-AKT antibodies were from R&D Systems (Minneapolis, MN). Anti-Ser1177
Phospho-eNOS, anti-total ERK and P-ERK and anti- eNOS antibodies were from Cell Signaling
(Beverly, MA). TUNEL staining for apoptosis was performed using Cardio-TACS kit (Trevigen;
Gaithersburg, MD).
Treatment
Experiment 1: Does Ticagrelor limit reperfusion injury? Rats were subjected to 30 min coronary
artery ligation followed by reperfusion. Ticagrelor (10 or 30mg/kg), clopidogrel (12.5mg/kg) or
vehicle was given via intraperitoneal (IP) injection 5min before reperfusion (acute treatment).
Experiment 2: Does TIC affect adverse remodeling after myocardial infarction? Rats were
subjected to 30 min coronary artery ligation followed by reperfusion. Ticagrelor (30mg/kg),
clopidogrel (12.5mg/kg) or vehicle was given via intraperitoneal (IP) injection 5min before
reperfusion (acute treatment). The next day oral Ticagrelor (300 mg/kg/d), Oral clopidogrel (62.5
mg/kg/d) or placebo was started and continued for 4W (chronic treatment). Ticagrelor and
Clopidogrel were mixed with normal chow (Ticagrelor: 4mg/g chow, Clopidogrel: 0.83mg/g
chow). The following groups were included: sham- sham surgery + vehicle IP and oral placebo;
control- ischemia-reperfusion surgery + vehicle IP + oral placebo; Ticagrelor acute- ischemiareperfusion surgery + Ticagrelor 30 mg/kg IP + oral placebo; Ticagrelor chronic- ischemiareperfusion surgery + vehicle IP + oral Ticagrelor 300 mg/kg/d; Ticagrelor acute + chronic ischemia-reperfusion surgery + Ticagrelor 30 mg/kg IP + oral Ticagrelor 300 mg/kg/d; and
Clopidogrel (12.5mg/kg IP + oral 62.5mg/kg/d).
IS surgical protocol
The rat model of myocardial ischemia-reperfusion injury has been described in detail.1-4 Rats
were anesthetized with intraperitoneal injection of xylazine (6 mg/kg) and ketamine (60 mg/kg),
intubated and ventilated (FIO2=30%). The rectal temperature was monitored and body
temperature was maintained between 36.7 and 37.3o C throughout the experiment. The left
carotid artery was cannulated. The chest was opened and the left coronary artery was encircled
with a suture and ligated for 30min. Isofluorane (1-2.5% titrated to effect) was added after the
beginning of ischemia to maintain anesthesia. After 30min of coronary occlusion, the snare was
released and myocardial reperfusion was verified by change in the color of the myocardium.
Subcutaneous buprenorphine (0.1 mg/kg) was administered, the chest was closed and the rats
were recovered from anesthesia. Twenty-four hours after reperfusion, the rats were re-
anesthetized, the coronary artery was reoccluded, 1.5 ml of Evan's blue dye 3% was injected
into the right ventricle and the rats euthanized under deep anesthesia. Heart rate and mean
blood pressure were noted at baseline (10min after completion of surgery), immediately before
coronary artery occlusion, after 25min of ischemia, and following 20min of reperfusion.
The pre-specified exclusion criteria were lack of signs of ischemia during coronary artery ligation,
lack of signs of reperfusion after release of the snare, prolonged ventricular arrhythmia with
hypotension, and area at risk ≤ 10% of the LV weight. 1-4
Determination of area at risk (AR) and IS
Hearts were excised and the left ventricle was sliced transversely into 6 sections. Slices were
incubated for 10 minutes at 37C in 1% buffered (pH=7.4) 2,3,5-triphenyl-tetrazolium-chloride
(TTC), fixed in a 10% formaldehyde and photographed in order to identify the AR (unstained by
Evan’s blue dye), the IS (unstained by TTC), and the non-ischemic zones (stained by Evan’s
blue). The AR and IS area in each slice were determined by planimetry, converted into
percentages of the total area, multiplied by the weight of the slice and finally data for all 6
sections were combined to obtain the weight of the myocardial AR and IS 1, 3-6.
Echocardiogram
Echocardiogram was performed 4 weeks after infarction using a fully digitized Vevo 770 highresolution ultrasound system (VisualSonics, Inc.) with a 25 MHz transducer-710B (VisualsonicsToronto, Canada), designed for the examination of small animals. Animals were anesthetized
with ketamine-xylazine. 7 Standard M-mode images were taken in the long axis and short axis
position at the level of the papillary muscles for each animal. Key cardiac parameters, such as
left ventricle internal diameters at end diastole (LVIDd) and systole (LVIDs), and left ventricular
fractional shortening (FS) were measured. Ejection fraction was measured by a single-plane
area length using 2D parasternal long axis images. 7
Myocardial fibrosis
Samples from the left ventricular border zone of the infarction were fixed in 10% buffered
formaldehyde for 24 h and embedded in paraffin. Serial sections of 4μm were incubated for 1h
in 0.2% picrosirius red in aqueous saturated picric acid. The images were analyzed under a
microscope at magnification ×200. The area of the myocardial collagen network was determined
using the image-processing program Image-Pro Plus v. 4.5 and expressed as the percentage of
picrosirius red–positive pixels among the total pixels in each image stack.
Apoptosis
TUNEL (terminal transferase dUTP nick end labeling) staining was used. Rats underwent 30
min coronary artery occlusion and 24h reperfusion, as above. At 5 min of coronary artery
occlusion rats received IP vehicle, Clopidogrel 12.5 mg/kg or Ticagrelor 30 mg/kg. Additional
group undergoing sham surgery and receiving vehicle IP. At 4h of reperfusion, rats were
euthanized and 2-mm section of myocardial tissue from the border of the ischemic zone was
fixed in 4% formalin solution and embedded in paraffin. Immunohistochemical procedures for
detecting apoptotic cardiomyocytes was performed by using Cardio-TACS kit according to the
manufacturer’s instructions. Apoptotic-positive myocytes were determined by randomly counting
10 fields. The percentage of apoptoic cells was then determined (i.e., the number of apoptotic
myocytes/total number of myocytes counted × 100).
15-epi-LXA4
Myocardial samples of the anterior wall of the left ventricle were harvested and snap-frozen in
liquid nitrogen and stored at −80°C. Samples were rinsed in cold PBS solution (pH 7.4)
containing 0.16mg/mL heparin to remove red blood cells and clots, homogenized in cold PBS
(pH 7.4) and centrifuged at 10,000 x g for 15 min at 40C. The supernatant was diluted with water
and acidified to pH 3.5 with 1M HCl. The sample was loaded into C-18 Sep-Pak light column
(Waters Corporation, Milford, MA) and washed with 1 mL of water followed by 1 mL of
petroleum ether. The sample was eluted with 2 mL of methyl formate and evaporated with N2
and the residue was dissolved in extraction buffer. We followed the manufacturer instruction of
the immunoassay kits for measuring 15-epi-LXA4.8
COX2 activity Myocardial samples were sectioned into three segments (20 mg each),
homogenized in cold PBS (pH 7.4), and centrifuged. The supernatants were collected and
stored on ice. The segments were placed into test vials with 500µL Hanks’ HEPES solution. Fifty
µM arachidonic acid (AA) were added to the first tube (for overcoming the potential rate limiting
effects of cPLA2 that generates AA); AA + 200µM of SC58125 (a specific COX2 inhibitor) to the
second tube; and AA + 100µM of SC560 (a specific COX1 inhibitor) to the third tube. After 15minute incubation at room temperature, the supernatant in each vial was aspirated and stored at
-70°C. The samples (25µL each) were analyzed for 6-keto-PGF1. 5, 8 by an ELISA kit according
to the manufacturer instruction. The first tube represents 6-keto-PGF1 generated by both COX1
and COX2. COX2 activity was calculated as 6-Keto-PGF1α levels in the first minus the second
tube and COX1 activity as 6-Keto-PGF1α levels in the first minus the third tube.5, 8
FGF2 and MIP2
Myocardial tissue was harvested and snap-frozen in liquid nitrogen and stored at −80°C.
Samples were rinsed with PBS and homogenized with a tissue homogenizer. Levels of FGF2 or
MIP2 in the samples were quantified with a FGF2 EIA kit (R&D) or a MIP-2 ELISA kit
(Invitrogen). All samples were prepared and analyzed in triplicate, and absorbance at 405 nm
was read in a microplate reader.
Immunoblotting
Myocardial samples from the left ventricle of animals not exposed to ischemia (sham) and from
the border zone of the previously ischemic area of animals exposed to ischemia-reperfusion and
treated with vehicle, TIC 30 or CLOP12.5 were homogenized in lysis buffer (in mM): 25 Tris·HCl
(pH 7.4), 0.5 EDTA, 0.5 EGTA, 1 phenylmethylsulfonyl fluoride, 1 dithiothreitol, 25 NaF, 1
Na3VO4, 1% Triton X-100, 2% SDS and 1% protease inhibitor cocktail. The lysate was
centrifuged at 10,000g for 15min at 4°C and supernatants were collected. Protein (50µg) was
fractionated by SDS-PAGE (4%-20% polyacrylamide gels) and transferred to PVDF membranes
(Millipore, Bedford, MA). The membranes were incubated overnight at 40C with primary
antibodies (see ”Materials”). Bound antibodies were detected using the chemiluminescent
substrate (NEN Life Science Products, Boston, MA). The protein signals were quantified with an
image-scanning densitometer, and the strength of each protein signal was normalized to the
corresponding β-actin signal. Data are expressed as percent relative the expression in the
control group.
Plasma Ticagrelor levels
Blood was collected from the tail-vein into EDTA anti-coagulated tubes. All blood samples were
gently mixed, and immediately placed on ice. Plasma was prepared within 30 minutes of blood
sampling by centrifugation at 1500 x g for 10 min at approximately 4°C. The plasma was
transferred into tubes stored at or below -20°C within 1 hour of sample collection and plasma
concentration of ticargelor was determined by protein precipitation and liquid chromatography
mass spectrometry as described previously.9
Platelet aggregation
Platelet rich plasma (PRP) was prepared from blood sampled from rats in experiment 1 by
centrifugation of whole blood anticoagulated with citrate dextrose at 800 rpm for 10 minutes at
room temperature. Platelet aggregation were recorded after activation with 15 µM ADP using a
platelet aggregation profiler (PAP-8; BioData). Data are expressed as the final percent
aggreagation response after 6 min. 4
Myocardial adenosine levels
Myocardial samples were immediately shock-frozen with liquid nitrogen. Adenosine levels in
myocardial tissue samples were analyzed by high performance liquid chromatography (HPLC)
based on the procedure of Wojcik and Neff. 10 Samples were homogenized in 10 volumes of
0.25 M ZnSO4, and protein concentrations were examined by the Lowry assay. After adding ten
volumes of 0.25 M Ba(OH)2, the samples were centrifuged at 30,000 x g for 10 minutes. The
supernatants were collected and 5 µL of chloroacetaldehyde was added to 20 µL of supernatant.
The tubes were capped, mixed and submerged in a boiling water bath for 10 min. Samples were
analyzed by HPLC using a Waters C18 reversed phase 150 mm X 4.6 mm column. The mobile
phase was a 50 mM acetate buffer (pH 4.5) and 6.5% aqueous acetonitrile (volume/volume)
containing 2 mM sodium octyl sulfonate, flow rate was 1.1 mL/min, the excitation
monochromator was set to a wavelength of 270 nm and the cutoff wavelength of the emission
filter was 389 nm.4
Tail Vein Bleeding time
Rats were anesthetized and placed on a 370C heating pad. The tail was transected 0.5 cm from
the tip using a 21-G syringe needle. Then the tail was immediately immersed in a 50-mL falcon
tube filled with 37 °C saline. Bleeding time will be recorded as the time at which bleeding
stopped. Animal will also be observed for 6 hours and examined on the next morning for signs
of delayed bleeding.
Real-Time PCR
Total RNA from heart tissue was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA), per
the manufacturer instructions. 2μg total RNA from each sample was reverse-transcribed into
cDNA and equal amounts of transcriptional products were subjected to PCR amplification. The
mRNA expression of IL-1β IL-18 TNF-α, Collagen III or COX2 was performed by using the
primers designed in Supplement Table II. The Ct (threshold cycle) is defined as the number of
cycles required for the fluorescence signal to exceed the detection threshold. Expression of the
gene relative to the GAPDH expression was calculated as the difference between the threshold
values of these two genes (2-Δct). Melting curve analysis was performed during real-time PCR
to analyze and verify the specificity of the reaction. The values are given as the means ±
standard error of four independent experiments.
Statistical Analysis
Data are presented as means ± SE. Analysis of variance (ANOVA) with Sidak correction for
multiple comparisons was applied to compare the different groups. The differences in HR and
MBP were compared using two-way repeated measures ANOVA with Holm-Sidak multiple
comparison procedures. Values of P <0.05 were considered statistically significant.
References:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Atar S, Ye Y, Lin Y, Freeberg SY, Nishi SP, Rosanio S, Huang MH, Uretsky BF, PerezPolo JR, Birnbaum Y. Atorvastatin-induced cardioprotection is mediated by increasing
inducible nitric oxide synthase and consequent s-nitrosylation of cyclooxygenase-2. Am
J Physiol Heart Circ Physiol. 2006;290:H1960-1968
Birnbaum Y, Lin Y, Ye Y, Martinez JD, Huang MH, Lui CY, Perez-Polo JR, Uretsky BF.
Aspirin before reperfusion blunts the infarct size limiting effect of atorvastatin. Am J
Physiol Heart Circ Physiol. 2007;292:H2891-2897
Birnbaum Y, Ye Y, Rosanio S, Tavackoli S, Hu ZY, Schwarz ER, Uretsky BF.
Prostaglandins mediate the cardioprotective effects of atorvastatin against ischemiareperfusion injury. Cardiovasc Res. 2005;65:345-355
Nanhwan MK, Ling S, Kodakandla M, Nylander S, Ye Y, Birnbaum Y. Chronic treatment
with ticagrelor limits myocardial infarct size: An adenosine and cyclooxygenase-2dependent effect. Arterioscler Thromb Vasc Biol. 2014;34:2078-2085
Birnbaum Y, Ye Y, Lin Y, Freeberg SY, Huang MH, Perez-Polo JR, Uretsky BF. Aspirin
augments 15-epi-lipoxin a4 production by lipopolysaccharide, but blocks the pioglitazone
and atorvastatin induction of 15-epi-lipoxin a4 in the rat heart. Prostaglandins Other Lipid
Mediat. 2007;83:89-98
Ye Y, Lin Y, Atar S, Huang MH, Perez-Polo JR, Uretsky BF, Birnbaum Y. Myocardial
protection by pioglitazone, atorvastatin, and their combination: Mechanisms and possible
interactions. Am J Physiol Heart Circ Physiol. 2006;291:H1158-1169
Keyes KT, Xu J, Long B, Zhang C, Hu Z, Ye Y. Pharmacological inhibition of pten limits
myocardial infarct size and improves left ventricular function postinfarction. Am J Physiol
Heart Circ Physiol. 2010;298:H1198-1208
Birnbaum Y, Ye Y, Lin Y, Freeberg SY, Nishi SP, Martinez JD, Huang MH, Uretsky BF,
Perez-Polo JR. Augmentation of myocardial production of 15-epi-lipoxin-a4 by
pioglitazone and atorvastatin in the rat. Circulation. 2006;114:929-935
Sillen H, Cook M, Davis P. Determination of ticagrelor and two metabolites in plasma
samples by liquid chromatography and mass spectrometry. J Chromatogr B Analyt
Technol Biomed Life Sci. 2010;878:2299-2306
Wojcik WJ, Neff NH. Adenosine measurement by a rapid hplc-fluorometric method:
Induced changes of adenosine content in regions of rat brain. J Neurochem.
1982;39:280-282
Ticagrelor Protects the Heart Against Reperfusion Injury and
Improves Remodeling After Myocardial Infarction
Running title: Ticagrelor Protects Against Reperfusion Injury
Yumei Ye, MD1; Gilad D. Birnbaum2; Jose R Perez-Polo, PhD1; Manjyot
K Nanhwan, MD1; Sven Nylander, PhD3; Yochai Birnbaum, MD1,2
Supplement Material
Supplement Table I: Primers used for the rt-PCR
Target mRNA
Forward primer
Reverse primer
IL-1β
IL-18
TNF-α
Collagen III
COX2
GAPDH
TGCTGTCTGACCCATGTGAG
GTCGTTGCTTGTCTCTCCTTG
CAGACCACTTTGGCAGACTTCACT
GACCCTCACACTCAGATCATCTTCT
GACAGATGCTGGTGCTGAGAAG
TGCGATGCTCTTCCGAGCTGTGCT
ATGATTCTACCCACGGCAAG
GGATTCGTTGGCTGTTCGGTCG
TGCTACGACGTGGGCTACG
TCTGAGGAAGGCCAGCTGTAC
TCAGGAAGTTCCTTATTTCCTTTC
CTGGAAGATGGTGATGGGTT
Supplement Table II: Heart rate (HR), body weight (BW) and heart weight (HW) of the
rats at the end of the 4W treatment (Experiment 2).
Sham
HR
Control
TIC IP
TIC oral
TIC
CLOP
IP + oral
IP + oral
P
value
n=8
n=7
n=8
n=8
n=8
n=8
295±5
288±5
290±5
301±4
298±6
287±6
0.291
268±14
267±11
266±12
283±12
259±16
259±16
0.824
(bpm)
BW
(g)
HW
(g)
1.22±0.05 1.19±0.05 1.15±0.04 1.25±0.05 1.19±0.04 1.19±0.03 0.641
Supplement Figure I: a. Heart rate (HR, BPM). There was a significant time effect
(p<0.001), but not treatment effect (p=0.511) on HR (p=0.012 for the treatment X time
interaction). b. Mean blood pressure (MBP, mmHg). There was a significant time effect
(p<0.001), but not treatment effect (p=0.842) on MBP (p<0.001 for the treatment X time
interaction).
Supplement Figure 2: Two-dimensional and M-mode echocardiographic samples at
4W of rats that underwent sham surgery (sham), or ischemia-reperfusion injury and
treated with vehicle (control), ticagrelor IP only (TIC-IP), ticagrelor oral only (TIC-oral),
ticagrelor IP + oral (TIC IP + oral), or clopidogrel IP + oral (Clop IP + oral).
Supplement Figure 3: Picrosirius red staining of myocardial samples from the left
ventricle of sham- operated rats and rats exposed to ischemia-reperfusion injury and
treated with vehicle, ticagrelor IP only (TIC-IP), ticagrelor oral only (TIC-oral), ticagrelor
IP + oral (TIC IP + oral), or clopidogrel IP + oral (Clop IP + oral).