Download Thyroid hormone regulation of cholesterol metabolism

University of South Florida
Scholar Commons
Graduate Theses and Dissertations
Graduate School
2009
Thyroid hormone regulation of cholesterol
metabolism
Lindsey R. Boone
University of South Florida
Follow this and additional works at: http://scholarcommons.usf.edu/etd
Part of the American Studies Commons
Scholar Commons Citation
Boone, Lindsey R., "Thyroid hormone regulation of cholesterol metabolism" (2009). Graduate Theses and Dissertations.
http://scholarcommons.usf.edu/etd/1863
This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in
Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact
[email protected].
Thyroid Hormone Regulation of Cholesterol Metabolism
by
Lindsey R. Boone
A dissertation submitted in partial fulfillment
of the requirements for the degree of
Doctor or Philosophy
Department of Molecular Medicine
College of Medicine
University of South Florida
Major Professor: Gene C. Ness, Ph.D.
Duane Eichler, Ph.D.
R. Ken Keller, Ph.D.
Richard Heller, Ph.D.
Doug Cress, Ph.D.
Date of Approval:
June 23, 2009
Keywords: In vivo electroporation, HMG-CoA reductase, cholesterol efflux,
transcription, ApoA-I
© Copyright 2009, Lindsey R. Boone
Acknowledgments
Though laborious and often unfulfilling, the course of my graduate career
was enhanced by the people with whom I had the benefit of working. I sincerely
thank my mentor Dr. Gene Ness for his guidance, support, patience, and
friendship. He is a driving force in the area of graduate education. I have always
known that he desires to educate and develop independent scientists through his
lab. I appreciate the selflessness with which he runs his lab and encourages his
students. I thank Dr. Bill Lagor for taking me under his wing my first year and
patiently teaching me techniques and how to be critical of data. He is honest and
direct - two traits that receive my deepest admiration. I am grateful to Melissa
Niesen for her hard-work and dedication to helping me graduate. The weeks of
large sample preparation and analysis were made more endurable by having a
partner in misery. I thank Patricia Brooks for her patience and aptitude. It has
been a pleasure to work with her in my final months. I thank my committee
members for taking time out of their schedules to meet with me independently
and guide my research endeavors. I appreciate the guidance and mentorship
from Dr. William Marshall. He provided me with a new career outlook and was a
strong supporter of my undertakings. I am grateful for my relationships with
Laura Pendleton, Dr Brenda Flam, and Dr Karen Corbin. These brilliant women
guided me through new techniques, troubleshooting, and the lifestyle of a
researcher. I am thankful for my friends in the Molecular Medicine department
who were supportive, helpful, and sympathetic to the obstacles in grad school:
Shara Pantry, Bernadette Ferraro, Sandi Shriver, Jesse Arbuckle, Matt Smith,
Helen Chen-Duncan, Andrew Conniff, and Debby Kingsbury. I also thank Matt
Smith for his guidance in ChIP assay setup and analysis. His advice was
priceless. This research would not have been possible without the financial
support we received from the NIH and Florida Department of Health.
I am grateful for the support that I have received from my family. My mom
supports me in everything I do and provides much-needed optimism. My dad
has never questioned my goals and has allowed me to pursue whatever makes
me happy. I thank both of my parents for their unending support. I thank my
sister Laura for her interest in my work and for her strong support. Even when I
saw no end in sight, she compelled me to stay focused and provided constant
reassurance. I thank my second family, the Boones, for their interest in my work
and for their continued motivation. I also thank them for providing a refuge from
the world of science when I needed it most. I am most grateful for my husband
Brian. He has witnessed the best and worst of me in this journey. He has
listened to countless seminars, read drafts and papers, and most importantly,
provided much-needed feedback to help me become a better scientist. All the
while, he has been my biggest fan. He is a true inspiration. Finally, I thank God
for the many blessings in my life and the opportunity to fulfill this dream of
becoming a scientist.
Table of Contents
List of Tables ......................................................................................................... iv
List of Figures.........................................................................................................v
Abbreviations ....................................................................................................... vii
Abstract ..................................................................................................................x
Chapter 1 Introduction ......................................................................................... 1
Chapter 2 In Vivo Identification of the Mechanism of Thyroid Hormone
Activation of HMGR............................................................................................... 7
Introduction................................................................................................. 8
Materials and Methods ............................................................................. 10
Plasmid Construction..................................................................... 10
Experimental Animals.................................................................... 13
Electroporation Equipment ............................................................ 14
In Vivo Electroporation .................................................................. 14
Luciferase Assays ......................................................................... 15
Serum Preparation and Thyroid Hormone Assay.......................... 15
Site-Directed Mutagenesis ........................................................... 16
Real Time PCR.............................................................................. 16
Nuclear Extract .............................................................................. 16
EMSA ............................................................................................ 18
Chromatin Immunoprecipitation .................................................... 18
siRNA Knockdown Study .............................................................. 21
Statistical Analyses........................................................................ 21
Results ..................................................................................................... 21
Functional Analysis of the HMGR Promoter.................................. 21
Binding of USF-2 to the HMGR Promoter ..................................... 26
siRNA Knockdown of Transcription Factors .................................. 27
i
Discussion ................................................................................................ 31
Chapter 3 Thyroid Hormone Promotes Macrophage Cholesterol Efflux
via ABCA1........................................................................................................... 38
Introduction............................................................................................... 38
Materials and Methods ............................................................................. 40
Experimental Animals.................................................................... 40
HDL and T3 Assays ....................................................................... 41
RNA Isolation................................................................................. 41
Microarray Analysis ....................................................................... 41
Real Time PCR.............................................................................. 42
Macrophage Efflux Studies ........................................................... 42
2D-DIGE ........................................................................................ 43
Results ..................................................................................................... 44
Hepatic ApoA-1 and ApoA-IV Gene Expression Are
Induced by Thyroid Hormone ........................................................ 44
Serum ApoA-1 and ApoA-IV Protein are Induced by
Thyroid Hormone........................................................................... 45
Thyroid Hormone Promotes Macrophage Cholesterol
Efflux via ABCA1 ........................................................................... 47
Discussion ................................................................................................ 50
Chapter 4 Analysis of the ABCG8 Promoter ...................................................... 53
Introduction............................................................................................... 53
Materials and Methods ............................................................................. 54
Electrophoretic Mobility Shift Assay .............................................. 54
Plasmid Construction..................................................................... 54
Experimental Animals and In Vivo Electroporation ....................... 55
Results ..................................................................................................... 59
EMSA Analysis of the ABCG8 Promoter ....................................... 59
TR1 and RXR Bind the ABCG8 Promoter ............................... 59
Identification of a TRE at -392/-376............................................... 60
The -444/+123 ABCG8 Promoter Plasmid is not Functional
ii
by in vivo Electroporation .............................................................. 62
Discussion ................................................................................................ 63
Chapter 5 Final Conclusions and Discussion .................................................... 66
References.......................................................................................................... 72
About the Author ......................................................................................End Page
iii
List of Tables
Table 1
Primer sequences used for cloning and site-directed
mutagenesis .................................................................................. 13
Table 2
Primer sequences used for qPCR ................................................. 17
Table 3
Primer sequences used for EMSA probes .................................... 20
Table 4
Real-time PCR primers.................................................................. 44
Table 5
Subset of hepatic thyroid hormone responsive genes
identified by microarray analysis ................................................... 45
Table 6
List of serum proteins induced by thyroid hormone....................... 48
Table 7
ABCG8 Promoter EMSA Probes ................................................... 55
Table 8
ABCG8 Promoter Mutant EMSA Probes ....................................... 56
iv
List of Figures
Figure 1.
Thyroid Hormone Decreases Serum LDL Cholesterol in
Hypothyroid Rat............................................................................... 6
Figure 2.
In Vivo Electroporation Process .................................................... 11
Figure 3.
In Vivo Imaging of In Vivo Electroporation .................................... 12
Figure 4.
Thyroid Hormone Induces Hepatic HMGR .................................... 23
Figure 5.
-316/-321, SRE, and NF-Y Promoter Elements are Highly
Conserved across Species............................................................ 24
Figure 6.
EMSA Analysis of the -325/-307 HMGR Promoter Region ........... 25
Figure 7.
-316/-321, SRE, and NF-Y Promoter Elements are
Necessary for the Thyroid Hormone Response ............................ 26
Figure 8.
EMSA Analysis of the -316/-321 HMGR Promoter Region ........... 29
Figure 9.
USF-2 Binds to the HMGR Promoter ............................................ 30
Figure 10.
USF-2 Binding to the HMGR Promoter is Increased 4-fold
in Response to T3 .......................................................................... 31
Figure 11.
Real-time PCR Analysis of the Effect of Thyroid Hormone
on Transcription Factors that Bind the HMGR Promoter............... 32
Figure 12.
In Vivo siRNA Knockdown of Hepatic USF-2, SREBP-2,
and NF-Y ....................................................................................... 33
Figure 13.
In Vivo siRNA Knockdown Demonstrates the Functional
roles of USF-2, SREBP-2, and NF-Y on Hepatic HMGR
Promoter Activity ........................................................................... 34
Figure 14.
Real-time PCR Validation of Thyroid Hormone
Responsive Hepatic Genes ........................................................... 46
Figure 15.
2D DIGE of Rat Serum .................................................................. 47
Figure 16.
Thyroid Hormone Increases Macrophage Cholesterol
Efflux via the ABCA1 Cholesterol Transporter .............................. 49
v
Figure 17.
ABCA1 Efflux is Not Mediated by an Increase in Serum
HDL cholesterol ............................................................................. 49
Figure 18.
EMSA Analysis of the ABCG8 Promoter ....................................... 60
Figure 19.
TR-1 and RXR Bind the ABCG8 Promoter ............................... 62
Figure 20.
EMSA Analysis of the -420/-371 ABCG8 Promoter Region .......... 68
Figure 21.
The -444/+123 ABCG8 Promoter Plasmid is not Functional
by in vivo Electroporation .............................................................. 63
Figure 22.
Combined Actions of Thyroid Hormone on Cholesterol
Metabolism .................................................................................... 67
Figure 23.
Proposed Model of HMGR Promoter ............................................ 68
Figure 24.
Thyroid Hormone Induces Cholesterol Efflux ................................ 70
vi
Abbreviations
ABCA1
ATP-binding cassette transporter A1
ABCA8
ATP-binding cassette transporter A8
ABCD2
ATP-binding cassette transporter D2
ABCG1
ATP-binding cassette transporter G1
ABCG5
ATP-binding cassette transporter G5
ABCG8
ATP-binding cassette transporter G8
ApoA-1
Apolipoprotein A-1
ATF2
Activating transcription factor 2
C/EBPa
CCAAT- Enhancer binding protein a
CETP
Cholesteryl ester transfer protein
ChIP
Chromatin immunoprecipitation
CRE
cyclic AMP response element
CYP7A1
Cholesterol 7 alpha-hydroxylase
DC
Direct current
DIGE
Differential in gel electrophoresis
DR-4
Direct Repeat - 4
E4BP4
Nuclear factor, interleukin 3 regulated
EDTA
ethylenediaminetetraacetic acid
ELISA
Enzyme-linked immunosorbent assay
EMSA
Electrophoretic mobility shift assays
vii
ESR1
Estrogen receptor 1
FTF
Fetoprotein transcription factor
LRH-1
Liver receptor homologue
GATA
GATA transcription factors
HDL
High Density Lipoprotein
HMG-CoA
3-hydroxy-3-methylglutaryl coenzyme A
HMGR
HMG –CoA Reductase
HSTF1
Fibroblast growth factor 4
Hx
Hypophysectomized
IDL
Intermediate density lipoprotein
IREBP1
Iron regulatory element binding protein 1
LCAT
Lecithin:cholecterol acyl transferase
LDL
Low density lipoprotein
LDLR
Low density lipoprotein receptor
LRH1
Liver receptor homologue 1
Mt
Mutant
NF4a
Nuclear factor 4 alpha
NF-Y
Nuclear factor Y
NPC1L1
Niemann-Pick C1 Like 1
PLA2
Phospholipase A2, Group IIA
PLTP
Phospholipid transfer protein
PPARa
Peroxisome proliferator activator receptor- alpha
RCT
Reverse cholesterol transport
viii
RXRa
Retinoic acid receptor a
SCAP
SREBP cleavage-activating protein
siRNA
Small-interfering RNA
SF1
Splicing factor-1
SHP
Short heterodimer partner
SP1
Specificity protein-1
SR-B1
Scavenger receptor B1
SRE
Sterol response element
SREBP-2
Sterol regulatory element binding protein-2
TSH
Thyroid stimulating hormone
TR1
Thyroid hormone receptor beta-1
TRE
Thyroid hormone response element
USF 2
Upstream transcription factor 2
VLDL
Very low density lipoprotein
Wt
Wild type
ix
Thyroid Hormone Regulation of Cholesterol Metabolism
Lindsey R. Boone
ABSTRACT
In this study, we examined the effects of thyroid hormone on regulatory
processes of cholesterol metabolism. Specifically, the pathways of cholesterol
synthesis and cholesterol efflux were investigated. Hepatic HMG-CoA reductase
(HMGR) is the rate-limiting enzyme in cholesterol synthesis. Hypothyroid rats
exhibit decreased expression of this gene, which can be induced by subsequent
treatment with thyroid hormone. The mechanism of this activation was
previously unknown. Utilizing in vivo electroporation, we identified HMGR
promoter elements necessary for the induction of HMGR by thyroid hormone.
The -316/-321 element, the sterol response element, and nuclear factor-y site
were all found to be necessary to induce HMGR promoter activity by thyroid
hormone. We used electrophoretic mobility shift assays (EMSA) and chromatin
immunoprecipitation (ChIP) studies to demonstrate increased binding of
upstream transcription factor-2 (USF-2) to the -316/-321 element in the HMGR
promoter in response to thyroid hormone. Finally, co-electroporation of the wildtype HMGR plasmid with siRNA to USF-2, SREBP-2, or NF-Y nearly abolished
the T3 induction as measured by promoter activity. Microarray and real-time PCR
analysis demonstrated an induction of the apolipoproteins ApoA-I and ApoA-IV
x
mRNA by T3. Serum levels of ApoA-I and ApoA-IV proteins were induced by T3.
We collected serum from rats treated with or without T3 and used these sera in
an in vitro macrophage efflux model. We found that T3 promoted cholesterol
efflux via the ABCA1 cholesterol transporter and not via the ABCG1 transporter.
We propose that the induction of serum ApoA-I and ApoA-IV by thyroid hormone
promotes cholesterol efflux via the ABCA1 cholesterol transporter. Hepatic
ABCG5 and ABCG8 are cholesterol transporters that promote biliary secretion of
cholesterol. We utilized EMSAs to scan the shared ABCG5/G8 rat promoter for a
thyroid hormone response element (TRE). We identified a TR binding site at 392/-376 of the ABCG8 promoter. Collectively, these observations provide new
insight into the cholesterol-lowering function of thyroid hormone.
xi
Chapter 1
Introduction
Cholesterol metabolism can be broadly viewed as the dietary intake or
endogenous production of cholesterol and the subsequent utilization of this
cholesterol in downstream processes such as cholesterol transport, cell
membrane structure, bile acid production, and steroid hormone synthesis. When
exogenous cholesterol is ingested through the diet, it travels to the intestine
where it is absorbed by enterocytes via the Niemann-Pick C1 Like 1 (NPC1L1)
cholesterol transporter and packaged into lipid-rich chylomicrons (1, 2). The
chylomicrons are transported via the bloodstream and converted to chylomicron
remnants that are cleared by the liver (3). Once in the liver, the cholesterol can
be repackaged into very low-density lipoproteins (VLDL) and secreted into the
bloodstream (4) or oxidized into bile acids under the control of cholesterol 7
alpha-hydroxylase (CYP7A1) (5). Additionally, hepatic de novo cholesterol
synthesis occurs under the control of HMG-CoA reductase (HMGR) and is the
main source of cholesterol secreted from the liver (6). VLDL secreted into the
bloodstream contain triglycerides and cholesterol (7). The VLDL particles unload
triglycerides through interaction with lipoprotein lipase and become intermediate
density lipoproteins (IDL) (8). As the ratio of cholesterol to triglycerides becomes
higher, the IDL particles become low density lipoproteins (LDL). LDL particles
bind the LDL receptor (LDLR) to unload cholesterol to peripheral tissues or clear
1
cholesterol from the bloodstream back into the liver (9). In the presence of
excess LDL cholesterol, deposition of cholesterol into the arterial lining can lead
to atherosclerosis, which will be discussed in further detail in Chapter 3.
High density lipoproteins (HDL) are the smallest and densest of the
lipoproteins. HDL are synthesized by the liver and secreted into the
bloodstream. Their main function is to transport cholesterol to steroidogenic
organs and the liver. They are capable of picking up cholesterol from the
cholesterol transporter ATP-binding cassette transporter AI (ABCAI), in the
process of cholesterol efflux from macrophages (10), an antiatherogenic process.
The collected cholesterol, in the form of cholesteryl esters, can be removed from
the HDL particle indirectly via exchange with the VLDL particle and uptake by the
downstream LDL receptor (LDLR) or directly by the HDL receptor scavenger
receptor BI (SR-BI) (11).
Important components of the transport lipoproteins are the
apolipoproteins. Apolipoproteins are proteins that bind lipids to form lipoproteins.
Apolipoprotein A-I is a major component of HDL and is a cofactor for lecithin
cholesterolacyltransferase (LCAT), an enzyme that converts free cholesterol to
cholesteryl ester (12). Apolipoprotein B48 and B100 are essential components of
VLDL, IDL, and LDL particles and act as ligands for the LDL receptor (13). Also
critical for cholesterol transport are the ATP-binding cassette transporters
ABCA1/G1 and ABCG5/G8. ABCA1 has been shown to regulate the process of
excess cholesterol efflux from macrophages to the ApoA-I component of HDL
2
(14). The ABCG5/G8 transporters function primarily in the intestine and liver and
act to limit absorption of dietary cholesterol (15).
Many of the genes involved in cholesterol metabolism are under
cholesterol feedback regulation. The sterol regulatory element-binding proteins
(SREBP) are sterol-sensing transcription factors of the basic-loop-helix-leucine
zipper (bHLH-Zip) family that activate cholesterolgenic genes when sterol levels
are low (16). SREBPs are membrane-bound and must be proteolytically cleaved
to act (17). When sterols are abundant, SREBPs are maintained in the
endoplasmic reticulum by SREBP cleavage activating protein (SCAP) and insulin
induced gene 1 (INSIG1) (18, 19). When sterol levels drop, SCAP allows site-1
cleavage to occur by Site-1 protease, which separates the functional domain of
SREBP from the regulatory domain (17). SREBP moves to the Golgi where site2 protease cleavage frees the NH2-terminal bHLH-Zip domain and allows for its
transport to the nucleus for transcriptional regulation of target genes (20). There
are three known SREBPS: SREBP-1a and SREBP-1c are produced from a
single gene and SREBP-2 is produced from a separate gene (20). SREBP-1 has
been shown to regulate genes involved in fatty acid metabolism while SREBP-2
is known to regulate genes involved in cholesterol metabolism (21).
Due to the necessity of cholesterol in physiological processes,
modifications in its metabolism can have deleterious effects. An important
controller of cholesterol metabolism is thyroid hormone. A low level of thyroid
hormone is clinically diagnosed as hypothyroidism. Patients with hypothyroidism
exhibit hyperlipidemia (22) and are at an increased risk for cardiovascular
3
disease (23). Treatment of hypothyroidism with thyroid hormone replacement
therapy was shown to result in a less atherogenic lipid profile consisting of
decreased plasma LDL cholesterol (24). Data from an ongoing clinical trial of a
thyroid hormone receptor agonist, MB07811, suggests lipid-lowering results in
patients with mild hypercholesterolemia (25). Also, the thyroid hormone mimetic,
KB2115, was able to decrease LDL cholesterol levels and stimulate bile acid
synthesis (26). Thus, thyroid hormone is an important component in the field of
cardiovascular disease.
Thyroid hormone is produced by the follicular cells of the thyroid gland in
response to thyroid stimulating hormone (TSH) released from the anterior
pituitary. Thyrotropin releasing hormone (TRH) from the hypothalamus
stimulates release of TSH from the pituitary (27). Thyroid hormone inhibits TSH
and TRH release from the pitiuitary and hypothalamus as a negative feedback
mechanism. Two forms of thyroid hormone exist in the body: thyroxine (T4) and
triiodothyronine (T3), which differ in iodine composition. Thyroxine makes up the
majority of thyroid hormone in the blood, has a longer half life than T3 and is less
potent. Thyroxine is converted to the biologically active form of thyroid hormone,
T3, within target cells by deiodinases that remove an iodine molecule (28, 29).
Most thyroid hormone in the blood circulates bound to thyroid binding globulin
(TBG), while only the free form has hormonal activity. Thyroid hormones
functions mainly to increase metabolism, but also have roles in brain maturation
during fetal development, regulation of long bone growth and sensitivity to
catecholamines (30, 31).
4
The mechanisms of thyroid hormone’s effects on cholesterol metabolism
have generally been well studied. Thyroid hormone is known to activate a
number of genes involved in cholesterol metabolism including the LDLR (32), the
cholesterol transporter genes ATP-binding cassette G5/G8 (ABCG5/G8) (33), the
rate-limiting enzyme in cholesterol biosynthesis HMGR (34), the rate-limiting
enzyme in bile acid synthesis CYP7AI (35), and the apolipoproteins ApoA-I and
ApoA-IV (36). Physiological effects of thyroid hormone activation of these genes
includes a decrease in circulating LDL cholesterol (37), a decrease in intestinal
absorption of dietary cholesterol (33), and increased biliary cholesterol secretion
(38). Though clinical utilization of thyroid hormone in treating
hypercholesterolemia is not as simple as administering T3 to patients, targeting
thyroid hormone receptor-beta agonists to the liver has been shown to reduce
cholesterol (39).
Of the effects on gene expression, the mechanism of thyroid hormone
activation of HMGR and the result of thyroid activation of ApoA-I and ApoA-IV
have not yet been determined. We utilized a hypophysectomized (Hx) SpragueDawley rat model treated ± thyroid hormone to investigate these areas of
cholesterol metabolism. The Hx rax is surgically altered to be hypothyroid with
the removal of its pituitary. The absence of a pituitary gland prevents secretion
of thyroid stimulating hormone (TSH) and its downstream control of thyroid
hormone. The hypothyroid Hx Sprague-Dawley rat demonstrates increased LDL
cholesterol, which can be restored with thyroid hormone treatment (Fig. 1). This
effect mimics the effect of thyroid hormone on LDL cholesterol observed in
5
humans and provides a good mammalian model to study cholesterol metabolism.
One caveat to this animal model is the disproportionate lipid profile relative to the
human profile. Humans maintain a greater proportion of total cholesterol in the
LDL fraction whereas most cholesterol is found in the HDL fraction in rat serum
(40). However, the variations in relative proportions of cholesterol do not affect
our studies. Of note is the absence of a gallbladder in rats, the organ that stores
bile. The herbivorous nature of the rat does not require a large amount of bile to
emulsify and absorb ingested animal fats. The rat liver does produce bile,
however, and the periportal plexus of bile ductules has been proposed as the bile
storage organ (41).
Figure 1. Thyroid Hormone Decreases Serum LDL Cholesterol in Hypothyroid
Rat. Serum was collected from normal and hypophysectomized rats treated ±T3.
Total serum serum LDL cholesterol is reported. Data are reported as the mean ±
standard error of the mean for each treatment. Statistically significant differences
are relative to Hx. For all conditions, n4 and * p<0.05.
6
Chapter Two
In vivo Identification of the Mechanism of Thyroid Hormone Activation of
HMGR
Introduction
Cholesterol metabolism and serum cholesterol levels are profoundly
affected by thyroid hormone (T3) status (42). Key genes that are involved in
regulating cholesterol metabolism include: LDL receptor, cholesterol 7
hydroxylase and HMG-CoA reductase (HMGR) (43). Each of these genes is
regulated at the level of transcription by T3 (43). Significant advances have been
made in defining the mechanisms by which T3 regulates LDL receptor and
cholesterol 7 hydroxylase (44, 45). The promoter elements and transcription
factors involved in T3 stimulation have been identified for these genes.
In
contrast, the elements and transcription factors mediating T3 induction of HMGR
have not yet been identified.
HMGR is the enzyme that catalyzes the rate-limiting step in cholesterol
biosynthesis. HMGR is regulated by various mechanisms including hormonal
(insulin, glucagon, thyroid hormone) and sterol (46-50). Hepatic HMGR activity
and gene expression is diminished in hypothyroid rats (50, 51).
Subsequent
treatment with thyroid hormone (T3) restores HMGR mRNA, protein, and activity
to levels actually greater than those observed in normal animals (50, 51).
Notably, there is a considerable lag time for full induction of both mRNA and
protein. The greatest levels of induction are measured at 72 to 96 hours post-
7
treatment, suggesting that the transcriptional response is not a direct effect.
Rather it has been shown that both RNA and protein synthesis are required to
achieve this T3-mediated induction (51).
The mechanism of thyroid hormone activation of gene transcription has
been well-studied. Activation of gene transcription by T3 is usually mediated by
thyroid
hormone
response
elements
(TRE),
often
of
the
DR4
type
(AGGTCAnnnnAGGTCA). Typically in liver, the nuclear receptor thyroid receptor
beta (TR-1) binds as a heterodimer with retinoic acid receptor (RXR-a) to
induce gene transcription in response to T3 (52). The long lag period for T3induction of hepatic HMGR suggests that T3 may act to increase expression of
some other protein, which in turn would activate HMGR transcription through
some element other than a TRE. Also, the lack of a consensus TRE in the
HMGR promoter required the consideration of non-traditional models of T3
stimulation.
Previous reports have identified upstream transcription factor-2 (USF-2),
nuclear factor-Y (NF-Y), and the sterol regulatory element binding proteins
(SREBP) as being necessary for the T3 response of other genes involved in
metabolism (53-56). USF-2 and NF-Y are ubiquitous transcription factors that
function on a variety of genes (57, 58). Though there has been no previous
description of a USF-2 binding site in the HMGR promoter, an earlier report from
our lab identified a NF-Y binding site in the proximal promoter of HMGR (59).
The -316/-321 site in the rat HMGR promoter conforms to a DR4 half site
8
(AGGTCA). Such a site was shown to mediate T3 induction of cholesterol 7
hydroxylase (45).
The HMGR promoter contains a sterol response element (SRE) to which
SREBP-2 and SREBP-1 have been shown to bind (60, 61).
SREBP-1 and
SREBP-2 are transcription factors that have been shown to function primarily on
genes involved in cholesterol, fatty-acid, and triglyceride metabolism (46, 60, 6267). The SREBP proteins typically interact with nearby transcription factors, such
as NF-Y, to control gene transcription (66, 68, 69). Previous work has shown
that hypothyroid mice have decreased levels of mature SREBP-2 protein, which
is induced by subsequent T3 treatment (70). Interestingly, studies have shown
that hypothyroid rats treated with either T3 or a combination of bile acid
sequestrant and statin exhibit similar inductions of SREBP-2 and HMGR
expression (70, 71), thus further linking SREBP-2 to T3 regulation of HMGR. We
hypothesized that the SREBP proteins may cooperate with additional
transcription factors to mediate the T3 response.
In this report, we utilized in vivo electroporation to characterize the
promoter elements and factors necessary for T3 induction of HMGR gene
expression. Electroporation subjects membranes to a high-voltage electric field
that results in the formation of pores that are large enough to allow DNA to enter
the cell (72, 73).
In vivo electroporation allows for introduction of promoter-
luciferase constructs directly into the liver of live animals (74, 75). A schematic of
the electroporation process is presented in Figure 2.
In vivo electroporation
results in transfection of hepatocytes within a well-defined region of the liver. In
9
vivo imaging of electroporation of an HMGR-promoter luciferase construct
demonstrates this precision (Fig. 3).
The -325/+70 region of the HMGR promoter was determined to be
sufficient for the full T3 response. We showed that the transcription factor USF-2
binds to the HMGR promoter in vivo and that USF-2 promoter binding is
increased 4-fold by T3. Furthermore, knockdown of USF-2, SREBP-2, and NF-Y
by siRNA abolished the T3-mediated induction of HMGR gene expression as
measured by promoter activity. Thus, USF-2, SREBP-2, and NF-Y appear to
play significant functional roles in mediating T3-induction of hepatic HMGR gene
expression.
Materials and Methods
Plasmid Construction. The rat HMGR promoter was amplified to -5683 from a
genomic BAC clone (CH230-263N2) from the rat genome using the Expand Long
Template PCR System (Roche). The -325/+70 HMGR promoter segments in
pGL3-Basic (Promega, Madison, WI) were obtained as previously described (59).
A -5123/+70 promoter fragment was obtained by using the primer sequences
listed in Table 1. This PCR product contains a NheI site at both ends for cloning.
The -3187/+70 and the -2314/+70 promoter fragments were prepared from this
large PCR product and cloned into pGL3-Basic vector using the restriction
enzymes MluI and SacI, respectively. All clones were confirmed by restriction
analysis and DNA sequencing at the Moffitt Molecular Biology Core Facility
(Tampa, FL).
10
Figure 2. In Vivo Electroporation Process. A, Liver is exposed; B, DNA is
injected below the capsule; C, Electrode is placed over site of injection and voltage
applied to introduce DNA into cell; D, Pattern of electrode remains for easy
identification of site.
11
Figure 3. In Vivo Imaging of in vivo electroporation. Fifty mg of wild-type
HMGR promoter plasmid was electroporated in the liver of a normal rat. Imaging
was performed 24 hours later using Xenogen in vivo Imager.
12
Experimental Animals. Hypophysectomized and normal male Sprague-Dawley
rats weighing 125 to 150 g were purchased from Harlan (Indianapolis, IN).
Hypophysectomized rats received Tekland Iodine Deficient chow and water ad
libitum and were housed in a reverse-cycle light controlled room with a 12-hour
light period followed by a 12-hour dark period. The rats were maintained on the
Iodine deficient diet for 20 days prior to being used in experiments in order to
achieve sufficient turnover of T4. Rats on the iodine deficient diet were given an
initial injection of 1.0 mg/kg T3 72 hours prior to electroporation and an additional
injection of 0.25 mg/kg T3 24 hours prior to electroporation. The rats were
euthanized at the mid-dark period when hepatic HMG-CoA reductase expression
is at its diurnal high, 24 hours following electroporation.
Table 1. Primer sequences used for cloning and site-directed mutagenesis.
Target
Sequence (5’3’)
Plasmid
-5123/+70
CTGAAGCTATGCTAGCAGCTACAGAAATGGAGCGCTCTTC
G
GAGAAGATGCTAGCATCTCAATGGAGGCCACCAAGC
SDM
SRE
CCGTGGTGAGAGATGTGTATTGTCCCGTTCTCCGCCCG
CGGGCGGAGAACGGGACAATACACATCTCTCACCACGG
USF-2
GCTCTTACGCGTCTGCCTTGACAATTCTGAGTTCGGGG
CCCCGAACTCAGAATTGTCAAGGCAGACGCGTAAGAGC
SP-1
GCGGTGCCCGTTCTCCGAAATTTGTCGAGCAGTGGG
CCCACTGCTCGACAAATTTCGGAGAACGGGCACCGC
CRE
GGGCGACCGTTCGGTCATGCTTCCGTCAGGCTGAGCAG
CTGCTCAGCCTGACGGAAGCATGACCGAACGGTCGCCC
13
Electroporation Equipment. An array of electrodes was used to administer
porating direct current pulses (DC) to liver. The electrode array was comprised
of a cylindrical molded plastic handle with six 30 gauge acupuncture needles
(NA2840, Suzhou Gusu Acupuncture & Moxitustion Appliance Co. Ltd., Japan)
protruding from one end. The needles were held in a fixed position at 60 degree
intervals in a 0.5 cm diameter circle. The needles extended 7 mm from the end
of the handle. The array was custom made at the University of South Florida
along with an instrument system to supply voltage to the needles. The
instrument system consisted of a Dell Dimensions 8200 personal
computer/monitor/keyboard, two mechanical relay boards (PCI-6521; National
Instruments, Austin, TX), a DC power supply (9312-PS; Marlin P. Jones and
Associates, Lake Park, FL), and LabVIEW software (National Instruments). The
LabVIEW software was used to write an application that utilized the computer
and relay boards to direct the output from the power supply to the needles in a
manner that rotated the applied voltage around the segment of liver delineated
by the array. A description of the pulsing order has been previously described
(76).
In Vivo Electroporation. Ten μg of HMG-CoA reductase promoter constructs and
mutants ligated to luciferase were directly introduced into the livers of rats by
electroporation as recently described (74) with minor modifications. Renilla
luciferase (Promega, Madison, WI) was co-electroporated at a 1:1000 dilution to
control for electroporation efficiency. The total volume of injected DNA was 50
14
μl. The 5 mm diameter, six-needle electrode array was used to deliver 6
rectangular DC electric pulses to the tissue. Each pulse had a potential of 75 V
and a duration of 150 ms. Pulses were administered with a 150 ms interval
between them. The voltage applied to the tissue corresponded to an electric field
strength of 150 V/cm.
Luciferase Assays. Twenty-four hours following electroporation, the livers were
harvested and tested for HMG-CoA reductase promoter activity by measuring
luciferase activity. Once removed, the electroporated regions of the liver were
extracted using a 5 mm cork-borer. Approximately 0.1 g of liver was placed in
600 l of passive lysis buffer (Promega) and homogenized using a tissue
disrupter. The lysate was centrifuged at 16,000 g for 5 minutes and the
supernatant assayed for luciferase activity using the dual luciferase assay kit
from Promega. Luciferase activity was calculated as the average ratio of firefly
(reporter) to renilla luciferase for at least 2 injection sites per animal.
Serum Preparation and Thyroid Hormone Assay. Blood was collected from
animals at time of euthanasia and centrifuged at 16,000 g for 5 min. Supernatant
(serum) was collected and used for determination of T3. The T3 assay from
Calbiotech (Spring Valley, CA) is a solid-phase competitive ELISA. Free T3 in
the serum competes with a T3 enzyme conjugate for binding to the anti-T3
monoclonal antibody that coats the assay wells.
15
Site-Directed Mutagenesis. Mutant plasmids were produced using the
QuikChange kit from Stratagene (Cedar Creek, TX). The plasmid consisted of
the double stranded DNA encoding the promoter with point mutations at the site
of the SRE, USF-2 site, NF-Y site, CRE, or SP1-like site. Primer sequences
used are listed in Table 1. The NF-Y mutant plasmid was previously prepared
(59).
Real Time PCR. Total RNA was isolated from rat livers using TRI Reagent
(Molecular Research Center, Cincinnati, OH) and resuspended in nuclease-free
water. RNA was then DNAse treated using the TURBO DNA-Free Kit (Ambion,
Austin, TX). cDNA was prepared using the Reverse Transcription System
(Promega) per the manufacturer’s protocol. Primer sequences used are listed in
Table 2. mRNA was quantified under the following reaction conditions: 95oC for
5 minutes, followed by 40 cycle of 95oC for 15 seconds, 61oC for 1 minute and
melt curve 55oC + 0.5oC each 10 seconds, x 80. All samples were run in
duplicate on a Bio-Rad Chromo4 DNAEngine thermal cycler using SYBR green
chemistry. Relative mRNA was calculated as a function of the internal control 18s
using Ct.
Nuclear Extract. Nuclei were prepared as previously described by centrifugation
through dense sucrose (59). Nuclei isolated from 2 g of rat liver were
resuspended in 1 ml of PBS containing 3 mM MgCl2 and were centrifuged at
3000 x g for 5 min at 4°C. Nuclear pellets were resuspended in 300 L of high
16
salt buffer (420 mM NaCl, 20 mM HEPES, pH 7.9, 1 mM EDTA, 1 mM EGTA,
20% glycerol, 20 mM NaF, 1 mM Na3VO4, 1 mM Na4P2O7, 1 mM dithiothreitol,
0.5 mM phenylmethylsulfonyl fluoride, 1x protease inhibitor mixture (Sigma, St.
Louis, MO). Nuclei were lysed by rotating slowly at 4°C for 30 minutes. The
lysates were then centrifuged at 16,000 x g for 15 min to pellet nuclear debris.
The supernatant (nuclear extract) was collected and protein concentrations
determined using the BCA Assay from Pierce (Rockford, IL).
Table 2. Primer sequences used for qPCR.
Target
Sequence (5’3’)
qPCR
HMGR
SREBP-2
TGTGGGAACGGTGACACTTA
CTTCAAATTTTGGGCACTCA
GGATCATCCAGCAGCCTTTGA
ACCGGGACCTGCTGCACCTGT
USF-2
CCCAGGATGTGCTTCAAACAGGAA
TCCTTCTCCGCTCCACTTCATTGT
NFY-B
AAGTTCAGAGAGGCCATGAAGGGA
TCTGCAGTTATTAACCCAGCCGGT
18s
CCATCCAATCGGTAGTAGCG
GTAACCCGTTGAACCCCATT
ChIP qPCR
USF-2
SREBP1/2,NFY
CCACACTCCAACTCTGACACGGT
CCGAGCCAACCAATGGCTAGT
ACTAGCCATTGGTTGGCTCGG
CGCCAATAAGGAAGGATCGTCCGAT
17
EMSA. Electrophoretic mobility shift assays were performed as previously
described (59). Briefly, probes corresponding to the wild type (Wt) SRE and
mutant (Mt) SRE were generated by annealing two complementary
oligonucleotides (Integrated DNA Technologies). Oligonucleotide sequences are
listed in Table 3. One pmol of probe was labeled by the Klenow fill-in reaction
using 20 Ci of [-32P] dCTP along with cold 0.125 mM dATP, dGTP, and dTTP.
Each probe (25 fmol) was incubated with 2.0 g of rat liver nuclear extract protein
in binding buffer (10 mM HEPES, pH 7.9, 25 mM KCl, 0.5 mM EDTA, 50 g/ml
poly(dI-dC), 5% glycerol, 0.5 mM DTT, 125 g/ml bovine serum albumin) for 30
minutes at room temperature. Binding reactions were run on a 6%
polyacrylamide gel in 0.25x TBE. For antibody supershift experiments, binding
reactions were incubated with 1-3 μg of antisera for 30 minutes prior to the
addition of probe. The antibodies were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA): PPAR (sc-9000x), tr-1 (sc-772x), USF2 (sc862x), SF1 (sc-28740x), ESR1 (sc-542x), RXRa (sc-553x), C/EBPa (sc-9314x),
USF1 (sc-8983x), USF2 (sc-861x), C/EBP (sc-746x), Sp1 (sc-17824x), HSTF1
(sc-9144x), ATF2 (sc-187), E4BP4 (sc-9550), SHP (sc-15283), FTF/LRH1 (sc5995x), and NFY (sc-7711x).
Chromatin Immunoprecipitation. Chromatin was prepared and
immunoprecipitated using the ChIP-IT Express kit from Active Motif (Carlsbad,
CA). The protocol was modified for liver tissue preparation. All named buffers
are included in the kit. Equal portions of liver (100 mg total) from 3 rats per
18
treatment group (±T3) were minced and fixed in 1% formaldehyde for 5 minutes
at room temperature. One mL of Glycine Stop-Fix Solution was added to stop
fixation and incubated for 5 minutes. Samples were centrifuged for 5 minutes at
720g. The pellets were resuspended in 6 ml scraping solution and centrifuged at
720g for 5 min. The pellets were resuspended in 1.5 ml ice-cold Lysis Buffer
supplemented with 7.5 μl protease inhibitors (PIC) and 7.5 μl PMSF and
incubated on ice for 30 minutes. The tissue was homogenized in a Dounce
homogenizer for 10 strokes on ice to release the nuclei. The homogenates were
then centrifuged at 2400g for 10 min at 4oC to pellet the nuclei. The nuclei were
resuspended in 1 ml of Complete Shearing Buffer supplemented with 5 μl PIC
and disrupted using an Ultrasonic model W-375 sonicator at 40% duty cycle and
output control at 3. Sonication was applied 5 times each for 15 seconds on, 30
seconds off, to shear chromatin. Chromatin size was checked by agarose
electrophoresis to ensure an average size between 200 and 500 bp. Chromatin
was precleared with 35 μl of magnetic beads per 500 μl chromatin by rotating at
4oC for 30 minutes and collected. Eighty μl of chromatin, 3 μg of antibody, and
25 μl of beads were used for each IP reaction. The antibodies used were:
SREBP-2 (Cayman Chemical, #10007663), USF-2 (SCBT, sc-861x), SREBP-1
(SCBT, sc-8984x), NF-Y (SCBT, sc-13045x), and RXR- (SCBT, sc-553x). The
negative and positive control antibodies were part of the ChIP-IT Kit. The
reactions were rotated at 4oC with antibody for 17 hours. Final DNA samples
were analyzed by qPCR in triplicate as described above. The relative level of
transcription factor binding was quantified by correcting for amount of input DNA
19
and negative control antibody DNA (background), which were performed in
parallel. Relative induction of binding was calculated as the ratio of relative
binding of the factor in the Hx +T3 chromatin preparation to the relative binding of
the factor in the Hx chromatin preparation. The data are the results of at least 3
independent immunoprecipitation experiments on pooled chromatin samples.
PCR products from ChIPs performed with antibodies to USF-2 and NF-Y were
also run on a 2% agarose gel to show in vivo binding of these factors. PCR was
carried out as described under real-time PCR methods above with the omission
of a melt curve.
Table 3. Primer sequences used for EMSA probes.
Target
Sequence (5’3’)
WT SRE
TGGTGAGAGATGGTGCGGTGCCCGTTCTCCG
CGATCGGAGAACGGGCACCGCACCATCTCTCACCA
MT SRE
TGGTGAGAGATGTGTATTGTCCCGTTCTCCG
CGATCGGAGAACGGGACAATACACATCTCTCACCA
WT USF2
GGAAACACCCTGCAGGTCAAATTCTGAGTTCGGGGTACT
CGATGAACTCAGAATTTGACCTGCAGGGTGTTTCC
MT USF2
GGAAACACCCTGCCTTGACAATTCTGAGTTC
CGATGAACTCAGAATTGTCAAGGCAGGGTGTTTCC
WT NF-Y
GCCTCCCGCCGATTGGCTAGGGGATCGGAC
CGATGTCCGATCCCCTAGCCAATCGGCGGGAGGC
MT NF-Y
GCCTCCCGCCGCGGTTCTAGGGGATCGGAC
CGATGTCCGATCCCCTAGAACCGCGGCGGGAGGC
20
siRNA Knockdown Study. Following the treatments described previously under
Experimental Animals, 5 μg of SREBP-2 siRNA (Dharmacon cat# L-081475-01),
or 20 μg of USF-2 siRNA (SABiosciences cat# SIR449799A-C), or NFY siRNA
(SABiosciences cat# SIR252807A-C) was co-electroporated with or without 10
μg -325/+70 HMGR promoter construct in a final volume of 50 μl using at least 2
sites per animal. The electroporated sites were removed 24 hours later using a 5
mm cork-borer. For NF-Y experiments, samples were also removed after 48 hrs.
Luciferase assays were performed as described above. qPCR was performed to
measure knock down of endogenous USF-2, SREBP-2, or NFY mRNA. Five μg
of Dharmacon cat# L-096650-01 siRNA was used as the negative control, as
electroporation of this siRNA did not knockdown the target gene.
Statistical Analyses. Data is expressed as the mean +/- standard error for a
minimum of 3 animals per group. Experimental treatments included
hypophysectomized Sprague-Dawley and hypophysectomized Sprague-Dawley
rats treated with T3.
Results
Functional Analysis of the HMGR Promoter
We utilized in vivo electroporation in a hypothyroid (Hx) rat model to
analyze the regulatory mechanism of T3 induced hepatic HMGR gene
expression. Hx rats were treated ± T3 96 hours before harvest of liver tissue to
measure hepatic HMGR gene expression by real-time PCR. HMGR gene
expression was induced approximately 2.7-fold by thyroid hormone (Fig. 4A). In
21
order to define the region of the HMGR promoter necessary for this induction,
four promoter-luciferase constructs inclusive of the HMGR promoter from -5683, 3190, -2314, or -325 to +70 bp were generated. The plasmids were
electroporated into the livers of Hx rats treated ±T3. We found that the -325/+70
region was sufficient to induce maximum thyroid hormone stimulation of HMGR
promoter activity (Fig. 4B). With this construct, a 2.5-fold induction of HMGR
promoter activity was observed in response to T3, which correlates well with the
increase observed in mRNA levels.
The -325/+70 region of the promoter is highly conserved in mammalian
species (Fig. 5). Specifically, the -316/-321 element, the sterol response element
(SRE), and the NF-Y binding sites all lie within regions of very high conservation
in the HMGR promoter. The element at -316/-321 is a conserved element that
serves as a near-consensus binding sequence for a TRE half-site, the USF-2
transcription factor (57), as well as other common transcription factors (77-79).
USF-2, SREBP-2, and NF-Y have previously been shown to function in T3
regulation of genes such as fatty acid synthase, S14, and carnitine
palmitoyltransferase-I (53-55). Thus, we hypothesized that T3 induction could
occur through these sites.
In an effort to identify the factor that binds to the -316/-321 region, we
performed EMSAs. Figure 6 shows an experiment in which a Wt probe to the 316/-321 region was incubated in a binding reaction with normal rat liver nuclear
extract. An unlabeled double-stranded oligonucleotide corresponding to the
exact sequence of the Wt with the exception of single nucleotide substitutions
22
was added in 50x molar excess relative to the radiolabeled probe in the
remaining lanes. The sequence at the top of the figure is the wild type promoter
sequence, with an arrow highlighting the nucleotide substitution in each lane. The
Wt band in Fig. 6 can be efficiently competed away with the cold wild-type
competitor (2nd lane). The mutants that were unable to compete away the wildtype binding represent the sequence AGGTCAAA_TCTG.
Figure 4. Thyroid Hormone Induces Hepatic HMGR. A, Real-time PCR analysis of
total HMGR mRNA isolated from livers of hypophysectomized rats treated ± T3. B, An
HMGR promoter construct inclusive of the -325/+70 region was electroporated into the
livers of hypophysectomized rats treated ±T3. Data are reported as the mean ±
standard error of the mean for each promoter construct. Statistically significant
differences are relative to Hx with wild-type construct. For all conditions, n4 and
*p<0.05.
23
Figure 5. -316/-321, SRE, and NF-Y Promoter Elements are Highly Conserved
across Species. Multiple sequence alignment was performed using the
CLUSTALW2 tool provided by EMBL-EBI. HMGR promoter sequences for H.
sapiens, R. norvegicus, and M. musculus were obtained from GenBank.
Nucleotides are labeled ± from the transcription start site.
We prepared plasmids inclusive of the -325/+70 promoter region (Wt) with
point mutations in each of these elements as well as the Sp1-like site at -145/138 and the cAMP response element at -104/-97. The mutated plasmids were
then introduced into the livers of Hx rats treated ±T3 as described previously.
Independent mutations in the -316/-321 element, SRE, and NFY binding site
resulted in essentially complete loss of the T3 induction (Fig. 7). These data
24
suggest that all three elements and their respective transcription factors are
necessary for T3-mediated induction of HMGR transcription. Mutations in the
SP1-like site and CRE did not abolish the T3 response of the HMGR promoter
(data not shown).
Figure 6. EMSA Analysis of the -325/-307 HMGR Promoter Region. EMSA of
single point mutations in the -325/-307 region. 50x competitor probes were used to
identify nucleotides that are necessary for binding to occur to the -316/-321
element. The wild-type promoter sequence is listed on top with an arrow pointing to
the point mutation in the competitor probe.
25
Figure 7. -316/-321, SRE, and NF-Y Promoter Elements are Necessary for the
Thyroid Hormone Response. HMGR promoter construct spanning the -325/+70
region (wild-type) as well as constructs with mutations in the -316/-321, SRE, or NFY binding sites were electroporated into the livers of hypophysectomized rats
treated ±T3 (n4). Data are reported as the mean ± standard error of the mean for
each promoter construct. Statistically significant differences are relative to Hx with
wild-type construct. *p<0.05
Binding of USF-2 to the HMGR Promoter
We used the online transcription factor prediction program PROMO to identify
a number of potential factors that could bind the -316/-321 sequence (80). We
used nuclear extract prepared from normal rats to perform EMSA antibody
supershift experiments with antisera to the transcription factor candidates (Fig.
8). Antisera for RXR and USF-2 produced shifted bands. Interestingly, the
TR-1 antisera did not produce a supershift. The USF-2 antibody (sc-861)
26
produced a shifted band, while the USF-2 antibody (sc-862) did not. The USF-2
(sc-862) antibody recognizes the C-terminus of USF-2, which functions as the
DNA-binding component of the protein, thus preventing the binding of the
antibody.
To confirm the binding of USF-2 to the HMGR promoter in vivo, ChIP
analysis was performed on pooled chromatin samples prepared from the livers of
Hx + T3 rats. PCR was performed on the immunoprecipitated DNA and products
were run on agarose gels for identification. USF-2 was found to bind the HMGR
promoter in vivo (Fig. 9). This is the first report of in vivo evidence showing USF2 binding to the HMGR promoter at -316/-321. Chromatin was then prepared in
two pools of 3 equal amounts of liver from Hx rats treated ±T3. ChIP assays
were performed and immunoprecipitated DNA analyzed using qPCR to measure
the induction of transcription factor binding to the HMGR promoter in response to
T3. Most notably, USF-2 binding was induced approximately 4-fold in response
to T3 (Fig. 10). The binding of SREBP-2 or NF-Y was not significantly increased
in response to T3 treatment.
siRNA Knockdown of Transcription Factors
In order to better understand the functional necessity of the USF-2, NF-Y,
and SREBP-2 transcription factors in the T3 induction of HMGR transcription, we
performed in vivo siRNA knockdown assays. We hypothesized that knockdown
of these necessary factors would mimic the results of our previous mutations in
the HMGR promoter elements and abolish the T3 response as measured by
27
HMGR promoter activity. In order to determine if siRNA knockdown could be
utilized to analyze the functional role of the identified transcription factors, we
measured the levels of mRNA for SREBP-2, SREBP-1, USF-2, and NF-Y in
response to T3 treatment (Fig. 11). We observed a 1.5-fold induction of SREBP2 mRNA in response to T3 treatment, which correlates with previous reports that
SREBP-2 mRNA is transcribed and protein translated in response to T3 treatment
(70). This narrow effect may be sufficient to drive T3 induction of HMGR
transcription, as previous studies have shown tight control of SREBP processing
(81). This mechanism is consistent with the long lag period for induction of
HMGR and suggests that knockdown of SREBP-2 may decrease induction of
HMGR by T3.
USF-2, SREBP-1, and NF-Y mRNAs were unchanged in response to T3.
USF-2 and NF-Y are ubiquitously expressed and function as transcription factors
for a number of unrelated genes (57, 58), which suggests that they may be less
sensitive to hormonal stimuli. The SREBP proteins are more specialized and
function primarily on genes involved in fatty-acid and lipid metabolism (65), which
themselves are frequently T3 responsive (53, 70)
siRNA to USF-2, SREBP-2, or NF-Y was electroporated into the livers of
Hx + T3 rats. Efficacy of siRNA knockdown was measured by qPCR analysis of
endogenous mRNA isolated from individual electroporation sites 24 hours
following electroporation. siRNA treatment resulted in maximal knockdown of
endogenous USF-2 to 82% of control and SREBP-2 to 51% of control (Fig. 12)
within 24 hours. siRNA to NF-Y required a greater period of time to achieve
28
optimal knockdown, with knockdown to 79% of control achieved at 24 hours and
to 24% of control at 48 hours.
Figure 8. EMSA Analysis of the -316/-321 HMGR Promoter Region. A probe
corresponding to the -325/-307 promoter region was incubated with 2 μg of pooled
nuclear extract prepared from the livers of normal rats. A. Three μg of antibody to
potential transcription factors was added to each binding reaction to obtain a
supershift of the protein-probe complex. B. Lane 1 shows binding reaction. Lanes
2-7 show the addition of increasing amounts of USF-2 antibody (1-6 μg).
29
Figure 9. USF-2 Binds to the HMGR Promoter. ChIP assays were performed on
pooled chromatin prepared from equal portions of liver collected from 3 Hx + T3
rats. Sheared chromatin was immunoprecipitated using the antibodies indicated.
Immunoprecipitated DNA was analyzed by PCR and products (220bp) were run on
a 2% agarose.
Having generated a considerable knockdown of endogenous mRNA, we
then co-electroporated the Wt HMGR plasmid with siRNA to each factor. siRNA
to USF-2 and SREBP-2 generated knockdown of HMGR promoter activity to
49% or 44% of control, respectively and essentially abolished the T3 response
(Fig. 12). This knockdown is consistent with the difference in Wt HMGR
promoter activity observed in the Hx rat compared to rats treated with T3 (Fig.
4B). Electroporation of NF-Y siRNA resulted in knockdown of HMGR promoter
activity that was highest after 48 hours. The knockdown at 24 hours was to 75%
of control compared to 57% of control at 48 hours (Fig. 12). These in vivo
knockdown assays indicate functional roles for USF-2, SREBP-2, and NFY in T3
activation of HMGR transcription.
30
Figure 10. USF-2 Binding to the HMGR Promoter is Increased 4-fold in
Response to T3. Two chromatin pools were prepared from equal portions of liver
collected from 3 rats in each treatment group (±T3). ChIP was performed for the
transcription factors listed.
Immunoprecipitated DNA was analyzed by qPCR in
triplicate. Fold-change in binding was calculated for at least three separate ChIP
experiments as the ratio of Hx + T3 binding to Hx binding. Statistically significant
differences are relative to the total input DNA set at 1. *p<0.05
Discussion
We utilized in vivo electroporation in a hypothyroid rat model to analyze
the regulatory mechanism of T3 induced hepatic HMGR gene expression.
Though the effect of T3 on HMGR transcription has been well documented (51,
71, 82, 83), little is known about the actual molecular mechanism responsible for
this regulation. Due to the significant lag time required for induction of HMGR
following T3 treatment and the necessity of mRNA and protein synthesis to
31
produce the response (51), we hypothesized that an atypical mechanism may be
involved in transcriptional activation. Furthermore, the lack of a consensus TRE
in the HMGR promoter suggests that T3 induction occurs via another mechanism.
Though we were unable to locate a TRE in the proximal promoter, it may be
worthwhile to search intronic sequences for a TRE, as this has been documented
for the carnitine palmitoyltransferase-I alpha gene (54).
Figure 11. Real-time PCR Analysis of the Effect of Thyroid Hormone on
Transcription Factors that Bind the HMGR Promoter. Total RNA was isolated
from livers of hypophysectomized rats treated ± T3 (n4). Quantitative real-time
PCR was performed to measure relative mRNA levels of USF-2, SREBP-2, NF-Y,
and SREBP-1. Statistically significant differences are relative to Hx mRNA for each
gene. *p<0.05
32
Figure 12. In Vivo siRNA Knockdown of Hepatic USF-2, SREBP-2, and NF-Y.
Total RNA was isolated from the livers of hypophysectomized rats treated with T3
and electroporated with 5 μg SREBP-2, 20 μg USF-2 or NF-Y siRNA, or saline
control (n3). qPCR was performed to measure relative endogenous mRNA levels
of each factor in response to the respective siRNA. Saline electroporation was set
to 100% as the control for each gene. siRNA knockdowns are presented as a
percentage of this control.
We measured a 2.5-fold induction of HMGR promoter activity with a Wt
plasmid corresponding to the -325/+70 region of the HMGR promoter. This value
agrees well with the 2.7-fold induction of HMGR mRNA as measured by qPCR.
Analysis of the HMGR promoter out to -5683 bp resulted in no additional
increase in HMGR promoter activity. The -325/+70 region of the promoter is
highly conserved in mammalian species. Specifically, the USF-2, the SRE, and
the NF-Y binding sites all lie within regions of high conservation in the HMGR
promoter. This suggests that the mechanism of T3 induction could likely occur
through these sites. Also, each of these factors have previously been shown to
function in the T3 regulation of genes such as fatty acid synthase, S14, carnitine
33
palmitoyltransferase-I, acetyl-CoA carboxylase-alpha, and ApoA-V (53-55, 84).
Correspondingly, mutations in each of these elements resulted in essentially
complete loss of T3 induction as measured by HMGR promoter activity.
Figure 13. In Vivo siRNA Knockdown Demonstrates the Functional roles of
USF-2, SREBP-2, and NF-Y on Hepatic HMGR Promoter Activity. An HMGR
promoter construct spanning the -325/+70 region (wild-type) and either 5 μg
SREBP-2 or 20 μg USF-2 or NF-Y siRNA were co-electroporated into the livers of
hypophysectomized rats treated with T3. Wild-type promoter activity was set to
100% as the control. siRNA knockdowns are presented as a percentage of this
control. Data are reported as the mean ± standard error of the mean for each
treatment. Statistically significant differences are relative to control (n3). * p<0.05,
† p<0.10
The binding of SREBP-1 and SREBP-2 to the HMGR promoter is well
established in the literature (60, 61) and in vitro and iv vivo assays have shown
NF-Y to bind the -65/-69 element (59, 61). However, there has been no report of
34
USF-2 binding to the -316/-321 element. Here we present data that provides in
vivo evidence of USF-2 binding to the HMGR promoter. A previous report has
shown this sequence to bind the LRH-1/FTF protein to mediate bile acid
regulation of HMGR, though we were unable to replicate this binding by EMSA
(85). It is not unusual for USF-2 to regulate genes involved in lipid metabolism,
as it has been identified as a regulator of Apolipoprotein A5 (84) and is
associated with familial combined hyperlipidemia (86).
ChIP analyses of a number of transcription factors show that USF-2
promoter binding is increased 4-fold with T3 treatment. It is possible that
although USF-2 is bound to the promoter in a basal state, additional USF-2
protein is recruited to the HMGR promoter in response to T3. USF-2 is a member
of the evolutionary conserved basic-helix-loop-helix-leucine zipper transcription
factor family (57) that functions as a homodimer or heterodimer with USF-1. The
USF proteins function in transcriptional activation via a number of pathways
including cooperative interaction with other factors (87), homo- and
heterodimerization and DNA looping (88), and the recruitment of histone
modifications (89). The most likely mechanism is the absence of USF-2 from the
Hx HMGR promoter and the subsequent recruitment of a USF-2 dimer or
tetramer in response to T3. The binding of other factors assayed was not greatly
increased in response to T3 treatment, suggesting that they may be required for
basal regulation of the gene, and while not solely responsible for the induction of
HMGR transcription, are indeed necessary.
35
In order to better understand the functional necessity of the USF-2, NF-Y,
and SREBP transcription factors in the T3 response of HMGR transcription, we
measured their gene expression in response to T3. Real-time PCR analysis of
SREBP-2 showed that SREBP-2 mRNA was modestly induced by T3 treatment
suggesting that knock down of this target may decrease the induction of HMGR
by T3. This narrow effect may be sufficient to drive T3 induction of HMGR
transcription, as previous studies have shown tight control of SREBP processing
(81). Real-time PCR analyses of USF-2 and NF-Y did not show an induction of
the mRNA for these genes in response to T3 treatment. These factors are
ubiquitously expressed and function as transcription factors for a number of
unrelated genes (57, 58), which implies that they may be less sensitive to
hormonal stimuli. The SREBP proteins are more specialized and function
primarily on genes involved in fatty-acid and lipid metabolism (63-66), which
themselves are frequently T3 responsive (53, 70, 90).
We hypothesized that knockdown of these necessary factors would mimic
the results of our previous mutations in the HMGR promoter elements and
abolish the T3 response as measured by HMGR promoter activity. We performed
in vivo siRNA experiments using the On-TARGETplus SMARTpool siRNAs from
Dharmacon or SureSilencing siRNA from SABiosciences. These pools contain
four duplexes all designed to target distinct sites within the specific gene of
interest, providing high efficiency of knockdown. Following successful
knockdown of endogenous targets, we then co-electroporated the Wt HMGR
plasmid with siRNA to each factor. siRNA to USF-2, SREBP-2, and NF-Y
36
essentially abolished the T3 response. This knockdown is consistent with the
difference in Wt HMGR promoter activity observed in the Hx rat compared to rats
treated with T3. It is pertinent to note that quantification of endogenous mRNA
knockdown (Fig. 12) may include hepatocytes that were not transfected with
siRNA due to the potential collection of extraneous tissue. This may result in
masking of the knockdown effect. In contrast, knockdown of HMGR promoter
activity (Fig. 13) is measured by luciferase assay, which only quantifies
successfully transfected cells. Thus, discrepancies in relative knockdown
between endogenous mRNA and promoter activity are expected.
In conclusion, the -325/+70 region of the HMGR promoter appears
sufficient for the full T3 response. The newly described element at -316/-321 was
shown to bind USF-2 in vivo. Binding of USF-2 to this element was markedly
increased by T3 treatment. The transcription factors USF-2, SREBP-2, and NF-Y
are necessary for the response, as mutations in the elements binding these
factors markedly diminished the T3 response. Furthermore, knockdown of USF2, SREBP-2, or NF-Y mRNA was able to nearly eliminate the T3 response, which
suggests functional roles for all of these factors in regulating hepatic HMGR
promoter activity. Even though T3 did not appear to cause significant increases
in binding of SREBP-2 or NF-Y to the HMGR promoter, the decreases observed
after siRNA treatment indicate that these factors are also required. Together,
these data provide a working model for T3 induction of HMGR gene expression.
37
Chapter 3
Thyroid Hormone Promotes Macrophage Cholesterol Efflux via ABCA1
Introduction
The deposition of excess cholesterol into the arterial lining and
subsequent hardening of the arteries is the well-known condition of
atherosclerosis. In this disease, circulating plasma LDL particles invade the
endothelium and become oxidized (91). The body’s inflammatory response
sends monocytes to the site of invasion that differentiate into macrophages (92).
These macrophages phagocytose the oxidized LDL and are transformed into
foam cells, which are retained in the endothelial wall (93). The accumulation of
foam cells leads to the formation of lesions in the arteries known as fatty streaks
(94). These are the first steps of atherosclerosis and are naturally occurring
processes that are result from high levels of LDL cholesterol (95).
The cholesterol transport mechanism that opposes this lipid deposition is
reverse cholesterol transport (RCT), or cholesterol efflux. RCT is a protective
mechanism that lessens the cholesterol burden in atherosclerotic plaques. This
process is mediated by lipid-poor circulating plasma HDL particles. HDL
particles are synthesized by the liver and secreted into the bloodstream. It has
been proposed that through interaction with hepatic ABCAI, the particles are
fitted with two to four molecules of ApoA-I (96, 97). These lipid-poor particles are
designated pre-beta HDL (98). In RCT, pre-beta HDL particles composed
38
primarily of nascent ApoA-I dock onto the cholesterol transporter ABCAI found in
cholesterol-laden macrophages (99). The ApoA-I c-terminal domain has been
shown to be necessary for cell-surface binding and cholesterol efflux from
macrophages (100). This interaction allows for lipidation of ApoAI (10) via
ABCAI and its subsequent transformation to a lipid-enriched particle (101, 102).
The cholesterol transporter ABCG1 has also been implicated in cholesterol efflux
to HDL (103, 104), however ABCA1 was shown to export cholesterol and
phospholipid to lipid-free apolipoproteins, while ABCG1 exports cholesterol to
phospholipid-containing acceptors and not necessarily apolipoproteins (105).
The pre-beta HDL particles become alpha-HDL particles as they circulate
through the bloodstream and collect cholesterol, a process mediated by
phospholipid transfer protein (PLTP) and cholesteryl ester transfer protein
(CETP) (106).
Given the ability of HDL to facilitate the efflux of cholesterol from
macrophages, it is not surprising that increased serum HDL cholesterol
correlates with decreased levels of atherosclerosis (107). This may be due to
higher levels of ApoA-I, the cholesterol acceptor on HDL. Treatments with ApoAI mimetics have been shown to increase the formation of pre-beta high-density
lipoprotein, increase cholesterol efflux, and reduce lipoprotein oxidation in vitro
and improve HDL inflammatory properties in humans with coronary heart disease
(108).
Apolipoprotein A-IV is a lesser studied apolipoprotein component of HDL.
But like ApoA-I, ApoA-IV has been shown to remove cholesterol from fibroblast
39
cells (109), mediate efflux via the ABCA1 transporter (110), and activate LCAT
(111). Additionally, it has been found to bind hepatocellular plasma membranes
(112). This effect may have important clinical implications, as ApoA-IV functions
as a ligand for HDL to bind a hepatic receptor site distinct from apoE-dependent
receptors (113).
Previous reports have identified the activation of hepatic ApoA-I and ApoIV by thyroid hormone. While little is known about the effect of this regulation,
thyroid hormone was shown to stabilize ApoA-IV mRNA (114). It is presently not
known whether thyroid hormone acts to increase the cholesterol efflux from cells
to acceptor HDL. In this study, we investigated the ability of serum from
hypothyroid rats treated ± thyroid hormone to stimulate cellular cholesterol efflux
via ABCA1 or ABCG1. Furthermore, we examined the effect of thyroid hormone
on serum lipoproteins.
Materials and Methods
Experimental Animals. Hypophysectomized and normal male Sprague-Dawley
rats weighing 125 to 150 g were purchased from Harlan (Indianapolis, IN).
Hypophysectomized rats received Tekland Iodine Deficient chow and water ad
libitum and were housed in a reverse-cycle light controlled room with a 12-hour
light period followed by a 12-hour dark period. The rats were maintained on the
Iodine deficient diet for at least 21 days prior to being used in experiments in
order to achieve sufficient turnover of T4. Rats on the iodine deficient diet were
given an initial injection of 1.0 mg/kg T3 72 hours prior to harvest of tissue and an
additional injection of 0.25 mg/kg T3 24 hours prior to harvest of tissue.
40
HDL and T3 Assays. Blood was collected and centrifuged at 16,000 x g for 5
min. The supernatant (serum) was collected and used for determinations of
HDL, apolipoproteins and T3. HDL levels were measured using the HDL and
LDL/VLDL Cholesterol Quantification Kit from BioVision (Cat# K613-100;
Mountain View, CA). T3 levels were measured using the Free T3 ELISA from
Calbiotech (Cat# F3106T; Spring Valley, CA)
RNA Isolation. A portion of about 200 mg was quickly excised from the livers of
the rats and immediately homogenized in 4 ml of Tri-Reagent from Molecular
Research Center (Cincinnati, OH) using a Polytron homogenizer at room
temperature. Aortas were removed from the diaphragm to the bifurcation of the
iliac arteries. The remainder of the isolation steps was carried out using volumes
corresponding to 4x the manufacturer’s recommendations. RNA concentrations
were determined by diluting each sample 1:100 and measuring their absorbance
at 260nm.
Microarray Analysis. Isolated RNA was further purified using the RNeasy kit from
Qiagen. To demonstrate that the RNA was indeed free of RNase activity,
samples were incubated in water at 42º C for 1 hr and then examined on 1%
agarose gels. An identical pattern of bands in unheated and heated samples
was obtained showing a lack of RNase activity. Microarray analysis was
performed by the Moffitt Core Facility (Tampa, FL) using the Affymetrix
41
GeneChip instrument system following the protocol established by Affymetrix,
Inc. Ten μg each of RNA from the livers of 3 Hx and 3 Hx+T3 rats was used in
the analysis. The RNA was converted to double-stranded cDNA using an
oligo(dT)24 primer containing a T7 RNA polymerase recognition sequence. The
product was transcribed into biotin-labeled cRNA using T7 RNA polymerase.
The biotinylated cRNA was hybridized to Affymetrix GeneChip Rat Genome 230
Plus 2.0 arrays which detects about 28,000 genes. Multiple oligos are used for
each gene with the data averaged. Scanned chip images were analyzed using
GeneChip algorithms.
Real Time PCR. To validate the microarray results, we assessed the expression
of a subset of genes using real-time PCR. RNA was DNAse treated using the
TURBO DNA-Free Kit (Ambion, Austin, TX). cDNA was prepared using the
Reverse Transcription System (Promega) per the manufacturer’s protocol.
Primer sequences used are listed in Table 4. mRNA was quantified under the
following reaction conditions: 95oC for 5 minutes, followed by 40 cycle of 95oC for
15 seconds, 61oC for 1 minute and melt curve 55oC + 0.5oC each 10 seconds, x
80. All samples were run in duplicate on a Bio-Rad Chromo4 DNAEngine
thermal cycler using SYBR green chemistry. Relative mRNA was calculated as a
function of the internal control 18s using Ct.
Macrophage Efflux Studies. Efflux studies were performed by the lab of George
Rothblat (Children’s Hospital of Philadelphia, PA) as previously described (115).
42
Briefly, J774 macrophage cells or BHK cells were obtained from Dr. Jack Oram,
University of Washington School of Medicine. Cells were grown in 10% FBSDMEM in the presence of antibiotics. Cells were radiolabeled in 2.5% FBSDMEM containing 1μci/ml 3H-cholesterol and 2mg, 113-818, an ACAT inhibitor
using 0.5 ml per well. J774 control cells and J774 cells expressing ABCA1 were
treated with 0.3mM cpt-cAMP for 16-18 hours to upregulate ABCA1. BHK cells
were treated with 10 nM mifepristone for 16-18 hours to upregulate ABCG1. All
efflux medium was prepared using serum from Hx rats treated ±T3 diluted to 2%
in DMEM-HEPES.
2D-DIGE. Two dimensional differential in-gel electrophoresis was performed by
Applied Biomics (Hayward, CA). Briefly, equal volumes of serum from 3 Hx rats
or 3 Hx + T3 rats was combined to form a pool for each treatment. A pool of
serum from 2 normal rats was included as a control. Each pool was fluorescently
labeled with different CyDye (red, yellow, blue) for downstream visualization.
The samples were run on first dimension isoelectric focusing and second
dimension SDS-PAGE. Differentially expressed proteins were quantified, cut out,
and subjected to in-gel trypsin digestion followed by protein identification by
MALDI-TOF mass spectrometry.
43
Table 4. Real-time PCR Primers
Target
Sequence (5’3’)
ABCA1
AAA CTC ACC CAG CAG CAG TTT GTG
AAG ACC AGG GCG ATG CAA ACA AAG
ABCG1
AGA ACT GGT CAA CAA CCC TCC TGT
ATC AGG GAC ACC ACT TGG AAG CAA
ApoA-I
TCC ACT TTG GGC AAA CAG CTG AAC
TCC TGT AGG CGA CCA ACA GTT GAA
ApoA-IV
CTT TGC CAA CGA GCT AAA GG
GCT GCT TGT TTC AGG TGT TTC C
ABCG5
TGA GCT CTT CCA CCA CTT CGA CAA
TGT CCA CCG ATG TCA AGT CCA TGT
ABCG8
TGC CCG GGA TGA TAC AGC AGT
TTC TGC TCC ATG GAT GAA CAG GGT
Results
Hepatic ApoA-I and ApoA-IV Gene Expression are Induced by Thyroid Hormone
We performed a microarray analysis on liver RNA isolated from Hx rats
treated ± T3 in order to determine the role of thyroid hormone on hepatic genes
involved in cholesterol metabolism. Table 5 shows a list of genes that were
found to positively or negatively respond to T3 treatment. The cholesterol
transporter ABCG5 and apolipoprotein A-IV showed the greatest T3 activation,
20-fold and 18-fold respectively. Phospholipase A2 showed the greatest
decrease at 142-fold less in response to T3. These results were validated by
real-time PCR analysis (Fig. 14). ApoA-IV was induced approximately 60-fold
and ABCG5 50-fold. Additionally, we quantified the induction of ApoA-I and
44
ABCG8 in response to T3, as they have been shown to be induced by T3. ApoA-I
was induced 8-fold and ABCG8 over 150-fold.
Table 5. Subset of hepatic thyroid hormone
responsive genes identified by microarray analysis.
Fold
Gene
Change
ABCG5
+ 20
ApoA-IV
+ 18
Malic Enzyme
+ 14
ABCB1A
+8
ABCD2
+7
Leptin Receptor
+6
IRE Binding Protein 1
+5
ABCC5
+4
HMGR
+2
LDLR
+2
SCAP
+2
ABCA8
-3
Insulin-like Growth Factor 2 BP 3
-5
Phospholipase A2, Group IIA
- 142
Serum ApoA-I and ApoA-IV Protein are Induced by Thyroid Hormone
The induction of the hepatic mRNA of ApoA-I and ApoA-IV suggested that
as more apolipoprotein is synthesized in the liver, additional protein would
circulate in the bloodstream. To measure changes in serum protein, we
performed 2D DIGE on pooled serum samples from normal and Hx rats treated
±T3 (Fig. 15). Gel spots that were found to have significant changes (over 2-fold)
in response to T3 treatment were trypsin digested and their protein identity
determined by MALDI-TOF mass spectrometry. The determined protein
sequences were compared to the database and those with high confidence (95100%) are listed in Table 6. Serum ApoA-I was found with 4 modifications and
45
increased 5-12–fold, depending on the modification. These modifications appear
to primarily affect the charge of the protein. Serum ApoA-IV was found in only
one form and was increased 2.4-fold by T3. Fetuin-A, serine protesase inhibitor
alpha 1, fibrinogen alpha subunit, and Clu protein were also increased.
Interestingly, ApoE was decreased 1.6-6.0 fold in response to T3.
Figure 14. Real-time PCR Validation of Thyroid Hormone Responsive Hepatic
Genes. A. ABCG5, B. ABCG8, C. ApoA-I, D. ApoA-IV. Data are reported as the
mean ± standard error of the mean for each treatment.
differences are relative to control (n3). * p<0.05, † p<0.10
46
Statistically significant
Figure 15. 2D DIGE of Rat Serum. Serum was pooled from 3 rats
treated ±T3 and ran on first dimension isoelectric focusing and second
dimension SDS-PAGE. Serum pools from Hx+T3 rats were labeled with
red CyDye and serum pools from Hx rats was labeled with green CyDye
The identities of the individual spots are listed in Table 6.
Thyroid Hormone Promotes Macrophage Cholesterol Efflux via ABCA1
The evidence for a role for thyroid hormone in cholesterol efflux has not
been investigated. Therefore, we conducted cholesterol efflux assays to
determine if thyroid hormone could promote cholesterol efflux. Using the J774
murine macrophage cell line or BHK cells, efflux via the ABCA1 or ABCG1
transporter can be measured. Treatment with serum from Hx rats treated ±T3
47
identified thyroid hormone-mediated cholesterol efflux via ABCA1 (Fig. 16).
Thyroid hormone did not induce efflux via ABCG1.
HDL cholesterol levels were measured and plotted relative to ABCA1
efflux to identify if the increase in efflux was a result of an increase in total
number of HDL particles (Fig.17). There was no correlation between HDL and
ABCA1 efflux, suggesting that the increase in cholesterol efflux is an effect
independent of HDL particle number.
Table 6. List of serum proteins induced by thyroid hormone
Spot
12
5
44
14
4
13
33
32
24
10
23
22
11
18
21
Protein
Apolipoprotein A-I
Fetuin-A
Apolipoprotein A-I
Preproapolipoprotein A-I
Fetuin-A
Apolipoprotein A-I
Fetuin-A
Fetuin-A
Serine protease inhibitor alpha 1
Fibrinogen alpha subunit
Clu protein
Clu protein
Apolipoprotein A-IV
Apolipoprotein E
Apolipoprotein E
48
Fold
Change
+ 12.5
+ 10.8
+ 8.54
+ 7.80
+ 6.12
+ 5.02
+ 4.57
+ 4.12
+ 3.61
+ 3.48
+ 3.29
+ 2.66
+ 2.38
- 3.45
- 8.62
Figure 16. Thyroid Hormone Increases Macrophage Cholesterol Efflux via the
ABCAI Cholesterol Transporter. Serum was collected from normal and
hypophysectomized rats treated ±T3. Relative ABCA1 efflux (A) and ABCG1 efflux
(B) was determined as described in Material and Methods. Data are reported as the
mean ± standard error of the mean for each treatment. Statistically significant
differences are relative to Hx. For all conditions, n4 and *p<0.05.
Figure 17. ABCA1 Efflux is Not Mediated by an Increase in Serum HDL
cholesterol. Serum was collected from normal and hypophysectomized rats
treated ±T3. Normalized ABCA1 efflux was plotted relative to serum HDL
cholesterol levels for individual serum samples.
49
Discussion
The role of thyroid hormone in cholesterol efflux was investigated in
Sprague-Dawley hypophysectomized rats treated ±T3. These hypothyroid rats
show moderately increased levels of LDL cholesterol that is markedly decreased
with thyroid hormone treatment, similar to the effects observed in humans (37,
42). We utilized this animal model to mimic the cholesterol transport pathways
under thyroid hormone control in the human. We performed microarray analysis
on hepatic RNA from Hx rats treated ±T3 to identify thyroid hormone-responsive
genes involved in cholesterol metabolism. Cholesterol-related genes with the
greatest inductions were ABCG5 and ApoA-IV. ABCG5 functions as a
membrane cholesterol transporter mainly in the liver and small intestine. Though
relevant to the entire cholesterol transport process, it is not specifically involved
in cholesterol efflux from macrophages. ApoA-IV is an apolipoprotein involved in
the transport of cholesterol, predominantly as a member of HDL (113). ApoA-IV
has also been shown to function as an acceptor in cholesterol efflux from
macrophages (110).
Phospholipase A2, Group IIA (PLA2) was the only gene significantly
down-regulated by thyroid hormone. PLA2 is a small lipolytic enzyme that
releases fatty acids from the second carbon of glycerol. PLA2 has been shown
to be up-regulated in hepatocytes in response to stress stimuli and secreted from
liver cells (116). More importantly, overexpression of PLA2 in mice increased the
incidence of atherosclerotic lesions, decreased plasma HDL, and increased
plasma LDL (117). PLA2 has been identified in atherosclerotic lesions (118) and
50
has been suggested to aid in the transformation of macrophages into foam-cells
by promoting macrophage LDL uptake (119, 120). The striking reduction in this
gene in response to thyroid hormone suggests an alternative antiatherogenic
property of T3.
We performed real-time PCR analysis to validate our microarray findings.
In addition to the inductions observed in ABCG5 and ApoA-IV, we also identified
increases in ABCG8 and ApoA-I. Like ABCG5, ABCG8 is a membrane
cholesterol transporter found in the liver and small intestine. ABCG5 and ABCG8
share a bidirectional promoter that is analyzed in the Chapter 4 of this report.
ApoA-I is the major apolipoprotein component of HDL. We hypothesized that the
increase in hepatic ApoA-IV and ApoA-I led to an increase in cholesterol loading
of HDL particles via efflux from the ABCA1 or ABCG1 transporters.
We analyzed the rat serum proteins differentially regulated by T3 using
2D-DIGE and downstream mass spectrometric protein analysis. The cholesterol
transport proteins with the greatest increases in the T3-treated serum were ApoAI and ApoA-IV. Depending on the posttranslational modification, an increase of
up to 12.5-fold was observed for ApoA-I and 2.4 for ApoA-IV. Since the total
amount of serum HDL is not increased in response to T3, it may be that the total
amount of ApoA-I or ApoA-IV per HDL particle increases. An increase in lipidaccepting apolipoprotein would facilitate the loading of additional cholesterol onto
HDL particles, as treatment with ApoA-I mimetic peptides was able to increase
cholesterol efflux (108). Serum ApoE, a component of chylomicrons and IDL and
some HDL, was decreased in response to T3 treatment. These results correlate
51
well with a previous study that demonstrated an increase in serum ApoE in
hypothyroid rats (121). The decrease in ApoE may signify the conversion of
more HDL particles to ApoA-I-rich particles capable of accepting cholesterol and
the decrease in a need for additional ApoE particles.
Finally, the effects of thyroid hormone on cholesterol efflux were examined
in two cell lines capable of inducing cholesterol efflux. Cholesterol efflux was
increased approximately 2-fold in cells expressing the ABCA1 transporter. There
was no increase in efflux in cells expressing the ABCG1 transporter. This is
consistent with previous reports that suggest an initial direct interaction between
lipid-poor ApoA-I and ABCA1 (96) that results in the transfer of cholesterol to
ApoA-I, followed by further lipidation via ABCG1 (103).
We have provided the first evidence of thyroid hormone induced
macrophage cholesterol efflux via the ABCA1 transporter. Based on an analysis
of serum protein, is seems that an increase in the amounts of ApoA-I and ApoAIV serum protein in the T3-treated serum in responsible for the additional
cholesterol accepting capacity of the associated lipoproteins.
52
Chapter 4
Analysis of the ABCG8 Promoter
Introduction
ABCG5 and ABCG8 (ABCG5/G8) are membrane transporters of the ATPbinding cassette transporter superfamily. ABCG5/G8 are half transporters that
form heterodimers to become functional (122). They are expressed primarily in
the small intestine and liver and function to limit the uptake of dietary cholesterol
from the intestine and promote biliary secretion of cholesterol from the liver (123,
124). Mutations in these genes have been well-documented to cause
sitosterolemia (15, 125, 126). This disease is characterized by high levels of
plasma plant sterols and increased levels of plasma cholesterol. ABCG5/G8 are
recognized as the main pathway for sterol secretion into the bile and thus play an
important role in cholesterol transport (127).
ABCG5 and ABCG8 are two distinct that genes that lie in a head-to-head
orientation and are under the control of a shared, bidirectional promoter (128).
We have minimal knowledge of the regulation of the shared promoter, however
liver receptor homologue 1 (LRH-1), nuclear factor 4 alpha (NF4), and GATA
have been shown to bind to this promoter (129, 130). There have been no
reports on the identification of hormone response elements.
ABCG5/G8 are regulated by thyroid hormone. A study of
hypophysectomized rats found that intestinal absorption of cholesterol was
doubled and could be normalized with thyroid hormone treatment. Also, hepatic
53
secretion of cholesterol and ABCG5/G8 expression are strongly stimulated in
hypophysectomized rats during treatment with thyroid hormone (33). We aimed
to identify the thyroid hormone response elements in the shared ABCG5/G8
promoter using EMSAs and in vivo electroporation.
Materials and Methods
Electrophoretic Mobility Shift Assay. EMSAs were performed as described in
Materials and Methods in Chapter 2. Additional probes are listed in Table 7. For
antibody supershift experiments, binding reactions were incubated with 3 μg of
antisera for 30 minutes prior to the addition of probe.
The antibodies were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA): TR-1 (sc-772x),
TR1 (sc-772x), RXR (sc-553x)
Plasmid Construction. The rat ABCG8 promoter was amplified to -444/+123 from
a genomic BAC clone (CH230-263N2) from the rat genome using the Expand
Long Template PCR System (Roche).
The -444/+123 promoter segment in
pGL3-Basic (Promega, Madison, WI) was obtained using the primer sequences:
forward 5’-GAA CCG GGT ACC ATA GGG TGG GAA GCC TA-3’ and reverse 5’GAA CCG GCT AGC GAC CTG CGG TGT TGT-3’. This PCR product contains
a KpnI site on the forward primer and NheI site on the reverse primer for cloning
into pGL3-Basic.
All clones were confirmed by restriction analysis and DNA
sequencing at the Moffitt Molecular Biology Core Facility (Tampa, FL).
54
Experimental Animals and In Vivo Electroporation were performed as described
under Materials and Methods in Chapter 2 with the ABCG8 promoter-luciferase
plasmid.
Table 7. ABCG8 Promoter EMSA Probes
Target
Sequence (5’ 3’)
1
ACAGAGGGCAGGTGATGGACCAGCCAAGGAA
CGATTTCCTTGGCTGGTCCATCACCTGCCCTCTGT
2
TAGACAGGCAGCCCAAAGCCCACAGGCCCAC
CGATGTGGGCCTGTGGGCTTTGGGCTGCCTGTCTA
3
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGAC
CGATGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
4
CGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCG
5
TGAATCCTCTGGTGTCCTGTCTGGCTTCA
CGATTGAAGCCAGACAGGACACCAGAGGATTCA
6
TTTAGCCAGAGTGTCCTTATCTCGACAAT
CGATATTGTCGAGATAAGGACACTCTGGCTAAA
7
CAACACCGCACCTCATGGCTGAGAAGACC
CGATGGTCTTCTCAGCCATGACCTGCGGTGTTG
8
CAAGATGAAACTGACCTTTCTTTCCTAC
CGATGTAGGAAAGAAAGGTCAGTTTCATCTTG
9
CACAGAATTAGTCCTAGTTCACCAC
CGATGTGGTGAACTAGGACTAATTCTGTG
Malic Enzyme
TRE
AGGACGTTGGGGTTAGGGGAGGACAGTG
CGATCACTGTCCTCCCCTAACCCCAACGTCCT
-420/-371 Wt
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATT
CAGGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTA
AGGGGACCCCACAGC
55
Table 8. ABCG8 Promoter Mutant EMSA Probes
Target
Sequence (5’3’)
1
TCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGA
2
GATGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACATC
3
GCGGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACCGC
4
GCTTTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCAAAGC
5
GCTGGGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCCCAGC
6
GCTGTTGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCAACAGC
7
GCTGTGTGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCACACAGC
8
GCTGTGGTGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACACCACAGC
9
GCTGTGGGTTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGAACCCACAGC
10
GCTGTGGGGGCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGCCCCCACAGC
11
GCTGTGGGGTACCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGTACCCCACAGC
12
GCTGTGGGGTCACCTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGTGACCCCACAGC
13
GCTGTGGGGTCCACTTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGTGGACCCCACAGC
14
GCTGTGGGGTCCCATTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAATGGGACCCCACAGC
15
GCTGTGGGGTCCCCGTACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTACGGGGACCCCACAGC
16
GCTGTGGGGTCCCCTGACCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTCAGGGGACCCCACAGC
17
GCTGTGGGGTCCCCTTCCCTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGGAAGGGGACCCCACAGC
56
Table 8 (Continued). ABCG8 Promoter Mutant EMSA Probes
Target
Sequence (5’3’)
18
GCTGTGGGGTCCCCTTAACTGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGTTAAGGGGACCCCACAGC
19
GCTGTGGGGTCCCCTTACATGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCATGTAAGGGGACCCCACAGC
20
GCTGTGGGGTCCCCTTACCGGACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTCCGGTAAGGGGACCCCACAGC
21
GCTGTGGGGTCCCCTTACCTTACGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGTAAGGTAAGGGGACCCCACAGC
22
GCTGTGGGGTCCCCTTACCTGCCGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCGGCAGGTAAGGGGACCCCACAGC
23
GCTGTGGGGTCCCCTTACCTGAAGCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGCTTCAGGTAAGGGGACCCCACAGC
24
GCTGTGGGGTCCCCTTACCTGACTCTGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCAGAGTCAGGTAAGGGGACCCCACAGC
25
GCTGTGGGGTCCCCTTACCTGACGATGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCATCGTCAGGTAAGGGGACCCCACAGC
26
GCTGTGGGGTCCCCTTACCTGACGCGGAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTCCGCGTCAGGTAAGGGGACCCCACAGC
27
GCTGTGGGGTCCCCTTACCTGACGCTTAAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTTAAGCGTCAGGTAAGGGGACCCCACAGC
28
GCTGTGGGGTCCCCTTACCTGACGCTGCAGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCTGCAGCGTCAGGTAAGGGGACCCCACAGC
29
GCTGTGGGGTCCCCTTACCTGACGCTGACGGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCCGTCAGCGTCAGGTAAGGGGACCCCACAGC
30
GCTGTGGGGTCCCCTTACCTGACGCTGAATGACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTCATTCAGCGTCAGGTAAGGGGACCCCACAGC
31
GCTGTGGGGTCCCCTTACCTGACGCTGAAGTACACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGTACTTCAGCGTCAGGTAAGGGGACCCCACAGC
32
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGCCACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTGGCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
33
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGAAACATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGTTTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
34
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACCCATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATGGGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
57
Table 8 (Continued). ABCG8 Promoter Mutant EMSA Probes
Target
Sequence (5’3’)
35
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACAAATTCAGGACACCTAA
CGATTTAGGTGTCCTGAATTTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
36
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACCTTCAGGACACCTAA
CGATTTAGGTGTCCTGAAGGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
37
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACAGTCAGGACACCTAA
CGATTTAGGTGTCCTGACTGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
38
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATGCAGGACACCTAA
CGATTTAGGTGTCCTGCATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
39
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTAAGGACACCTAA
CGATTTAGGTGTCCTTAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
40
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCCGGACACCTAA
CGATTTAGGTGTCCGGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
41
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCATGACACCTAA
CGATTTAGGTGTCATGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
42
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGTACACCTAA
CGATTTAGGTGTACTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
43
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGCCACCTAA
CGATTTAGGTGGCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
44
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGAAACCTAA
CGATTTAGGTTTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
45
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACCCCTAA
CGATTTAGGGGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
46
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACAACTAA
CGATTTAGTTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
47
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACATAA
CGATTTATGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
48
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCGAA
CGATTTCGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
49
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTCA
CGATTGAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
50
GCTGTGGGGTCCCCTTACCTGACGCTGAAGGACACATTCAGGACACCTAC
CGATGTAGGTGTCCTGAATGTGTCCTTCAGCGTCAGGTAAGGGGACCCCACAGC
58
Results
EMSA Analysis of the ABCG8 Promoter
Due to the large induction of ABCG5/G8 expression in response to thyroid
hormone, we analyzed the shared promoter for potential thyroid hormone
response elements (TREs). We identified 9 elements that could function as
TREs based on the canonical direct repeat-4 (DR-4) sequence:
AGGTCAnnnnAGGTCA. We used nuclear extract prepared from normal rats to
perform EMSA antibody supershift experiments with antisera to TR-1. The TR
antibody used in these experiments recognizes TR-1 and was the only
functional antibody identified for antibody supershift experiments. Radiolabeled
probes corresponding to the potential TREs in the ABCG8 promoter were
incubated with nuclear extract in the binding reactions labeled in Figure 18. A
probe to the known malic enzyme TRE served as a positive control. The probes
corresponding to the -420/-388 and -398/-371 promoter regions showed strong
shifted bands in the presence of TR-1 antibody. The probes corresponding to 233/-205 and -88/-60 promoter regions showed weakly shifted bands in the
presence of TR-1 antibody.
TR-1 and RXR Bind the ABCG8 Promoter
The binding reactions that resulted in antibody supershifts were then
incubated with antibody to RXR-, which heterodimerizes with TR-1 in
activation of thyroid hormone responsive genes. The probes corresponding to the
-420/-388 and -398/-371 promoter regions showed strong shifted bands in the
59
presence of either TR-1 or RXR or a combination of both (Fig. 19). The
probes corresponding to -233/-205 and -88/-60 promoter regions did not produce
strong shifted bands in any of the antibody treatments.
Figure 18. EMSA Analysis of the ABCG8 Promoter. Probes corresponding to
the identified promoter regions were incubated with 2 μg of pooled nuclear extract
prepared from the livers of normal rats. Three μg of TR antibody, which positively
recognizes TR-1, or a negative control TR-1 antibody was added to each binding
reaction to obtain a supershift of the protein-probe complex. The malic enzyme
TRE was used as a positive control.
Identification of a TRE at -392/-376
In an effort to identify the nucleotides in the -420/-371 promoter region to
which TR1 and RXR bind, we performed EMSAs with a radiolabeled probe to
the -420/-371 promoter region. The labeled Wt probe was incubated in a binding
reaction with normal rat liver nuclear extract. An unlabeled double-stranded
oligonucleotide corresponding to the exact sequence of the Wt with the exception
60
of single nucleotide substitutions was added in 50x molar excess relative to the
radiolabeled probe in the remaining lanes (Fig. 20). The sequence at the top of
the figure is the wild type promoter sequence, with an arrow highlighting the
nucleotide substitution in each lane. The Wt band in Figure 20 can be efficiently
competed away with the cold wild-type competitor (4th lane). The mutants that
were unable to compete away the wild-type binding represent the sequence at 392/-376: AGGACAcattcAGGACA.
Figure 19. TR-1 and RXR Bind the ABCG8 Promoter. Probes corresponding
to the identified promoter regions were incubated with 2 μg of pooled nuclear
extract prepared from the livers of normal rats. Three μg of TR antibody, which
positively recognizes TR-1, or RXR antibody, or a combination of both
antibodies, was added to each binding reaction to obtain a supershift of the proteinprobe complex.
61
Figure 20. EMSA Analysis of the -420/-371 ABCG8 Promoter Region. EMSA
using 50x competitor probes to identify nucleotides that are necessary for binding to
occur to the -420/-371 region. The wild-type promoter sequence is listed on top
with an arrow pointing to the point mutation in the competitor probe.
The -444/+123 ABCG8 Promoter Plasmid is not Functional by in vivo Electroporation.
The promoter region corresponding to the proximal promoter out to -444
was cloned into the pGL3-Basic luciferase plasmid backbone to evaluate the
thyroid hormone response by luciferase assay. The plasmid was electroporated
in the livers of normal rats and Hx rats treated ±T3 to determine if this region of
the promoter could induce a thyroid hormone response. Unfortunately, this
plasmid was not functional and did not produce luciferase activity over
background (Fig 21).
62
Figure 21. The -444/+123 ABCG8 Promoter Plasmid is not Functional by in
vivo Electroporation. An ABCG8 promoter construct inclusive of the -444/+123
region was electroporated into the livers of hypophysectomized rats treated ±T3.
Data are reported as the mean ± standard error of the mean for each promoter
construct.
Discussion
In hypophysectomized (Hx) rats, intestinal absorption of cholesterol is
doubled, and treatment with T3 normalizes this effect (33). The ATP-Binding
Cassette (ABC) transporters ABCG5 and ABCG8 function as half-transporters in
the intestine and liver to limit intestinal absorption and promote biliary excretion
of cholesterol, respectively (123, 124). Hepatic expression of both genes is
diminished in hypophysectomized rats, but is greatly induced (up to 100-fold) by
subsequent treatment with thyroid hormone. This suggests that ABCG5/8
function to mediate thyroid hormone-dependent biliary secretion of cholesterol.
63
Due to the drastic induction of these genes by T3, the shared promoter of these
genes was analyzed for thyroid hormone response elements (TREs). The
intergenic region, including the bidirectional promoter, is heavily conserved (128)
among several species. Multiple sequence alignment and transcription factor
prediction algorithms were applied to the sequences to identify potential TREs.
Nine regions of high conservation and high probability of TREs were identified.
These sequences were analyzed for TR-1 binding ability by EMSA. The -420/371 ABCG8 downstream region showed the strongest shifted bands in the
presence of TR-1 antibody. Within this region, the element
AGGACAcattcAGGACA was shown to be necessary for binding to occur.
Promoter luciferase plasmids were prepared to include this region (-444/+123)
and introduced into the livers of Hx rats treated ±T3 to determine if a thyroid
hormone response could be measure by luciferase activity. Unfortunately, the
prepared plasmid was not functional and produced no measurable luciferase
assay. Consequently, there was no observed T3 response in this plasmid.
Additional investigation and cloning of the rat ABCG8 promoter sequence
into the pGL3-Basic luciferase backbone did not provide a functional plasmid. A
reporter gene inclusive of a 358bp fragment of the murine ABCG5/G8 promoter
was also not functional as a promoter plasmid (131). Cloning of the
corresponding human sequence produced a functional promoter activity
response (128). We evaluated the possibility of a reading frame shift in the
cloned sequence, but did not find any alterations that would have affected
transcription initiation. It is unclear if this short sequence is incapable of
64
functioning as a minimal promoter or if other transcriptional mechanisms are
impaired.
65
Chapter 5
Final Conclusions and Discussion
Thyroid hormone exerts multiple and critical roles in cholesterol
metabolism. In general, thyroid hormone has atheroprotective effects that
include decreased circulating LDL cholesterol, decreased absorption of dietary
cholesterol, and increased biliary secretion of cholesterol (Fig. 22). These effects
are the result of thyroid hormone’s direct regulation of a number of hepatic and
intestinal genes involved in cholesterol metabolism. We examined the role of
thyroid hormone in three areas of cholesterol metabolism: i) hepatic cholesterol
synthesis under the control of HMG-CoA reductase, ii) macrophage cholesterol
efflux, and iii) ABCG5/G8-mediated biliary secretion of cholesterol.
The activation of HMGR by thyroid hormone has been well documented.
Throughout previous studies, however, the mechanism facilitating this activation
has been largely overlooked. We identified USF-2, SREBP-2, and NF-Y as
necessary factors in this activation using in vivo techniques. siRNA
coelectroporation studies demonstrated the necessity of these factors in thyroid
hormone induction of HMGR promoter activity. Quantitative ChIP analyses
suggested that while SREBP-2 and NF-Y are necessary factors for activation, the
relative amounts of promoter binding does not change in response to thyroid
hormone. However, thyroid hormone was shown to increase the relative binding
of USF-2 4-fold. We propose that in the absence of thyroid hormone, USF-2
66
does not bind the HMGR promoter. Upon thyroid hormone treatment, a dimer or
tetramer of USF-2 is recruited to the promoter thus activating HMGR transcription
(Fig. 23).
Figure 22. Combined Actions of Thyroid Hormone on Cholesterol Metabolism.
The atheroprotective effects of thyroid hormone include increased biliary secretion of
cholesterol, decreased intestinal absorption of cholesterol, and increased hepatic
uptake of cholesterol resulting in lower LDL cholesterol levels.
67
Figure 23. Proposed Model of HMGR Promoter. In the absence of thyroid
hormone USF-2 does not bind the HMGR promoter (top panel). Upon treatment with
thyroid hormone, USF-2 dimerizes and is recruited to the HMGR promoter, thus
stimulating transcription (bottom panel).
The ability to increase cholesterol efflux presents an intriguing treatment
for atherosclerosis. Lipid-poor ApoA-I particles are able to remove cholesterol
from atherogenic cholesterol-laden macrophages to be transported to the liver for
excretion. A model of selective delipidation of plasma HDL in primates
demonstrated decreased atherosclerosis in the presence of lipid-poor ApoA-I
(132). We determined that hepatic ApoA-I and ApoA-IV mRNA are increased by
thyroid hormone. This hepatic induction translates to increased serum ApoA-I
and ApoA-IV. Correspondingly, macrophage cholesterol efflux is induced via the
68
ABCA1 transporter and not the ABCG1 transporter in response to thyroid
hormone. We propose that the increase in serum ApoA-I and ApoA-IV facilitates
the increased cholesterol efflux from macrophages (Fig. 24). These data provide
further insight into the mechanisms of thyroid hormone’s atheroprotective effects
and potentially provide a therapeutic target for treating atherosclerosis. The
Metabasis TR agonist that targets the liver (MB07811) results in a reduction in
serum cholesterol and an induction of hepatic T3-responsive genes (39).
Unfortunately, the effects of the agonist on hepatic ApoA-I and ApoA-IV were not
examined. It would be interesting, and perhaps beneficial, to determine if a TR
agonist is able to increase serum ApoA-I and ApoA-IV with a downstream
induction of cholesterol efflux. The area of thyroid hormone-mediated cholesterol
efflux is a novel field of study that has the potential to provide success in treating
atherosclerosis.
Thyroid hormone regulation of biliary cholesterol secretion provides
another therapeutic target for hypercholesterolemia. The hepatic ABCG5/G8
cholesterol transporters are activated by thyroid hormone. Using EMSAs, we
identified a TR binding site at -392/-376 of the ABCG8 promoter. This TR
binding site presents a target for the TR agonist class of therapeutics. It would
be advantageous to the field of hypercholesterolemia research to ascertain if the
liver-specific TR agonist, MB07811, activates ABCG5/G8. Upregulation of
ABCG5/G8 should lead to increased biliary secretion of cholesterol, as was
identified in the hypophysectomized rat treated with thyroid hormone (33).
69
Figure 24. Thyroid Hormone Induces Cholesterol Efflux. Apolipoprotein
loading in the absence (upper left grey) and presence (lower right white) of thyroid
hormone. In the presence of T3, 1) Hepatic ApoA-I and ApoA-IV are induced
leading to increased levels of serum ApoA-I and ApoA-IV; 2) Lipid-poor HDL
particles have a greater capacity to accumulate cholesterol from macrophages via
the ABCA1 transporter; 3) Lipid-rich HDL completes the reverse cholesterol
transport process by delivering cholesterol to the liver via the LDL receptor
pathway.
The future role of thyroid hormone in treating hypercholesterolemia and
associated diseases may lie in the design of liver-specific TR agonists or other
factors involved in the mechanism of thyroid hormone activation of hepatic
genes. We hope that these present data will provide the research community
70
with additional incentive to develop useful T3 analogs to treat
hypercholesterolemia.
71
References
1.
Davis, H. R., Jr., Zhu, L. J., Hoos, L. M., Tetzloff, G., Maguire, M., Liu, J.,
Yao, X., Iyer, S. P., Lam, M. H., Lund, E. G., Detmers, P. A., Graziano, M.
P., and Altmann, S. W. (2004) Niemann-Pick C1 Like 1 (NPC1L1) is the
intestinal phytosterol and cholesterol transporter and a key modulator of
whole-body cholesterol homeostasis, J Biol Chem 279, 33586-33592.
2.
Altmann, S. W., Davis, H. R., Jr., Zhu, L. J., Yao, X., Hoos, L. M., Tetzloff,
G., Iyer, S. P., Maguire, M., Golovko, A., Zeng, M., Wang, L., Murgolo, N.,
and Graziano, M. P. (2004) Niemann-Pick C1 Like 1 protein is critical for
intestinal cholesterol absorption, Science 303, 1201-1204.
3.
Chappell, D. A., and Medh, J. D. (1998) Receptor-mediated mechanisms
of lipoprotein remnant catabolism, Prog Lipid Res 37, 393-422.
4.
Rustaeus, S., Lindberg, K., Stillemark, P., Claesson, C., Asp, L., Larsson,
T., Boren, J., and Olofsson, S. O. (1999) Assembly of very low density
lipoprotein: a two-step process of apolipoprotein B core lipidation, J Nutr
129, 463S-466S.
5.
Gregory, D. H., Vlahcevic, Z. R., Schatzki, P., and Swell, L. (1975)
Mechanism of secretion of biliary lipids. I. Role of bile canalicular and
microsomal membranes in the synthesis and transport of biliary lecithin
and cholesterol, J Clin Invest 55, 105-114.
6.
Swell, L., and Law, M. D. (1968) Synthesis of serum and sub-cellular liver
cholesterol esters in fasted and fed rats, J Nutr 95, 141-147.
7.
Wetterau, J. R., and Zilversmit, D. B. (1985) Purification and
characterization of microsomal triglyceride and cholesteryl ester transfer
protein from bovine liver microsomes, Chem Phys Lipids 38, 205-222.
8.
Marzetta, C. A., Foster, D. M., and Brunzell, J. D. (1990) Conversion of
plasma VLDL and IDL precursors into various LDL subpopulations using
density gradient ultracentrifugation, Journal of lipid research 31, 975-984.
72
9.
Brown, M. S., and Goldstein, J. L. (1984) How LDL receptors influence
cholesterol and atherosclerosis, Sci Am 251, 58-66.
10.
Marcel, Y. L., Ouimet, M., and Wang, M. D. (2008) Regulation of
cholesterol efflux from macrophages, Curr Opin Lipidol 19, 455-461.
11.
Ira Thabrew, R. M. A., and Claire Wicks (2001) Biochemistry for Clinical
Medicine, Cambridge University Press.
12.
Zannis, V. I., Chroni, A., and Krieger, M. (2006) Role of apoA-I, ABCA1,
LCAT, and SR-BI in the biogenesis of HDL, J Mol Med 84, 276-294.
13.
Olofsson, S. O., and Boren, J. (2005) Apolipoprotein B: a clinically
important apolipoprotein which assembles atherogenic lipoproteins and
promotes the development of atherosclerosis, J Intern Med 258, 395-410.
14.
Zha, X., Gauthier, A., Genest, J., and McPherson, R. (2003) Secretory
vesicular transport from the Golgi is altered during ATP-binding cassette
protein A1 (ABCA1)-mediated cholesterol efflux, J Biol Chem 278, 1000210005.
15.
Lee, M. H., Lu, K., Hazard, S., Yu, H., Shulenin, S., Hidaka, H., Kojima,
H., Allikmets, R., Sakuma, N., Pegoraro, R., Srivastava, A. K., Salen, G.,
Dean, M., and Patel, S. B. (2001) Identification of a gene, ABCG5,
important in the regulation of dietary cholesterol absorption, Nat Genet 27,
79-83.
16.
Parraga, A., Bellsolell, L., Ferre-D'Amare, A. R., and Burley, S. K. (1998)
Co-crystal structure of sterol regulatory element binding protein 1a at 2.3
A resolution, Structure 6, 661-672.
17.
Brown, M. S., and Goldstein, J. L. (1997) The SREBP pathway: regulation
of cholesterol metabolism by proteolysis of a membrane-bound
transcription factor, Cell 89, 331-340.
18.
Adams, C. M., Goldstein, J. L., and Brown, M. S. (2003) Cholesterolinduced conformational change in SCAP enhanced by Insig proteins and
mimicked by cationic amphiphiles, Proceedings of the National Academy
of Sciences of the United States of America 100, 10647-10652.
73
19.
Sun, L. P., Li, L., Goldstein, J. L., and Brown, M. S. (2005) Insig required
for sterol-mediated inhibition of Scap/SREBP binding to COPII proteins in
vitro, J Biol Chem 280, 26483-26490.
20.
Brown, M. S., and Goldstein, J. L. (1999) A proteolytic pathway that
controls the cholesterol content of membranes, cells, and blood, Proc Natl
Acad Sci U S A 96, 11041-11048.
21.
Eberle, D., Hegarty, B., Bossard, P., Ferre, P., and Foufelle, F. (2004)
SREBP transcription factors: master regulators of lipid homeostasis,
Biochimie 86, 839-848.
22.
O'Brien, T., Dinneen, S. F., O'Brien, P. C., and Palumbo, P. J. (1993)
Hyperlipidemia in patients with primary and secondary hypothyroidism,
Mayo Clin Proc 68, 860-866.
23.
Neves, C., Alves, M., Medina, J. L., and Delgado, J. L. (2008) Thyroid
diseases, dyslipidemia and cardiovascular pathology, Rev Port Cardiol 27,
1211-1236.
24.
Martinez-Triguero, M. L., Hernandez-Mijares, A., Nguyen, T. T., Munoz,
M. L., Pena, H., Morillas, C., Lorente, D., Lluch, I., and Molina, E. (1998)
Effect of thyroid hormone replacement on lipoprotein(a), lipids, and
apolipoproteins in subjects with hypothyroidism, Mayo Clin Proc 73, 837841.
25.
(2008) Metabasis Announces Promising Results from its Phase 1b Clinical
Trial for MB07811, its Novel Product Candidate for the Treatment of
Hyperlipidemia, in Medical News Today.
26.
Berkenstam, A., Kristensen, J., Mellstrom, K., Carlsson, B., Malm, J.,
Rehnmark, S., Garg, N., Andersson, C. M., Rudling, M., Sjoberg, F.,
Angelin, B., and Baxter, J. D. (2008) The thyroid hormone mimetic
compound KB2115 lowers plasma LDL cholesterol and stimulates bile
acid synthesis without cardiac effects in humans, Proc Natl Acad Sci U S
A 105, 663-667.
27.
Chiamolera, M. I., and Wondisford, F. E. (2009) Minireview: Thyrotropinreleasing hormone and the thyroid hormone feedback mechanism,
Endocrinology 150, 1091-1096.
74
28.
McCann, U. D., Shaw, E. A., and Kaplan, M. M. (1984) Iodothyronine
deiodination reaction types in several rat tissues: effects of age, thyroid
status, and glucocorticoid treatment, Endocrinology 114, 1513-1521.
29.
Kaplan, M. M. (1984) The role of thyroid hormone deiodination in the
regulation of hypothalamo-pituitary function, Neuroendocrinology 38, 254260.
30.
Robson, H., Siebler, T., Shalet, S. M., and Williams, G. R. (2002)
Interactions between GH, IGF-I, glucocorticoids, and thyroid hormones
during skeletal growth, Pediatric research 52, 137-147.
31.
Leonard, J. L. (2008) Non-genomic actions of thyroid hormone in brain
development, Steroids 73, 1008-1012.
32.
Ness, G. C., and Zhao, Z. (1994) Thyroid hormone rapidly induces hepatic
LDL receptor mRNA levels in hypophysectomized rats, Arch Biochem
Biophys 315, 199-202.
33.
Galman, C., Bonde, Y., Matasconi, M., Angelin, B., and Rudling, M. (2008)
Dramatically increased intestinal absorption of cholesterol following
hypophysectomy is normalized by thyroid hormone, Gastroenterology 134,
1127-1136.
34.
Ness, G. C., Dugan, R. E., Lakshmanan, M. R., Nepokroeff, C. M., and
Porter, J. W. (1973) Stimulation of hepatic beta-hydroxy-betamethylglutaryl coenzyme A reductase activity in hypophysectomized rats
by L-triiodothyronine, Proc Natl Acad Sci U S A 70, 3839-3842.
35.
Ness, G. C., Pendelton, L. C., and Zhao, Z. (1994) Thyroid hormone
rapidly increases cholesterol 7 alpha-hydroxylase mRNA levels in
hypophysectomized rats, Biochim Biophys Acta 1214, 229-233.
36.
Apostolopoulos, J. J., La Scala, M. J., and Howlett, G. J. (1988) The effect
of triiodothyronine on rat apolipoprotein A-I and A-IV gene transcription,
Biochem Biophys Res Commun 154, 997-1002.
37.
Abrams, J. J., and Grundy, S. M. (1981) Cholesterol metabolism in
hypothyroidism and hyperthyroidism in man, J Lipid Res 22, 323-338.
75
38.
Gebhard, R. L., and Prigge, W. F. (1992) Thyroid hormone differentially
augments biliary sterol secretion in the rat. II. The chronic bile fistula
model, J Lipid Res 33, 1467-1473.
39.
Erion, M. D., Cable, E. E., Ito, B. R., Jiang, H., Fujitaki, J. M., Finn, P. D.,
Zhang, B. H., Hou, J., Boyer, S. H., van Poelje, P. D., and Linemeyer, D.
L. (2007) Targeting thyroid hormone receptor-beta agonists to the liver
reduces cholesterol and triglycerides and improves the therapeutic index,
Proc Natl Acad Sci U S A 104, 15490-15495.
40.
Vitic, J., and Stevanovic, J. (1993) Comparative studies of the serum
lipoproteins and lipids in some domestic, laboratory and wild animals,
Comp Biochem Physiol B 106, 223-229.
41.
Murakami, T., Sato, H., Nakatani, S., Taguchi, T., and Ohtsuka, A. (2001)
Biliary tract of the rat as observed by scanning electron microscopy of cast
samples, Arch Histol Cytol 64, 439-447.
42.
Illingworth, D. R., McClung, M. R., Connor, W. E., and Alaupovic, P.
(1981) Familial hypercholesterolaemia and primary hypothyroidism:
coexistence of both disorders in a young woman with severe
hypercholesterolaemia, Clin Endocrinol (Oxf) 14, 145-152.
43.
Weitzel, J. M., Hamann, S., Jauk, M., Lacey, M., Filbry, A., Radtke, C.,
Iwen, K. A., Kutz, S., Harneit, A., Lizardi, P. M., and Seitz, H. J. (2003)
Hepatic gene expression patterns in thyroid hormone-treated hypothyroid
rats, J Mol Endocrinol 31, 291-303.
44.
Lopez, D., and Ness, G. C. (2006) Characterization of the rat LDL receptor
5'-flanking region, Biochim Biophys Acta 1761, 492-500.
45.
Shin, D. J., Plateroti, M., Samarut, J., and Osborne, T. F. (2006) Two
uniquely arranged thyroid hormone response elements in the far upstream
5' flanking region confer direct thyroid hormone regulation to the murine
cholesterol 7alpha hydroxylase gene, Nucleic Acids Res 34, 3853-3861.
46.
Dooley, K. A., Millinder, S., and Osborne, T. F. (1998) Sterol regulation of
3-hydroxy-3-methylglutaryl-coenzyme A synthase gene through a direct
interaction between sterol regulatory element binding protein and the
trimeric CCAAT-binding factor/nuclear factor Y, J Biol Chem 273, 13491356.
76
47.
Lakshmanan, M. R., Nepokroeff, C. M., Ness, G. C., Dugan, R. E., and
Porter, J. W. (1973) Stimulation by insulin of rat liver -hydroxy- methylglutaryl coenzyme A reductase and cholesterol-synthesizing
activities, Biochem Biophys Res Commun 50, 704-710.
48.
Ness, G. C. (1983) Regulation of 3-hydroxy-3-methylglutaryl coenzyme A
reductase, Mol Cell Biochem 53-54, 299-306.
49.
Dugan, R. E., Ness, G. C., Lakshmanan, M. R., Nepokroeff, C. M., and
Porter, J. W. (1974) Regulation of hepatic beta-hydroxy-betamethylglutaryl coenzyme A reductase by the interplay of hormones, Arch
Biochem Biophys 161, 499-504.
50.
Simonet, W. S., and Ness, G. C. (1987) Turnover rates of HMG-CoA
reductase mRNA: role of pituitary and thyroid hormones, Biochem Biophys
Res Commun 146, 1033-1039.
51.
Simonet, W. S., and Ness, G. C. (1988) Transcriptional and
posttranscriptional regulation of rat hepatic 3-hydroxy-3-methylglutarylcoenzyme A reductase by thyroid hormones, J Biol Chem 263, 1244812453.
52.
Harvey, C. B., and Williams, G. R. (2002) Mechanism of thyroid hormone
action, Thyroid 12, 441-446.
53.
Yin, L., Zhang, Y., and Hillgartner, F. B. (2002) Sterol regulatory elementbinding protein-1 interacts with the nuclear thyroid hormone receptor to
enhance acetyl-CoA carboxylase-alpha transcription in hepatocytes, J Biol
Chem 277, 19554-19565.
54.
Jackson-Hayes, L., Song, S., Lavrentyev, E. N., Jansen, M. S., Hillgartner,
F. B., Tian, L., Wood, P. A., Cook, G. A., and Park, E. A. (2003) A thyroid
hormone response unit formed between the promoter and first intron of
the carnitine palmitoyltransferase-Ialpha gene mediates the liver-specific
induction by thyroid hormone, J Biol Chem 278, 7964-7972.
55.
Jump, D. B., Badin, M. V., and Thelen, A. (1997) The CCAAT box binding
factor, NF-Y, is required for thyroid hormone regulation of rat liver S14
gene transcription, J Biol Chem 272, 27778-27786.
77
56.
Jump, D. B., Thelen, A. P., and Mater, M. K. (2001) Functional interaction
between sterol regulatory element-binding protein-1c, nuclear factor Y,
and 3,5,3'-triiodothyronine nuclear receptors, J Biol Chem 276, 3441934427.
57.
Corre, S., and Galibert, M. D. (2006) USF as a key regulatory element of
gene expression, Med Sci (Paris) 22, 62-67.
58.
Mantovani, R. (1998) A survey of 178 NF-Y binding CCAAT boxes,
Nucleic Acids Res 26, 1135-1143.
59.
Lagor, W. R., de Groh, E. D., and Ness, G. C. (2005) Diabetes alters the
occupancy of the hepatic 3-hydroxy-3-methylglutaryl-CoA reductase
promoter, J Biol Chem 280, 36601-36608.
60.
Vallett, S. M., Sanchez, H. B., Rosenfeld, J. M., and Osborne, T. F. (1996)
A direct role for sterol regulatory element binding protein in activation of 3hydroxy-3-methylglutaryl coenzyme A reductase gene, J Biol Chem 271,
12247-12253.
61.
Bennett, M. K., Seo, Y. K., Datta, S., Shin, D. J., and Osborne, T. F.
(2008) Selective binding of sterol regulatory element-binding protein
isoforms and co-regulatory proteins to promoters for lipid metabolic genes
in liver, J Biol Chem 283, 15628-15637.
62.
Chouinard, R. A., Jr., Luo, Y., Osborne, T. F., Walsh, A., and Tall, A. R.
(1998) Sterol regulatory element binding protein-1 activates the
cholesteryl ester transfer protein gene in vivo but is not required for sterol
up-regulation of gene expression, J Biol Chem 273, 22409-22414.
63.
Horton, J. D., Goldstein, J. L., and Brown, M. S. (2002) SREBPs:
transcriptional mediators of lipid homeostasis, Cold Spring Harb Symp
Quant Biol 67, 491-498.
64.
Horton, J. D., Goldstein, J. L., and Brown, M. S. (2002) SREBPs:
activators of the complete program of cholesterol and fatty acid synthesis
in the liver, J Clin Invest 109, 1125-1131.
65.
Amemiya-Kudo, M., Shimano, H., Hasty, A. H., Yahagi, N., Yoshikawa, T.,
Matsuzaka, T., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Osuga, J.,
78
Harada, K., Gotoda, T., Sato, R., Kimura, S., Ishibashi, S., and Yamada,
N. (2002) Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to
different target promoters of lipogenic and cholesterogenic genes, J Lipid
Res 43, 1220-1235.
66.
Nagai, M., Sakakibara, J., Nakamura, Y., Gejyo, F., and Ono, T. (2002)
SREBP-2 and NF-Y are involved in the transcriptional regulation of
squalene epoxidase, Biochem Biophys Res Commun 295, 74-80.
67.
Horton, J. D., Shimomura, I., Brown, M. S., Hammer, R. E., Goldstein, J.
L., and Shimano, H. (1998) Activation of cholesterol synthesis in
preference to fatty acid synthesis in liver and adipose tissue of transgenic
mice overproducing sterol regulatory element-binding protein-2, J Clin
Invest 101, 2331-2339.
68.
Ericsson, J., Jackson, S. M., and Edwards, P. A. (1996) Synergistic
binding of sterol regulatory element-binding protein and NF-Y to the
farnesyl diphosphate synthase promoter is critical for sterol-regulated
expression of the gene, J Biol Chem 271, 24359-24364.
69.
Ericsson, J., Jackson, S. M., Lee, B. C., and Edwards, P. A. (1996) Sterol
regulatory element binding protein binds to a cis element in the promoter
of the farnesyl diphosphate synthase gene, Proc Natl Acad Sci U S A 93,
945-950.
70.
Shin, D. J., and Osborne, T. F. (2003) Thyroid hormone regulation and
cholesterol metabolism are connected through Sterol Regulatory ElementBinding Protein-2 (SREBP-2), J Biol Chem 278, 34114-34118.
71.
Sample, C. E., Pendleton, L. C., and Ness, G. C. (1987) Regulation of 3hydroxy-3-methylglutaryl coenzyme A reductase mRNA levels by Ltriiodothyronine, Biochemistry 26, 727-731.
72.
Potter, H., Weir, L., and Leder, P. (1984) Enhancer-dependent expression
of human kappa immunoglobulin genes introduced into mouse pre-B
lymphocytes by electroporation, Proc Natl Acad Sci U S A 81, 7161-7165.
73.
Potter, H. (2001) Transfection by electroporation, Curr Protoc Immunol
Chapter 10, Unit 10 15.
79
74.
Lagor, W. R., Heller, R., de Groh, E. D., and Ness, G. C. (2007)
Functional analysis of the hepatic HMG-CoA reductase promoter by in
vivo electroporation, Exp Biol Med (Maywood) 232, 353-361.
75.
Muramatsu, T., Ito, N., Tamaoki, N., Oda, H., and Park, H. M. (2001) In
vivo gene electroporation confers nutritionally-regulated foreign gene
expression in the liver, Int J Mol Med 7, 61-66.
76.
Gilbert, R. A., Jaroszeski, M. J., and Heller, R. (1997) Novel electrode
designs for electrochemotherapy, Biochim Biophys Acta 1334, 9-14.
77.
Murad, H., Collet, P., Brunner, E., Schohn, H., Becuwe, P., Devignes, M.
D., Dauca, M., and Domenjoud, L. (2007) Immunoselection and
characterization of a human genomic PPAR binding fragment located
within POTE genes, Biochimie 89, 329-336.
78.
Zhang, Z., Chen, K., Shih, J. C., and Teng, C. T. (2006) Estrogen-related
receptors-stimulated monoamine oxidase B promoter activity is downregulated by estrogen receptors, Mol Endocrinol 20, 1547-1561.
79.
Malo, M. S., Pushpakaran, P., and Hodin, R. A. (2005) A 'Swinging Cradle'
model for in vitro classification of different types of response elements of a
nuclear receptor, Biochemical and biophysical research communications
337, 490-497.
80.
Messeguer, X., Escudero, R., Farre, D., Nunez, O., Martinez, J., and Alba,
M. M. (2002) PROMO: detection of known transcription regulatory
elements using species-tailored searches, Bioinformatics 18, 333-334.
81.
Radhakrishnan, A., Goldstein, J. L., McDonald, J. G., and Brown, M. S.
(2008) Switch-like control of SREBP-2 transport triggered by small
changes in ER cholesterol: a delicate balance, Cell Metab 8, 512-521.
82.
Ness, G. C. (1991) Thyroid hormone. Basis for its hypocholesterolemic
effect, J Fla Med Assoc 78, 383-385.
83.
Simonet, W. S., and Ness, G. C. (1989) Post-transcriptional regulation of
3-hydroxy-3-methylglutaryl-CoA reductase mRNA in rat liver.
Glucocorticoids block the stabilization caused by thyroid hormones, J Biol
Chem 264, 569-573.
80
84.
Prieur, X., Huby, T., Coste, H., Schaap, F. G., Chapman, M. J., and
Rodriguez, J. C. (2005) Thyroid hormone regulates the
hypotriglyceridemic gene APOA5, J Biol Chem 280, 27533-27543.
85.
Datta, S., Wang, L., Moore, D. D., and Osborne, T. F. (2006) Regulation of
3-hydroxy-3-methylglutaryl coenzyme A reductase promoter by nuclear
receptors liver receptor homologue-1 and small heterodimer partner: a
mechanism for differential regulation of cholesterol synthesis and uptake,
J Biol Chem 281, 807-812.
86.
Pajukanta, P., Lilja, H. E., Sinsheimer, J. S., Cantor, R. M., Lusis, A. J.,
Gentile, M., Duan, X. J., Soro-Paavonen, A., Naukkarinen, J., Saarela, J.,
Laakso, M., Ehnholm, C., Taskinen, M. R., and Peltonen, L. (2004)
Familial combined hyperlipidemia is associated with upstream
transcription factor 1 (USF1), Nature genetics 36, 371-376.
87.
Liu, M., Whetstine, J. R., Payton, S. G., Ge, Y., Flatley, R. M., and
Matherly, L. H. (2004) Roles of USF, Ikaros and Sp proteins in the
transcriptional regulation of the human reduced folate carrier B promoter,
Biochem J 383, 249-257.
88.
Ferre-D'Amare, A. R., Pognonec, P., Roeder, R. G., and Burley, S. K.
(1994) Structure and function of the b/HLH/Z domain of USF, Embo J 13,
180-189.
89.
West, A. G., Huang, S., Gaszner, M., Litt, M. D., and Felsenfeld, G. (2004)
Recruitment of histone modifications by USF proteins at a vertebrate
barrier element, Mol Cell 16, 453-463.
90.
Back, D. W., Wilson, S. B., Morris, S. M., Jr., and Goodridge, A. G. (1986)
Hormonal regulation of lipogenic enzymes in chick embryo hepatocytes in
culture. Thyroid hormone and glucagon regulate malic enzyme mRNA
level at post-transcriptional steps, J Biol Chem 261, 12555-12561.
91.
Quinn, M. T., Parthasarathy, S., Fong, L. G., and Steinberg, D. (1987)
Oxidatively modified low density lipoproteins: a potential role in
recruitment and retention of monocyte/macrophages during
atherogenesis, Proc Natl Acad Sci U S A 84, 2995-2998.
81
92.
Gerrity, R. G. (1981) The role of the monocyte in atherogenesis: I.
Transition of blood-borne monocytes into foam cells in fatty lesions, Am J
Pathol 103, 181-190.
93.
Gerrity, R. G. (1981) The role of the monocyte in atherogenesis: II.
Migration of foam cells from atherosclerotic lesions, Am J Pathol 103, 191200.
94.
Stary, H. C., Chandler, A. B., Glagov, S., Guyton, J. R., Insull, W., Jr.,
Rosenfeld, M. E., Schaffer, S. A., Schwartz, C. J., Wagner, W. D., and
Wissler, R. W. (1994) A definition of initial, fatty streak, and intermediate
lesions of atherosclerosis. A report from the Committee on Vascular
Lesions of the Council on Arteriosclerosis, American Heart Association,
Circulation 89, 2462-2478.
95.
Kannel, W. B., Castelli, W. P., Gordon, T., and McNamara, P. M. (1971)
Serum cholesterol, lipoproteins, and the risk of coronary heart disease.
The Framingham study, Ann Intern Med 74, 1-12.
96.
Vedhachalam, C., Duong, P. T., Nickel, M., Nguyen, D., Dhanasekaran,
P., Saito, H., Rothblat, G. H., Lund-Katz, S., and Phillips, M. C. (2007)
Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid
efflux to apolipoprotein A-I and formation of high density lipoprotein
particles, J Biol Chem 282, 25123-25130.
97.
Timmins, J. M., Lee, J. Y., Boudyguina, E., Kluckman, K. D., Brunham, L.
R., Mulya, A., Gebre, A. K., Coutinho, J. M., Colvin, P. L., Smith, T. L.,
Hayden, M. R., Maeda, N., and Parks, J. S. (2005) Targeted inactivation
of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney
hypercatabolism of apoA-I, J Clin Invest 115, 1333-1342.
98.
Lie, J., de Crom, R., Jauhiainen, M., van Gent, T., van Haperen, R.,
Scheek, L., Jansen, H., Ehnholm, C., and van Tol, A. (2001) Evaluation of
phospholipid transfer protein and cholesteryl ester transfer protein as
contributors to the generation of pre beta-high-density lipoproteins,
Biochem J 360, 379-385.
99.
Kielar, D., Dietmaier, W., Langmann, T., Aslanidis, C., Probst, M.,
Naruszewicz, M., and Schmitz, G. (2001) Rapid quantification of human
ABCA1 mRNA in various cell types and tissues by real-time reverse
transcription-PCR, Clin Chem 47, 2089-2097.
82
100.
Burgess, J. W., Frank, P. G., Franklin, V., Liang, P., McManus, D. C.,
Desforges, M., Rassart, E., and Marcel, Y. L. (1999) Deletion of the Cterminal domain of apolipoprotein A-I impairs cell surface binding and lipid
efflux in macrophage, Biochemistry 38, 14524-14533.
101.
Forte, T. M., Goth-Goldstein, R., Nordhausen, R. W., and McCall, M. R.
(1993) Apolipoprotein A-I-cell membrane interaction: extracellular
assembly of heterogeneous nascent HDL particles, J Lipid Res 34, 317324.
102.
Wang, X., Collins, H. L., Ranalletta, M., Fuki, I. V., Billheimer, J. T.,
Rothblat, G. H., Tall, A. R., and Rader, D. J. (2007) Macrophage ABCA1
and ABCG1, but not SR-BI, promote macrophage reverse cholesterol
transport in vivo, J Clin Invest 117, 2216-2224.
103.
Vaughan, A. M., and Oram, J. F. (2005) ABCG1 redistributes cell
cholesterol to domains removable by high density lipoprotein but not by
lipid-depleted apolipoproteins, J Biol Chem 280, 30150-30157.
104.
Nakamura, K., Kennedy, M. A., Baldan, A., Bojanic, D. D., Lyons, K., and
Edwards, P. A. (2004) Expression and regulation of multiple murine ATPbinding cassette transporter G1 mRNAs/isoforms that stimulate cellular
cholesterol efflux to high density lipoprotein, J Biol Chem 279, 4598045989.
105.
Jessup, W., Gelissen, I. C., Gaus, K., and Kritharides, L. (2006) Roles of
ATP binding cassette transporters A1 and G1, scavenger receptor BI and
membrane lipid domains in cholesterol export from macrophages, Curr
Opin Lipidol 17, 247-257.
106.
Bruce, C., Chouinard, R. A., Jr., and Tall, A. R. (1998) Plasma lipid
transfer proteins, high-density lipoproteins, and reverse cholesterol
transport, Annu Rev Nutr 18, 297-330.
107.
Reed, D. M., Strong, J. P., Resch, J., and Hayashi, T. (1989) Serum lipids
and lipoproteins as predictors of atherosclerosis. An autopsy study,
Arteriosclerosis 9, 560-564.
108.
Van Lenten, B. J., Wagner, A. C., Anantharamaiah, G. M., Navab, M.,
Reddy, S. T., Buga, G. M., and Fogelman, A. M. (2009) Apolipoprotein A-I
mimetic peptides, Curr Atheroscler Rep 11, 52-57.
83
109.
Stein, O., Stein, Y., Lefevre, M., and Roheim, P. S. (1986) The role of
apolipoprotein A-IV in reverse cholesterol transport studied with cultured
cells and liposomes derived from an ether analog of phosphatidylcholine,
Biochim Biophys Acta 878, 7-13.
110.
Remaley, A. T., Stonik, J. A., Demosky, S. J., Neufeld, E. B., Bocharov, A.
V., Vishnyakova, T. G., Eggerman, T. L., Patterson, A. P., Duverger, N. J.,
Santamarina-Fojo, S., and Brewer, H. B., Jr. (2001) Apolipoprotein
specificity for lipid efflux by the human ABCAI transporter, Biochem
Biophys Res Commun 280, 818-823.
111.
Steinmetz, A., and Utermann, G. (1985) Activation of lecithin: cholesterol
acyltransferase by human apolipoprotein A-IV, J Biol Chem 260, 22582264.
112.
Weinberg, R. B., and Patton, C. S. (1990) Binding of human
apolipoprotein A-IV to human hepatocellular plasma membranes, Biochim
Biophys Acta 1044, 255-261.
113.
Dvorin, E., Gorder, N. L., Benson, D. M., and Gotto, A. M., Jr. (1986)
Apolipoprotein A-IV. A determinant for binding and uptake of high density
lipoproteins by rat hepatocytes, J Biol Chem 261, 15714-15718.
114.
Lin-Lee, Y. C., Strobl, W., Soyal, S., Radosavljevic, M., Song, M., Gotto,
A. M., Jr., and Patsch, W. (1993) Role of thyroid hormone in the
expression of apolipoprotein A-IV and C-III genes in rat liver, J Lipid Res
34, 249-259.
115.
Asztalos, B. F., de la Llera-Moya, M., Dallal, G. E., Horvath, K. V.,
Schaefer, E. J., and Rothblat, G. H. (2005) Differential effects of HDL
subpopulations on cellular ABCA1- and SR-BI-mediated cholesterol efflux,
J Lipid Res 46, 2246-2253.
116.
Crowl, R. M., Stoller, T. J., Conroy, R. R., and Stoner, C. R. (1991)
Induction of phospholipase A2 gene expression in human hepatoma cells
by mediators of the acute phase response, J Biol Chem 266, 2647-2651.
117.
Ivandic, B., Castellani, L. W., Wang, X. P., Qiao, J. H., Mehrabian, M.,
Navab, M., Fogelman, A. M., Grass, D. S., Swanson, M. E., de Beer, M.
C., de Beer, F., and Lusis, A. J. (1999) Role of group II secretory
phospholipase A2 in atherosclerosis: 1. Increased atherogenesis and
84
altered lipoproteins in transgenic mice expressing group IIa phospholipase
A2, Arteriosclerosis, thrombosis, and vascular biology 19, 1284-1290.
118.
Menschikowski, M., Kasper, M., Lattke, P., Schiering, A., Schiefer, S.,
Stockinger, H., and Jaross, W. (1995) Secretory group II phospholipase
A2 in human atherosclerotic plaques, Atherosclerosis 118, 173-181.
119.
Menschikowski, M., Lattke, P., Bergmann, S., and Jaross, W. (1995)
Exposure of macrophages to PLA2-modified lipoproteins leads to cellular
lipid accumulations, Anal Cell Pathol 9, 113-121.
120.
Divchev, D., and Schieffer, B. (2008) The secretory phospholipase A2
group IIA: a missing link between inflammation, activated reninangiotensin system, and atherogenesis?, Vasc Health Risk Manag 4, 597604.
121.
Dory, L., and Roheim, P. S. (1981) Rat plasma lipoproteins and
apolipoproteins in experimental hypothyroidism, J Lipid Res 22, 287-296.
122.
Graf, G. A., Yu, L., Li, W. P., Gerard, R., Tuma, P. L., Cohen, J. C., and
Hobbs, H. H. (2003) ABCG5 and ABCG8 are obligate heterodimers for
protein trafficking and biliary cholesterol excretion, J Biol Chem 278,
48275-48282.
123.
Klett, E. L., Lee, M. H., Adams, D. B., Chavin, K. D., and Patel, S. B.
(2004) Localization of ABCG5 and ABCG8 proteins in human liver, gall
bladder and intestine, BMC Gastroenterol 4, 21.
124.
Lu, K., Lee, M. H., Hazard, S., Brooks-Wilson, A., Hidaka, H., Kojima, H.,
Ose, L., Stalenhoef, A. F., Mietinnen, T., Bjorkhem, I., Bruckert, E.,
Pandya, A., Brewer, H. B., Jr., Salen, G., Dean, M., Srivastava, A., and
Patel, S. B. (2001) Two genes that map to the STSL locus cause
sitosterolemia: genomic structure and spectrum of mutations involving
sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively,
Am J Hum Genet 69, 278-290.
125.
Hubacek, J. A., Berge, K. E., Cohen, J. C., and Hobbs, H. H. (2001)
Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8)
causing sitosterolemia, Hum Mutat 18, 359-360.
85
126.
Heimerl, S., Langmann, T., Moehle, C., Mauerer, R., Dean, M., Beil, F. U.,
von Bergmann, K., and Schmitz, G. (2002) Mutations in the human ATPbinding cassette transporters ABCG5 and ABCG8 in sitosterolemia, Hum
Mutat 20, 151.
127.
Hazard, S. E., and Patel, S. B. (2007) Sterolins ABCG5 and ABCG8:
regulators of whole body dietary sterols, Pflugers Arch 453, 745-752.
128.
Remaley, A. T., Bark, S., Walts, A. D., Freeman, L., Shulenin, S., Annilo,
T., Elgin, E., Rhodes, H. E., Joyce, C., Dean, M., Santamarina-Fojo, S.,
and Brewer, H. B., Jr. (2002) Comparative genome analysis of potential
regulatory elements in the ABCG5-ABCG8 gene cluster, Biochem Biophys
Res Commun 295, 276-282.
129.
Freeman, L. A., Kennedy, A., Wu, J., Bark, S., Remaley, A. T.,
Santamarina-Fojo, S., and Brewer, H. B., Jr. (2004) The orphan nuclear
receptor LRH-1 activates the ABCG5/ABCG8 intergenic promoter, J Lipid
Res 45, 1197-1206.
130.
Sumi, K., Tanaka, T., Uchida, A., Magoori, K., Urashima, Y., Ohashi, R.,
Ohguchi, H., Okamura, M., Kudo, H., Daigo, K., Maejima, T., Kojima, N.,
Sakakibara, I., Jiang, S., Hasegawa, G., Kim, I., Osborne, T. F., Naito, M.,
Gonzalez, F. J., Hamakubo, T., Kodama, T., and Sakai, J. (2007)
Cooperative interaction between hepatocyte nuclear factor 4 alpha and
GATA transcription factors regulates ATP-binding cassette sterol
transporters ABCG5 and ABCG8, Mol Cell Biol 27, 4248-4260.
131.
Lu, K., Lee, M. H., Yu, H., Zhou, Y., Sandell, S. A., Salen, G., and Patel,
S. B. (2002) Molecular cloning, genomic organization, genetic variations,
and characterization of murine sterolin genes Abcg5 and Abcg8, J Lipid
Res 43, 565-578.
132.
Sacks, F. M., Rudel, L. L., Conner, A., Akeefe, H., Kostner, G., Baki, T.,
Rothblat, G., de la Llera-Moya, M., Asztalos, B., Perlman, T., Zheng, C.,
Alaupovic, P., Maltais, J. A., and Brewer, H. B. (2009) Selective
delipidation of plasma HDL enhances reverse cholesterol transport in vivo,
J Lipid Res 50, 894-907.
86
About the Author
Lindsey Boone received a Bachelor’s Degree with Honors in Chemistry
from Jacksonville University in 2005. She joined the Ph.D.-PLUS program at the
University of South Florida College of Medicine in 2005 and received an MBA in
2009 as part of the dual-degree program.
In 2009 she was selected to give an oral presentation at the USF Health
Research Day for which she received the USF Health Vice President's Award for
Outstanding Oral Presentation. She has also received competitive travel awards
to present her research at several national meetings including the ASBMB
Graduate Travel Award (2007 & 2009) and AMSGS Travel Award (2007-2009).