Download The Center for Organogenesis | University of Michigan, Ann Arbor

CORRIGENDUM
Development 136, 3377 (2009) doi:10.1242/dev.043802
Stage-dependent modes of Pax6-Sox2 epistasis regulate lens development and eye
morphogenesis
April N. Smith, Leigh-Anne Miller, Glenn Radice, Ruth Ashery-Padan and Richard A. Lang
There was an error published in Development 136, 2977-2985.
The acknowledgements should have mentioned the Binational Science Foundation. The corrected acknowledgements section appears in
full below.
The authors apologise to readers for this mistake.
DEVELOPMENT
We thank Mr Paul Speeg for excellent technical assistance. We are indebted to Dr Hans Arnheiter for providing the anti-Mitf antibodies. This work was supported
by NIH RO1s EY10559, EY15766, EY16241 and EY17848, and by funds from the Abrahamson Pediatric Eye Institute Endowment at Children’s Hospital Medical
Center of Cincinnati (R.A.L.). Research in the laboratories of R.A.L. and R.A.-P. is supported by the Binational Science Foundation.
RESEARCH ARTICLE 2977
Development 136, 2977-2985 (2009) doi:10.1242/dev.037341
Stage-dependent modes of Pax6-Sox2 epistasis regulate lens
development and eye morphogenesis
April N. Smith1, Leigh-Anne Miller1, Glenn Radice2,*, Ruth Ashery-Padan3 and Richard A. Lang1,4,5,†
The transcription factors Pax6 and Sox2 have been implicated in early events in lens induction and have been proposed to
cooperate functionally. Here, we investigated the activity of Sox2 in lens induction and its genetic relationship to Pax6 in the mouse.
Conditional deletion of Sox2 in the lens placode arrests lens development at the pit stage. As previously shown, conditional
deletion of Pax6 in the placode eliminates placodal thickening and lens pit invagination. The cooperative activity of Sox2 and Pax6
is illustrated by the dramatic failure of lens and eye development in presumptive lens conditional, compound Sox2, Pax6
heterozygotes. The resulting phenotype resembles that of germ line Pax6 inactivation, and the failure of optic cup morphogenesis
indicates the importance of ectoderm-derived signals for all aspects of eye development. We further assessed whether Sox2 and
Pax6 were required for N-cadherin expression at different stages of lens development. N-cadherin was lost in Sox2-deficient but not
Pax6-deficient pre-placodal ectoderm. By contrast, after the lens pit has formed, N-cadherin expression is dependent on Pax6. These
data support a model in which the mode of Pax6-Sox2 inter-regulation is stage-dependent and suggest an underlying mechanism in
which DNA binding site availability is regulated.
INTRODUCTION
The Pax6 and Sox2 genes are both known to have major roles in eye
development (Callaerts et al., 1997; Chow and Lang, 2001;
Treisman, 2004; Kondoh, 2008). Pax6 is a paired domain and
homeodomain-containing transcription factor that is essential for
eye development in both invertebrates and vertebrates (Quiring et
al., 1994). It also has the remarkable ability to induce ectopic eyes,
both in flies and frogs, when misexpressed (Halder et al., 1995;
Chow et al., 1999). Pax6 is expressed in the presumptive lens in a
region that includes the lens placode and adjacent ectoderm
(Grindley et al., 1997; Furuta and Hogan, 1998; Ashery-Padan et al.,
2000; Dimanlig et al., 2001). According to tissue recombination
experiments (Fujiwara et al., 1994), the generation of Pax6 mutant
chimeric mice (Collinson et al., 2000), lineage-traced ectopic lenses
(Chow et al., 1999) and Pax6 conditional deletion (Ashery-Padan et
al., 2000), Pax6 has an autonomous role in lens development. When
Pax6 is misexpressed in the frog, it has been observed that ectopic
lenses can form in isolation, whereas ectopic retina development is
always accompanied by adjacent ectopic lens tissue (Chow et al.,
1999). This has suggested that the developing lens may provide
important signals for formation of the retina.
Sox2 is one member of the larger family of high mobility group
(HMG) domain transcription factors (Kamachi et al., 2000).
Members of the Sox family have diverse tissue-specific expression
patterns throughout early development and have been implicated in
1
Division of Pediatric Ophthalmology and 4Division of Developmental Biology,
Cincinnati Children’s Hospital Research Foundation, Cincinnati, OH 45229, USA.
2
Center for Research on Reproduction and Women’s Health, University of
Pennsylvania School of Medicine, Philadelphia, PA 19104, USA. 3Sackler Faculty of
Medicine, Department of Human Molecular Genetics and Biochemistry, Tel Aviv
University, Tel Aviv, Israel. 5Department of Ophthalmology, University of Cincinnati,
Cincinnati, OH 45229, USA.
*Present address: Center for Translational Medicine, College of Graduate Studies,
Thomas Jefferson University, Philadelphia, PA 19107, USA
†
Author for correspondence ([email protected])
Accepted 3 July 2009
cell fate decisions in numerous processes (Uwanogho et al., 1995).
Sox1, Sox2 and Sox3 are all expressed in the lens (Kamachi et al.,
1998). Sox2 and Sox3 expression in the early lens placode is
dependent on the optic vesicle and this implies that they are
responsive to inductive signals (Kamachi et al., 1998). Sox1 is first
expressed later during invagination of the lens placode, and also
during lens morphogenesis in lens fiber cells (Kamachi et al., 1998).
Sox2 has been implicated in lens development through its regulation
of the δ1-crystallin gene in the chick (Kamachi et al., 2001) and,
more recently, of N-cadherin (Matsumata et al., 2005), an adhesion
molecule known to be required for normal lens morphogenesis and
the differentiation of lens fiber cells (Pontoriero et al., 2009). It has
also been proposed that the Sox2 gene is regulated by the Sox2
protein product in combination with Pax6 through the N-3 enhancer
that is active in the presumptive lens (Inoue et al., 2007). Consistent
with an important role for Sox2 in eye development, it was recently
shown that, in humans, heterozygous Sox2 mutation can result in
anophthalmia-esophageal-genital (AEG) syndrome (Fantes et al.,
2003; Taranova et al., 2006; Bakrania et al., 2007).
It has been recognized, based on the analysis of cis-acting
regulatory elements, that Pax6 and Sox2 are likely to be crossregulated during development (Kondoh et al., 2004; Hever et al.,
2006; Inoue et al., 2007). Despite this, to date, an assessment of the
genetic and functional interactions between Pax6 and Sox2 has not
been performed. In the current study, we generated a Sox2
conditional allele in the mouse and, in combination with the existing
Pax6 conditional allele (Ashery-Padan et al., 2000), formally tested
the genetic and functional relationships between Pax6 and Sox2 in
the lens. This showed that in pre-placodal ectoderm, Pax6 and Sox2
expression is not inter-dependent, but that the two proteins cooperate
functionally in the very early steps of eye development.
Unexpectedly, we show that various combinations Pax6 and Sox2
deletion in the pre-placodal ectoderm have profound effects on the
morphogenesis of the eye. This suggests that Pax6 and Sox2 are
required for the production of signals that initiate eye
morphogenesis. We also show that, in pre-placodal ectoderm, Ncadherin is dependent on Sox2, but not Pax6. After the lens placode
DEVELOPMENT
KEY WORDS: Pax6, Sox2, Development, Eye, Lens, Morphogenesis, Mouse
2978 RESEARCH ARTICLE
MATERIALS AND METHODS
Animal maintenance and use
Animals were housed in a pathogen-free vivarium in accordance with
institutional policies. Gestational age was determined through detection of
a vaginal plug. At specific gestational ages, fetuses were removed by
hysterectomy after the dams had been anesthetized with isoflurane. In this
analysis, eight to 20 embryonic eyes were analyzed for each genotype and
stage of development.
flox
Generation of the Sox2
allele
The Sox2flox allele was generated using conventional gene-targeting
methods. A 5⬘ loxP site was placed in the 5⬘ untranslated region of Sox2 and
a 3⬘ loxP site downstream of the single Sox2 exon (Fig. 1A). The Frt siteflanked neo gene of the targeting vector was excised in vivo using a flippaseexpressing mouse line (Rodriguez et al., 2000). A similar allele of mouse
Sox2 has been generated by others (Miyagi et al., 2008).
Mouse lines
The following transgenic and gene-targeted mice were used in this study:
Le-cre (Ashery-Padan et al., 2000), AP2α-cre (Macatee et al., 2003), Pax6flox
(Ashery-Padan et al., 2000), Pax6sey (Hill et al., 1991), N-cadherinLacz
Fig. 1. The Sox2 allele and pattern of AP2α-cre and Le-cre
expression. (A) Schematic showing the design of the Sox2 targeting
vector and the final Sox2flox conditional allele. The positive selectable
marker neo was removed by crossing the Sox2floxNeo allele with a
germline flippase mouse line. (B) Expression patterns (green regions) of
AP2α-cre and Le-cre in the eye region at E8.5 and E9.5. The dashed
line shows the approximate boundary of the lens placode. hse, head
surface ectoderm; pom, periocular mesechyme; ov, optic vesicle; op,
optic pit.
(Radice et al., 1997), N-cadherinflox (Kostetskii et al., 2005) and αMHCEcad (Luo et al., 2001). All mouse lines used in this study were genotyped
by PCR using primers and protocols described previously. Yolk sacs from
staged embryos or tail tips were digested overnight at 55°C in lysis buffer
and genomic DNA extracted using a Kingfisher 96 Magnetic Particle
Processor. Primers for genotyping of the Sox2flox allele were as follows:
VS635, TGGAATCAGGCTGCCGAGAATCC; VS636, TCGTTCTGGCAACAAGTGCTAAAGC; and VS369, CTGCCATAGCCACTCGAGAAG. The PCR protocol used was 95°C for 4 minutes followed by 25
cycles of 94°C for 30 seconds, 58°C for 30 seconds and 72°C for 30 seconds,
with a final extension period of 72°C for 7 minutes. These primers
produce bands of 421 bp for the wild-type allele and 546 bp for the targeted
allele.
Immunofluorescence
Immunofluorescence labeling for cryosections was performed as previously
described (Smith et al., 2005). All sections were permeabilized with freshly
prepared ice-cold 0.5% Triton X-100, 1% sodium citrate in PBS for 5
minutes and then washed three times in 0.1% Tween in PBS prior to
blocking. Primary antibody dilutions were as follows: rabbit polyclonal antiN-cadherin antibody (ABCAM, ab18203), 1:300; sheep polyclonal CHX10
(Exalpha, X1180P), 1:1000; rabbit polyclonal anti-Pax6 (Covance, PRB278P), 1:2000; rabbit polyclonal anti-Sox2 (Chemicon, AB5603), 1:1000;
goat polyclonal anti-P-cadherin (R&D Systems, AF761), 1:100; polyclonal
rabbit anti-β-crystallin (generated in our laboratory), 1:5000; and rabbit
polyclonal Mitf-1 (a gift from H. Arnheiter, National Institute of
Neurological Disorders and Stroke, NIH, USA), 1:2500. Alexa Fluor
secondary antibodies and Alexa phalloidins were obtained from Invitrogen
or Molecular Probes and used at a dilution of 1:5000 (A-11072, A-11070,
A-11016, A11058, A11015, A11055, A-12379). All sections were
counterstained with Hoechst 33342 (Sigma, B-2261) for the visualization of
nuclei.
RESULTS
Generation of the Sox2 conditional allele
In order to effectively study the cooperative roles of Pax6 and Sox2
in the developing mouse lens, we generated a conditional Sox2flox
allele (see also Miyagi et al., 2008) using conventional gene
targeting in ES cells. The mouse Sox2 gene has a single exon and so
loxP sites were placed in the 5⬘ untranslated region and downstream
of the 3⬘ UTR (Fig. 1A). A Pax6flox allele was generated previously
(Ashery-Padan et al., 2000).
To assess the functions of Pax6 and Sox2 in the developing
lens, we took advantage of two Cre-expressing drivers. The Lecre transgenic mouse line (Ashery-Padan et al., 2000) uses the
Pax6 ectoderm enhancer (EE) (Williams et al., 1998; Kammandel
et al., 1999; Xu et al., 1999) to drive Cre and GFP expression in
the developing lens from the placode stage (approximately E9.0)
onwards (Fig. 1B). At later stages of development, Le-cre is
expressed in the periocular surface ectoderm that includes the
presumptive conjunctiva, the corneal ectoderm and the periocular
gland epithelia (Williams et al., 1998; Kammandel et al., 1999;
Xu et al., 1999; Ashery-Padan et al., 2000; Smith et al., 2005).
The AP2α-cre mouse line was generated by inserting the Cre
recombinase-coding region into the 3⬘ untranslated region of
the AP2α gene (Tcfap2a – Mouse Genome Informatics) using
gene-targeting methods (Macatee et al., 2003). This results in
a Cre expression domain that includes the dorsal neural tube,
neural crest-derived periocular mesenchyme and the head
surface ectoderm that includes the presumptive lens at a preplacodal stage (Fig. 1B). A comparison of the consequences
of AP2α-cre and Le-cre mediated gene deletion can be
informative (Song et al., 2007), as they represent genetically
distinct phases of lens development (Grindley et al., 1995; Lang,
2004).
DEVELOPMENT
has formed, Pax6 and Sox2 change to a different genetic
relationship, whereby Sox2 expression is dependent on Pax6. Ncadherin expression at this later stage is dependent on Pax6. These
data support a model in which the mode of Pax6-Sox2 interregulation is stage dependent, and point to an underlying mechanism
in which DNA binding site availability is regulated.
Development 136 (17)
Pax6 and Sox2 in lens and eye development
After lens placode formation, Pax6 is upstream of
Sox2
To understand the roles of Pax6 and Sox2 at the placodal stage of
lens development, we first performed deletions of each gene
separately using Le-cre. Le-cre-mediated deletion of Pax6
confirmed (Ashery-Padan et al., 2000) that Pax6 immunoreactivity
in the lens ectoderm was reduced at E9.5 (Fig. 2B) and absent at
E10.5 (Fig. 2E). Pax6 labeling in the presumptive retina of Le-cre;
Pax6FL/FL embryos was unchanged (Fig. 2B,E) and served to
illustrate the specificity of the Le-cre driver. Phenotypically, Pax6
deletion in the presumptive lens resulted in a failure of lens
development from the placode stage onwards (Fig. 2B,E,H,K), as
would be anticipated (Ashery-Padan et al., 2000). In addition, the
optic vesicle failed to undergo normal morphogenesis; although the
expected thickness differential was sometimes observed, the
presumptive retinal and retinal pigmented epithelia were not
apposed or cupped (Fig. 2E,K). When we labeled for Sox2 in Le-
RESEARCH ARTICLE 2979
cre; Pax6FL/FL embryos, there was little change apparent at E9.5
(Fig. 2H) but dramatically reduced immunoreactivity by E10.5
(Fig. 2K). This indicated that at the pit stage of lens development,
Sox2 expression is dependent on Pax6.
Conditional deletion of Sox2FL/FL with Le-cre gave reliably
diminished Sox2 immunoreactivity in the presumptive lens of E9.5
embryos (Fig. 2I) and an absence at E10.5 (Fig. 2L). The phenotypic
consequences of Sox2 deletion were milder than in the Pax6 mutant:
some placodal thickening was apparent (e.g. Fig. 2C) and a lens pit,
albeit shallow compared with that of wild type (Fig. 2J), was
observed (Fig. 2L). Furthermore, the optic cup of Le-cre; Sox2FL/FL
embryos was formed fairly normally with apposed presumptive
retina and retinal pigment epithelial layers of appropriate thickness.
Immunolabeling for Pax6 in Le-cre; Sox2FL/FL embryos did not
detect any changes in Pax6 levels either at E9.5 (Fig. 2C) or at E10.5
(Fig. 2F), indicating that Pax6 expression is not dependent on Sox2.
When combined with the above data showing the dependence of
Sox2 expression on Pax6, this suggests that after the placodal stage
of lens development there is a simple linear genetic pathway with
Pax6 upstream of Sox2.
Fig. 2. Placodal deletion of Pax6 and Sox2 produce distinct
consequences for lens and eye development. (A-L) Cryosections of
the indicated embryonic stage (left) and genotype (top) showing
immunofluorescence signal for either Pax6 or Sox2 (red) and nuclei
(blue). For clearer examination of areas of targeted deletion (white
brackets), red channels are magnified and shown separately, either
below (A-C,G-I) or above (D-F,J-L) the parent panel. lp, lens placode; lv,
lens vesicle; pr, presumptive retina; prpe, presumptive retinal pigmented
epithelium; ple, presumptive lens ectoderm; pi, lens pit; ov, optic
vesicle.
Fig. 3. Pre-placodal Pax6 is not dependent on Sox2.
(A-I) Cryosections of the indicated embryonic stage (left) and genotype
(top), showing immunofluorescence signal for Pax6 (red) and nuclei
(blue). For clearer examination of areas of targeted deletion (white
brackets), red channels are magnified and shown separately, either
below (A-C) or above (D-F). lp, lens placode; lv, lens vesicle; pr,
presumptive retina; prpe, presumptive retinal pigmented epithelium;
ple, presumptive lens ectoderm; ov, optic vesicle.
DEVELOPMENT
At the pre-placodal stage of lens development,
Pax6 and Sox2 function in parallel
AP2α-cre (Macatee et al., 2003) is expressed earlier than Le-cre and
is active at E8.5 in the head surface ectoderm that encompasses the
pre-placodal presumptive lens. Because Pax6 and Sox2 are not
expressed in the crest-derived periocular mesenchyme where AP2αcre is also active, this component of driver activity is not of concern.
To determine the function of Pax6 and Sox2 and to examine their
epistatic relationship at pre-placodal stages, we performed
conditional deletion of each individual gene with AP2α-cre.
In AP2α-cre; Pax6FL/FL embryos, typical nuclear Pax6
immunoreactivity was largely lost at E8.5 in the surface ectoderm
(Fig. 3B), but was somewhat patchy, presumably because some latedeleting cells retained residual Pax6. By E9.5 (Fig. 3E) and E10.5
(Fig. 3H) the presumptive lens ectoderm of AP2α-cre; Pax6FL/FL
embryos showed no Pax6 immunoreactivity. We were not able to
discern any change in Pax6 immunoreactivity in the optic vesicle at
any stage in any (n=20) of the AP2α-cre; Pax6Fl/Fl embryos
examined. A phenotypic response to the absence of pre-placodal
Pax6 did not become apparent until E9.5 and beyond but manifested
as an absence of placodal thickening (Fig. 3E) and a complete failure
of eye morphogenesis (Fig. 3H) that was more severe than when Lecre was used to delete Pax6FL (Fig. 2). Indeed, the phenotype of
AP2α-cre; Pax6FL/FL embryos most closely resembles that of
Pax6Sey homozygotes in which the lens placode does not thicken,
there is no invagination of either lens pit or optic cup and the optic
stalk fails to constrict in the proximal eye region (Grindley et al.,
1995). In AP2α-cre; Sox2FL/FL embryos (see Fig. 4 for confirmation
of deletion) there was no impact on Pax6 immunoreactivity in the
presumptive lens from E8.5 to E10.5 (Fig. 3C,F,I). This indicates
that during these stages of lens development, Sox2 is not upstream
of Pax6.
Fig. 4. Pre-placodal expression of Sox2 is not dependent on Pax6.
(A-I) Cryosections of the indicated embryonic stage (left) and genotype
(top), showing immunofluorescence signal for Sox2 (red) and nuclei
(blue). For clearer examination of areas of targeted deletion (white
brackets), red channels are magnified and shown separately, either
below (A-C) or above (D-F). (J-L) Immunofluorescence signal for nuclei
(blue), F-actin (green) and Chx10 (red) in wild-type (J) and AP2α-cre;
Pax6Fl/Fl-deleted embryos (K,L) at E10.5. se, surface ectoderm; lp, lens
placode; lv, lens vesicle; pr, presumptive retina; prpe; presumptive
retinal pigmented epithelium; ple, presumptive lens ectoderm; pi, lens
pit; ov, optic vesicle.
Development 136 (17)
As expected, AP2α-cre; Sox2FL/FL resulted in the absence of Sox2
immunoreactivity in the surface ectoderm and presumptive lens from
E8.5-E10.5 (Fig. 4C,F,I). The phenotypic consequence of this preplacodal Sox2 deletion was similar to the consequence of placodal
deletion with Le-cre, in that the presumptive lens and retina underwent
a modest invagination that arrested at the equivalent of E10.0 (Fig. 4I).
However, there were also distinctions between AP2α-cre and Le-cre
mediated Sox2 deletion. Unlike Le-cre mediated Sox2 deletion where
the optic cup layers were well formed, AP2α-cre-mediated Sox2
deletion resulted in a failure of the presumptive retina and the RPE to
form nested cups. Instead, the RPE was widely separated from the
presumptive retina (Fig. 4I) and transitioned to an optic stalk region
that, as in AP2α-cre; Pax6FL/FL embryos, showed no proximal
constriction. This suggests that the early phase of Sox2 expression in
the surface ectoderm is required for the production of signals that
regulate some aspects of optic cup morphogenesis.
Sox2 labeling of AP2α-cre; Pax6FL/FL embryos revealed that
immunoreactivity was retained from E8.5-E10.5 (Fig. 4B,E,H). At
first glance, this might appear surprising given the loss of Sox2 in
the presumptive lens of Le-cre; Pax6FL/FL embryos at E10.5 (Fig.
2K), but is likely explained by arrested lens and eye development in
this genotype. In other words, the eye of the E10.5 AP2α-cre;
Pax6FL/FL embryo is developmentally equivalent to an E9.0 eye, and
at this pre-placodal stage, Sox2 expression is independent of Pax6.
The notion that this represents a developmental arrest is reinforced
by the pattern of Chx10 labeling in presumptive retina of AP2α-cre;
Pax6FL/FL embryos. Normally, at E9.0, Chx10 is expressed at a low
level in a small domain of the central presumptive retina. This region
expands to encompass the entire presumptive retina by E9.5 (Fig.
6K) and E10.5 (Burmeister et al., 1996) (Fig. 6C). By contrast, in
E10.5 AP2α-cre; Pax6FL/FL embryos, Chx10 was observed in a
central domain of presumptive retina at the low expression levels
(Fig. 4L) characteristic of the E9.0 eye.
The stage dependence of the severity of the Sox2 mutant
phenotype is nicely illustrated by the expression of β-crystallin in
both conditional mutants (Fig. 5A-C). In control embryos (Fig.
5A), the lower half of the lens vesicle expressed β-crystallin at
E11.5. With AP2α-cre-mediated deletion, only a few
differentiated cells could be detected (Fig. 5C), whereas Le-cremediated deletion gave an intermediate-sized β-crystallinexpressing region (Fig. 5B). Thus, the phenotype is more severe
when Sox2 is deleted earlier.
In some AP2α-cre; Sox2FL/FL embryos, lenses of a reasonable size
but abnormal morphology were observed later in development. At
E17.5, control eyes showed robust β-crystallin and Prox1 labeling
(Fig. 5D,G). By contrast, most AP2α-cre; Sox2FL/FL eyes (n=6/10)
had no morphologically recognizable lenses but did have an
occasional ectopic β-crystallin-positive cell (Fig. 5E,H). The
remaining embryos of this genotype (n=4/10) had lenses, albeit of
abnormal morphology, that expressed both β-crystallin and Prox1
(Fig. 5F,I). In Pax6 conditional mutants generated using either Cre
driver, neither morphologically recognizable lenses nor β-crystallin
immunoreactivity was ever detected (data not shown) (AsheryPadan et al., 2000). This is consistent with the idea that Pax6 has the
more upstream role in lens development.
Unchanged Sox2 immunoreactivity in the head surface ectoderm
of AP2α-cre; Pax6FL/FL embryos (Fig. 4B) is perhaps in contrast
with earlier data examining Pax6Sey/Sey mutants (Furuta and Hogan,
1998), suggesting that Sox2 expression in this location is dependent
on Pax6. This information emerged from Sox2 in situ hybridization
studies performed on Pax6Sey-Neu/Sey-Neu embryos at 27 somites
(approximately E10). To examine this issue further, we performed
DEVELOPMENT
2980 RESEARCH ARTICLE
Fig. 5. Sox2 has an important role in lens development.
(A-M) Cryosections from embryos of the indicated age (left) and
genotypes (above) showing immunofluorescence signal for nuclei
(blue), β-crystallin (A-C, red; D-F, green) Prox1 (G-I, red), Pax6 (J,K, red)
and Sox2 (L,M, red). lp, lens placode; lv, lens vesicle; pr, presumptive
retina; ple, presumptive lens ectoderm; pi, lens pit; ov, optic vesicle; r,
retina; m, mesenchyme; l, lens.
immunolabeling on Pax6Sey/Sey embryos. We confirmed that, at E9.5,
Pax6Sey/Sey embryos showed no nuclear Pax6 immunoreactivity (Fig.
5K; cytoplasmic immunoreactivity was frequently detected but was
not greater than background levels). Furthermore, Pax6Sey/Sey
embryos showed Sox2 immunoreactivity at apparently normal
levels despite obvious morphological defects (Fig. 5M). Thus, both
germline (Pax6Sey/Sey) and conditional (AP2α-cre; Pax6FL/FL) Pax6
deletion suggests that prior to E9.5, Sox2 expression in the surface
ectoderm and presumptive lens is independent of Pax6.
Ectodermal Pax6 and Sox2 cooperate in lens
development and eye morphogenesis
The possibility that Pax6 and Sox2 cooperate developmentally is
raised by their co-expression, by their ability to form a transcription
regulation complex (Kamachi et al., 2001) and by the identification
of potential binding sites in cis-elements that might mediate crossregulation (Kondoh et al., 2004; Hever et al., 2006; Inoue et al.,
2007). To assess the possibility of Pax6 and Sox2 cooperation in lens
development, we generated conditional compound heterozygotes
using Le-cre and assessed the phenotypic consequences. In E10.5
Le-cre; Pax6+/Fl; Sox2+/Fl embryos, we observed phenotypic
variation that ranged from a small but otherwise normal eye
(n=10/20; data not shown) to an eye that showed arrested
RESEARCH ARTICLE 2981
Fig. 6. Ectodermal Pax6 and Sox2 cooperate in lens and eye
development. (A-L) Cryosections from embryos of the indicated ages
and genotypes labeled for F-actin (A-H, green), nuclei (I-L, blue), or
Pax6, Sox2, Chx10 or Mitf (red) as indicated at left. Asterisk in G
indicates a retinal fold that has been grazed in the plane of section.
lp, lens placode; lv, lens vesicle; pr, presumptive retina; prpe,
presumptive retinal pigmented epithelium; ple, presumptive lens
ectoderm; ov, optic vesicle; os, optic stalk.
development at an early stage (n=10/20; Fig. 6E-H). Compared with
normal E10.5 eyes that showed a lens pit or lens vesicle (Fig. 4AD), conditional compound heterozygotes that were severely affected
showed no placodal thickening and no lens pit or optic cup
invagination. The morphology of these mutant eyes most closely
resembled that of the Pax6Sey/Sey (Grindley et al., 1995) or the AP2αcre; Pax6Fl/Fl mutants (Figs 3, 4).
Immunolabeling of severely affected Le-cre; Pax6+/Fl; Sox2+/Fl
embryos revealed that at E10.5, both Pax6 and Sox2 were absent
from the surface ectoderm (Fig. 6E,F). Because these embryos are
conditional mutants in which Pax6 and Sox2 heterozygote deletion
took place approximately one day earlier, the complete loss of Pax6
and Sox2 immunoreactivity probably represents a secondary
consequence of loss of the entire lens development program. Chx10
and Mitf are markers for presumptive retina and RPE, respectively,
that reveal whether the optic cup has been patterned (Nguyen and
Arnheiter, 2000; Horsford et al., 2005). Despite the absence of eye
morphogenesis, Chx10 was expressed in central presumptive retina
(Fig. 6G, compare with E9.5 control, Fig. 6K), and Mitf in
presumptive RPE (Fig. 6H, compare with E9.5 control, Fig. 6L).
This indicates that the first steps of optic cup patterning have
occurred in Le-cre; Pax6+/Fl; Sox2+/Fl embryos, and suggests that a
major cooperative function of Pax6 and Sox2 is to signal optic cup
morphogenesis.
Sox2 regulates N-cadherin expression
The adhesion molecule N-cadherin has a complex pattern of
expression in the epithelia of the developing eye. At E8.5, Ncadherin was expressed in both the optic pit and the surface
DEVELOPMENT
Pax6 and Sox2 in lens and eye development
2982 RESEARCH ARTICLE
Development 136 (17)
ectoderm of the head fold (Fig. 7A). N-cadherin expression was
maintained in the optic vesicle at E9.5 but was downregulated in the
lens placode region of the surface ectoderm (Fig. 7B). N-cadherin
expression was further retained in the presumptive retina and the
RPE of E10.5 embryos and was upregulated in the lens pit during
invagination (Fig. 7C). Because it has been suggested that Ncadherin is regulated by Sox family members (Matsumata et al.,
2005) or Pax6 (van Raamsdonk and Tilghman, 2000), we assessed
this possibility using the conditional mutants.
AP2α-cre; Pax6Fl/Fl embryos at E8.5 showed a wild-type
distribution of N-cadherin immunoreactivity (Fig. 7E). By contrast,
AP2α-cre; Sox2Fl/Fl embryos at E8.5 had lost N-cadherin expression
from the surface ectoderm (Fig. 7F). Even though the N-cadherin
signal was not high at this stage of development, this change was
consistently detected in an analysis of six AP2α-cre; Sox2Fl/Fl
embryos. Previously, it has been shown that Pax6Sey heterozygotes
have reduced N-cadherin transcript levels in the lens pit (van
Raamsdonk and Tilghman, 2000). Because neither the Pax6 nor the
Sox2 homozygous Le-cre conditional mutants developed a lens pit
(Fig. 2), it was not possible to assess N-cadherin expression at this
stage in these genotypes. However, we have confirmed that in Lecre and AP2α-cre conditional Pax6 heterozygotes (Fig. 7H,K), Ncadherin levels were reduced in the lens pit. In the case of AP2α-cre;
Pax6Fl/Fl embryos, we quantified this by measuring N-cadherin
immunoreactivity and expressing the data as the ratio of
presumptive retina to lens pit signal intensity (Fig. 7M); the Ncadherin signal was significantly reduced in the Pax6 mutant
(control, n=4; AP2α-cre; Pax6+/Fl, n=9; P=0.00004). A similar
analysis for Sox2 conditional heterozygotes suggested a reduced Ncadherin signal in the lens pit according to observation of
DEVELOPMENT
Fig. 7. N-cadherin expression is Sox2 dependent
in the pre-placode, but Pax6 dependent
subsequently. (A-C) Expression pattern of Ncadherin in the developing wild-type lens from E8.5
to E10.5. (D-L) Cryosections from embryos of the
indicated ages and genotypes labeled for the colorcoded markers shown on the left. (D-F) The red
channel that represents labeling for N-cadherin is
shown below the parent panel. (M) Quantification of
N-cadherin immunolabeling for control (C), AP2αcre; Pax6FL/FL (P) and AP2α-cre; Sox2FL/FL (S) E10.5
eyes expressed as the ratio of retina/lens intensity.
Significance values according to one-way ANOVA are
as indicated. (N-S) Cryosections from embryos of the
indicated ages and genotypes labeled for the colorcoded markers shown on the left. lp, lens placode;
lv, lens vesicle; pi, lens pit; pr, presumptive retina;
prpe, presumptive retinal pigmented epithelium; op,
optic pit; ov, optic vesicle.
micrographs (Fig. 7I,L), but quantification (Fig. 7M) produced only
a trend of reduced N-cadherin signal (control, n=4; AP2α-cre;
Sox2+/Fl, n=8; P=0.10). These findings confirm that in the lens pit
N-cadherin expression is dependent on Pax6, and leave open the
possibility that part of this regulation might be mediated by Sox2
(Fig. 8). The latter suggestion would be consistent with the
identification of Sox2-binding sites in N-cadherin enhancers
(Matsumata et al., 2005).
To determine whether N-cadherin was an important component
of Sox2-dependent lens development, we deleted N-cadherin at
the pre-placodal stage by using an existing Ncadflox conditional
allele (Kostetskii et al., 2005; Li et al., 2005). AP2α-cre; NcadFl/Fl
embryos are difficult to produce at lens development stages owing
to an early developmental lethality that probably results from
neural tube and heart development defects (Radice et al., 1997).
However, in embryos that were viable at E12.5, we could confirm
that the normally robust level of N-cadherin in the lens vesicle
(Fig. 7N) was absent in the conditional mutants (Fig. 7O,P), even
though Pax6 expression (Fig. 7R,S) was retained. Furthermore, in
AP2α-cre; NcadFl/Fl embryos, as expected (Pontoriero et al.,
2009), we observed a failure of the lens vesicle to separate from
the surface ectoderm and a persistence of P-cadherin expression
(Fig. 7O,P). Even though this phenotype was striking, it was
milder that that observed when Sox2 was deleted with AP2α-cre
(Figs 3, 4) and suggests that N-cadherin is just one of several
downstream genes that Sox2 regulates during lens development.
Furthermore, because this early deletion of N-cadherin resulted
in a phenotype that manifested only at E11.5-E12.5, this suggests
that N-cadherin does not have a crucial function in pre-placodal
lens ectoderm.
DISCUSSION
In this analysis, we have assessed the genetic relationship and
developmental functions of Pax6 and Sox2 in the early stages of lens
development in the mouse. We show that there is an epistatic
Fig. 8. A model for ectodermal Pax6 and Sox2 function in early
eye development. The analysis we present indicates that in preplacodal ectoderm, Pax6 and Sox2 are regulated independently but
functionally cooperate. By contrast, after the lens placode has formed,
Sox2 expression is dependent on Pax6. In an unexpected finding, we
show that Pax6 and Sox2 in the presumptive lens cooperate to provide
signals (orange arrow) that are required for morphogenesis of the optic
cup. At the pre-placodal stages, N-cadherin is regulated by Sox2. After
the lens pit has formed, N-cadherin is regulated by Pax6. It is possible
that in the lens pit, the dependence of N-cadherin expression on Pax6 is
in part mediated by Sox2.
RESEARCH ARTICLE 2983
relationship between Pax6 and Sox2, but that this exists only in a
defined developmental window. We also show that, when deleted
only in presumptive lens, Pax6 and Sox2 have a cooperative action
that regulates lens development but that also initiates morphogenesis
in the adjacent optic cup. Finally, we show that N-cadherin is
regulated by Sox2 and that, during the placodal phase of lens
development when Pax6 regulates Sox2, N-cadherin is also
dependent on Pax6. These data raise a number of questions.
Stage-dependent regulation of Sox2 by Pax6
Our data show that during lens development there are dynamic
changes in the genetic relationship between Pax6 and Sox2. In preplacodal lens ectoderm, even though there is evidence for a
functional cooperation of the gene products, Pax6 and Sox2
transcription is regulated independently. After lens placode
formation, the mode of interaction changes to one in which Sox2
expression is dependent on Pax6. This changing relationship is also
illustrated by an assessment of N-cadherin expression. In preplacodal presumptive lens, N-cadherin expression is dependent on
Sox2, but not Pax6. After lens placode formation, N-cadherin
expression is dependent on Pax6. These data suggest a model in
which Pax6 becomes a regulator of Sox2 after lens induction
signaling has been initiated (Fig. 8). The N-3 enhancer of Sox2
(Inoue et al., 2007) is a good candidate for mediating Pax6
regulation of Sox2 after placode formation.
In earlier experiments in which Pax6 was conditionally deleted
in the presumptive lens with Le-cre (Ashery-Padan et al., 2000),
Sox2 immunoreactivity was retained and this contrasts with the
current data in which Le-cre deletion of Pax6 results in the loss of
Sox2. An explanation for this difference might lie in the genotype
of the experimental animals. Previously, Pax6flox was
conditionally deleted on a Pax6 heterozygous [Pax6lacZ (St-Onge
et al., 1997)] background, whereas here we used the homozygous
conditional allele. It might be that the Pax6 heterozygous
background produces an earlier developmental defect and that
Pax6+/lacZ; Le-cre embryos more closely resemble AP2α-cre;
Pax6flox/flox embryos, in which there is an early developmental
arrest and in which Sox2 expression is retained. It will be very
interesting to compare the eye transcriptomes of these mutants to
understand whether these differences define early steps in lens
induction.
The observation that the Pax6-Sox2 genetic relationship changes
with developmental stage suggests that an additional level of
transcriptional regulation is at play. Specifically, these data indicate
that, regardless of whether regulation is direct or indirect, the Sox2
transcriptional control element that mediates Pax6-dependent
regulation in the lens pit is inactive at earlier stages. Clearly there
are many mechanisms that could explain this switching. Given the
stage of development at which this regulatory switching occurs, it
might be that optic vesicle-dependent inductive signaling can throw
the switch. Switching might be mediated by co-regulator availability
or perhaps by chromatin remodeling (Li et al., 2007). Further
investigation will be required to gain an understanding of this
mechanism.
Pax6 and Sox2 function in lens induction in the context of a larger
set of transcription factors and several signaling pathways (Lang,
2004; Medina-Martinez and Jamrich, 2007; Kondoh, 2008). For
example, the Six3 transcription factor is known to be important for
the early stages of lens development (Liu et al., 2006) and is likely
to function in a positive-feedback loop with Pax6 that would result
in the enhanced expression of both (Liu et al., 2006). It has been
suggested (Liu et al., 2006) that the mechanism of Six3 regulation
DEVELOPMENT
Pax6 and Sox2 in lens and eye development
of Pax6 is direct binding to the ectoderm enhancer (Williams et al.,
1998; Kammandel et al., 1999; Xu et al., 1999). It has also been
suggested that Six3 is upstream of Sox2 (Liu et al., 2006) and that,
here too, the mechanism is direct transcriptional regulation, in this
case, via the N4 enhancer (Uchikawa et al., 2003). The positive
regulation of Sox2 by a positive-feedback loop provides a strong
rationale for its upregulation during early lens development.
Pax6 and Sox2 in the presumptive lens regulate
optic cup morphogenesis
An unexpected finding from these studies was the absence of optic
cup morphogenesis when various combinations of Pax6 and Sox2
were deleted in the surface ectoderm. A mild form of this
morphogenesis failure is seen in Le-cre; Pax6flox/flox embryos in
which the retina becomes convoluted (Ashery-Padan et al., 2000).
When Pax6 is deleted earlier in pre-placodal ectoderm with AP2αcre, eye morphogenesis fails completely and the phenotype most
closely resembles the changes observed in the Pax6Sey/Sey mice,
which are Pax6 germline null (Grindley et al., 1995). This implies
that Pax6 expression in the surface ectoderm is required for the
production of signals that initiate optic cup morphogenesis,
including the epithelial bending that leads to the formation of nested
cups of retina and RPE. The distances from the surface ectoderm to
the presumptive RPE at the relevant stage of E9.5 are quite large and
so, presumably, ectoderm and Pax6-dependent morphogenesis
signaling must use a mechanism that can be transmitted or relayed
over distance.
The transcription factors Chx10 and Mitf are expressed in the
presumptive retina and the RPE, respectively. It has been shown that
Chx10 represses Mitf expression and that this is an important
element of defining the retinal and RPE territories in the optic cup
(Nguyen and Arnheiter, 2000; Horsford et al., 2005). The failure of
Chx10 expression to propagate throughout the presumptive retina in
AP2α-cre; Pax6flox/flox embryos might provide an explanation for the
failure of optic cup morphogenesis. Specifically, Pax6 in the
presumptive lens appears to be required for the lens-to-retina
signaling that establishes Chx10 expression. In turn, retinal and RPE
territories might remain undefined and this might lead to a failure of
region-specific morphogenesis. Further analysis will be required to
identify the morphogenesis mechanisms involved.
Our findings were similar when Sox2 was deleted in pre-placodal
ectoderm, except that the morphogenesis defects were milder. In
AP2α-cre; Sox2flox/flox embryos, we typically observed E10.5 eyes
with optic stalk regions that had not constricted, although in others
there were nested cups of retina and RPE. The difference in the
severity of eye morphogenesis defects following pre-placodal
deletion of Pax6 and Sox2 presumably reflects the degree to which
ectodermal morphogenesis signals are dependent on each
transcription factor. Clearly, the dramatic eye morphogenesis failure
apparent in some Pax6, Sox2 conditional heterozygotes nicely
illustrates the functional cooperation of the two transcription factors.
An earlier study (Donner et al., 2007) generated mice that were
double heterozygotes for Sox2 and Pax6 by using the germline
alleles Sox2βgeo2 (Avilion et al., 2003) and Pax6Sey-Neu (Hill et al.,
1991). In contrast to the current data, the analysis of different stages
of eye development in Sox2βgeo2/+; Pax6Sey-Neu/+ embryos revealed
no exacerbation of the Pax6Sey-Neu/+ small eye phenotype by Sox2
heterozygosity. Although this might seem difficult to reconcile with
the current analysis, there may be explanations. One possibility is
that with Pax6 and Sox2 germline mutations producing a defect very
early in development, the embryo might have the developmental
plasticity to accommodate the change without major consequences.
Development 136 (17)
The rapid deletion of Pax6 and Sox2 conditional alleles at a later
stage of development, as in this analysis, is unlikely to allow
compensation due to developmental plasticity. There is also the
possibility that the germline and conditional alleles for Sox2 and
Pax6 do not produce mutations that are functionally equivalent,
especially given the complex gene structure and multiple isoforms
of Pax6. Further work will be required to better define these issues.
In humans, Sox2 heterozygosity leads to anophthalmiaesophageal-genital (AEG) syndrome (Taranova et al., 2006;
Bakrania et al., 2007). This contrasts with findings in the mouse
where Sox2 heterozygosity does not lead to this syndrome or any
obvious eye defects (Avilion et al., 2003). We have also observed
that in AP2α-cre or Le-cre; Sox2 conditional heterozygotes there are
no apparent eye defects. However, the dramatic consequences of
conditional Pax6, Sox2 heterozygosity do indicate that, on a
sensitized background in which there is only half the normal level
of Pax6, Sox2 heterozygosity can lead to anophthalmia. Perhaps
individuals with AEG syndrome arise when the genetic variability
of the human population provides a sensitized background in which
Sox2 heterozygosity can have serious consequences.
Acknowledgements
We thank Mr Paul Speeg for excellent technical assistance. We are indebted to
Dr Hans Arnheiter for providing the anti-Mitf antibodies. This work was
supported by NIH RO1s EY10559, EY15766, EY16241 and EY17848, and by
funds from the Abrahamson Pediatric Eye Institute Endowment at Children’s
Hospital Medical Center of Cincinnati (R.A.L.). Deposited in PMC for release
after 12 months.
References
Ashery-Padan, R., Marquardt, T., Zhou, X. and Gruss, P. (2000). Pax6 activity in
the lens primordium is required for lens formation and for correct placement of
a single retina in the eye. Genes Dev. 14, 2701-2711.
Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian, N. and LovellBadge, R. (2003). Multipotent cell lineages in early mouse development depend
on SOX2 function. Genes Dev. 17, 126-140.
Bakrania, P., Robinson, D. O., Bunyan, D. J., Salt, A., Martin, A., Crolla, J. A.,
Wyatt, A., Fielder, A., Ainsworth, J., Moore, A. et al. (2007). SOX2
anophthalmia syndrome: 12 new cases demonstrating broader phenotype and
high frequency of large gene deletions. Br. J. Ophthalmol. 91, 1471-1476.
Burmeister, M., Novak, J., Liang, M. Y., Basu, S., Ploder, L., Hawes, N. L.,
Vidgen, D., Hoover, F., Goldman, D., Kalnins, V. I. et al. (1996). Ocular
retardation mouse caused by Chx10 homeobox null allele: impaired retinal
progenitor proliferation and bipolar cell differentiation. Nat. Genet. 12, 376384.
Callaerts, P., Halder, G. and Gehring, W. J. (1997). PAX-6 in development and
evolution. Annu. Rev. Neurosci. 20, 483-532.
Chow, R. L. and Lang, R. A. (2001). Early eye development in vertebrates. Annu.
Rev. Cell Dev. Biol. 17, 255-296.
Chow, R. L., Altmann, C. R., Lang, R. A. and Hemmati-Brivanlou, A. (1999).
Pax6 induces ectopic eyes in a vertebrate. Development 126, 4213-4222.
Collinson, J. M., Hill, R. E. and West, J. D. (2000). Different roles for Pax6 in the
optic vesicle and facial epithelium mediate early morphogenesis of the murine
eye. Development 127, 945-956.
Dimanlig, P. V., Faber, S. C., Auerbach, W., Makarenkova, H. P. and Lang, R.
A. (2001). The upstream ectoderm enhancer in Pax6 has an important role in
lens induction. Development 128, 4415-4424.
Donner, A. L., Episkopou, V. and Maas, R. L. (2007). Sox2 and Pou2f1 interact
to control lens and olfactory placode development. Dev. Biol. 303, 784-799.
Fantes, J., Ragge, N. K., Lynch, S. A., McGill, N. I., Collin, J. R., HowardPeebles, P. N., Hayward, C., Vivian, A. J., Williamson, K., van Heyningen,
V. et al. (2003). Mutations in SOX2 cause anophthalmia. Nat. Genet. 33, 461463.
Fujiwara, M., Uchida, T., Osumi-Yamashita, N. and Eto, K. (1994). Uchida rat
(rSey): a new mutant rat with craniofacial abnormalities resembling those of the
mouse Sey mutant. Differentiation 57, 31-38.
Furuta, Y. and Hogan, B. L. M. (1998). BMP4 is essential for lens induction in the
mouse embryo. Genes Dev. 12, 3764-3775.
Grindley, J. C., Davidson, D. R. and Hill, R. E. (1995). The role of Pax-6 in eye
and nasal development. Development 121, 1433-1442.
Grindley, J. C., Hargett, L. K., Hill, R. E., Ross, A. and Hogan, B. L. (1997).
Disruption of PAX6 function in mice homozygous for the Pax6Sey-1Neu
mutation produces abnormalities in the early development and regionalization
of the diencephalon. Mech. Dev. 64, 111-126.
DEVELOPMENT
2984 RESEARCH ARTICLE
Halder, G., Callaerts, P. and Gehring, W. J. (1995). Induction of ectopic eyes by
targeted expression of the eyeless gene in Drosophila. Science 267, 1788-1792.
Hever, A. M., Williamson, K. A. and van Heyningen, V. (2006). Developmental
malformations of the eye: the role of PAX6, SOX2 and OTX2. Clin. Genet. 69,
459-470.
Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M.,
Prosser, J., Jordan, T., Hastie, N. D. and van Heyningen, V. (1991). Mouse
small eye results from mutations in a paired-like homeobox-containing gene.
Nature 354, 522-525.
Horsford, D. J., Nguyen, M. T., Sellar, G. C., Kothary, R., Arnheiter, H. and
McInnes, R. R. (2005). Chx10 repression of Mitf is required for the maintenance
of mammalian neuroretinal identity. Development 132, 177-187.
Inoue, M., Kamachi, Y., Matsunami, H., Imada, K., Uchikawa, M. and
Kondoh, H. (2007). PAX6 and SOX2-dependent regulation of the Sox2
enhancer N-3 involved in embryonic visual system development. Genes Cells 12,
1049-1061.
Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R. and Kondoh, H.
(1998). Involvement of Sox1, 2 and 3 in the early and subsequent molecular
events of lens induction. Development 125, 2521-2532.
Kamachi, Y., Uchikawa, M. and Kondoh, H. (2000). Pairing SOX off: with
partners in the regulation of embryonic development. Trends Genet. 16, 182187.
Kamachi, Y., Uchikawa, M., Tanouchi, A., Sekido, R. and Kondoh, H. (2001).
Pax6 and SOX2 form a co-DNA-binding partner complex that regulates initiation
of lens development. Genes Dev. 15, 1272-1286.
Kammandel, B., Chowdhury, K., Stoykova, A., Aparicio, S., Brenner, S. and
Gruss, P. (1999). Distinct cis-essential modules direct the time-space pattern of
the Pax6 gene activity. Dev. Biol. 205, 79-97.
Kondoh, H. (2008). Shedding light on developmental gene regulation through the
lens. Dev. Growth Differ. 50 Suppl. 1, S57-S69.
Kondoh, H., Uchikawa, M. and Kamachi, Y. (2004). Interplay of Pax6 and SOX2
in lens development as a paradigm of genetic switch mechanisms for cell
differentiation. Int. J. Dev. Biol. 48, 819-827.
Kostetskii, I., Li, J., Xiong, Y., Zhou, R., Ferrari, V. A., Patel, V. V., Molkentin,
J. D. and Radice, G. L. (2005). Induced deletion of the N-cadherin gene in the
heart leads to dissolution of the intercalated disc structure. Circ. Res. 96, 346354.
Lang, R. A. (2004). Pathways regulating lens induction in the mouse. Int. J. Dev.
Biol. 48, 783-791.
Li, B., Carey, M. and Workman, J. L. (2007). The role of chromatin during
transcription. Cell 128, 707-719.
Li, J., Patel, V. V., Kostetskii, I., Xiong, Y., Chu, A. F., Jacobson, J. T., Yu, C.,
Morley, G. E., Molkentin, J. D. and Radice, G. L. (2005). Cardiac-specific loss
of N-cadherin leads to alteration in connexins with conduction slowing and
arrhythmogenesis. Circ. Res. 97, 474-481.
Liu, W., Lagutin, O. V., Mende, M., Streit, A. and Oliver, G. (2006). Six3
activation of Pax6 expression is essential for mammalian lens induction and
specification. EMBO J. 25, 5383-5395.
Luo, Y., Ferreira-Cornwell, M., Baldwin, H., Kostetskii, I., Lenox, J.,
Lieberman, M. and Radice, G. (2001). Rescuing the N-cadherin knockout by
cardiac-specific expression of N- or E-cadherin. Development 128, 459-469.
Macatee, T. L., Hammond, B. P., Arenkiel, B. R., Francis, L., Frank, D. U. and
Moon, A. M. (2003). Ablation of specific expression domains reveals discrete
functions of ectoderm- and endoderm-derived FGF8 during cardiovascular and
pharyngeal development. Development 130, 6361-6374.
RESEARCH ARTICLE 2985
Matsumata, M., Uchikawa, M., Kamachi, Y. and Kondoh, H. (2005). Multiple
N-cadherin enhancers identified by systematic functional screening indicate its
Group B1 SOX-dependent regulation in neural and placodal development. Dev.
Biol. 286, 601-617.
Medina-Martinez, O. and Jamrich, M. (2007). Foxe view of lens development
and disease. Development 134, 1455-1463.
Miyagi, S., Masui, S., Niwa, H., Saito, T., Shimazaki, T., Okano, H.,
Nishimoto, M., Muramatsu, M., Iwama, A. and Okuda, A. (2008).
Consequence of the loss of Sox2 in the developing brain of the mouse. FEBS
Lett. 582, 2811-2815.
Nguyen, M. and Arnheiter, H. (2000). Signaling and transcriptional regulation in
early mammalian eye development: a link between FGF and MITF. Development
127, 3581-3591.
Pontoriero, G. F., Smith, A. N., Miller, L. A., Radice, G. L., West-Mays, J. A.
and Lang, R. A. (2009). Co-operative roles for E-cadherin and N-cadherin
during lens vesicle separation and lens epithelial cell survival. Dev. Biol. 326, 403417.
Quiring, R., Walldorf, U., Kloter, U. and Gehring, W. J. (1994). Homology of
the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in
humans. Science 265, 785-789.
Radice, G. L., Rayburn, H., Matsunami, H., Knudsen, K. A., Takeichi, M. and
Hynes, R. O. (1997). Developmental defects in mouse embryos lacking Ncadherin. Dev. Biol. 181, 64-78.
Rodriguez, C. I., Buchholz, F., Galloway, J., Sequerra, R., Kasper, J., Ayala, R.,
Stewart, A. F. and Dymecki, S. M. (2000). High-efficiency deleter mice show
that FLPe is an alternative to Cre-loxP. Nat. Genet. 25, 139-140.
Smith, A. N., Miller, L. A., Song, N., Taketo, M. M. and Lang, R. A. (2005). The
duality of beta-catenin function: a requirement in lens morphogenesis and
signaling suppression of lens fate in periocular ectoderm. Dev. Biol. 285, 477-489.
Song, N., Schwab, K. R., Patterson, L. T., Yamaguchi, T., Lin, X., Potter, S. S.
and Lang, R. A. (2007). pygopus 2 has a crucial, Wnt pathway-independent
function in lens induction. Development 134, 1873-1885.
St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A. and Gruss, P.
(1997). Pax6 is required for differentiation of glucagon-producing alpha-cells in
mouse pancreas. Nature 387, 406-409.
Taranova, O. V., Magness, S. T., Fagan, B. M., Wu, Y., Surzenko, N., Hutton,
S. R. and Pevny, L. H. (2006). SOX2 is a dose-dependent regulator of retinal
neural progenitor competence. Genes Dev. 20, 1187-1202.
Treisman, J. E. (2004). How to make an eye. Development 131, 3823-3827.
Uchikawa, M., Ishida, Y., Takemoto, T., Kamachi, Y. and Kondoh, H. (2003).
Functional analysis of chicken Sox2 enhancers highlights an array of diverse
regulatory elements that are conserved in mammals. Dev. Cell 4, 509-519.
Uwanogho, D., Rex, M., Cartwright, E. J., Pearl, G., Healy, C., Scotting, P. J.
and Sharpe, P. T. (1995). Embryonic expression of the chicken Sox2, Sox3 and
Sox11 genes suggests an interactive role in neuronal development. Mech. Dev.
49, 23-36.
van Raamsdonk, C. D. and Tilghman, S. M. (2000). Dosage requirement and
allelic expression of PAX6 during lens placode formation. Development 127,
5439-5448.
Williams, S. C., Altmann, C. R., Chow, R. L., Hemmati-Brivanlou, A. and
Lang, R. A. (1998). A highly conserved lens transcriptional control element from
the Pax-6 gene. Mech. Dev. 73, 225-229.
Xu, P. X., Zhang, X., Heaney, S., Yoon, A., Michelson, A. M. and Maas, R. L.
(1999). Regulation of Pax6 expression is conserved between mice and flies.
Development 126, 383-395.
DEVELOPMENT
Pax6 and Sox2 in lens and eye development