Download v13a134-qiong pgmkr

Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
Received 14 May 2007 | Accepted 19 July 2007 | Published 20 July 2007
©2007 Molecular Vision
Changes in muscarinic acetylcholine receptor expression in form
deprivation myopia in guinea pigs
Liu Qiong, Wu Jie, Wang Xinmei, Zeng Junwen
State Key Laboratory of Ophthalmology Zhongshan Ophthalmic Center, SunYat-sen University, Guangzhou, China
Purpose: Muscarinic receptor signaling is involved in ocular development and implicated in myopia. The aims of this
study were to identify the presence of muscarinic acetylcholine receptors (mAChRs) in normal ocular tissues of guinea
pigs and to determine if ocular expression of mRNA and protein changes in guinea pigs with or without form-deprived
myopia (FDM).
Methods: One- to two-week-old guinea pigs were monocularly treated with a translucent lens. Twenty-one days after the
induction of FDM, we collected the retina, choroid, sclera, and iris-ciliary body. We used a semiquantitative reversetranscription polymerase chain reaction (RT-PCR) to detect changes in mRNA expression for mAChRs. Western blotting
analysis was used to investigate changes in protein expression for mAChRs. Levels of mAChRs as well as mRNA and
protein expression were statistically compared among FDM, internal, and normal eyes.
Results: We observed expression of mRNA for muscarinic subtypes M1 to M5 in the retina, choroid, sclera, and irisciliary body. Proteins for the M1 to M5 subtypes were present in normal ocular tissues. Their molecular weights ranged
from 80 kDa for M5 to 52 kDa for M1 as noted on Western blotting. Twenty-one days after the induction of myopia, we
observed statistically significant increases in mRNA expression for subtypes M1 (+18.67%) and M4 (+26.48%) as well as
in protein expression for M1 (+24.65%) and M4 (+49.11%) in the posterior sclera of FDM-affected eyes (p<0.05 vs.
internal control and normal eyes).
Conclusions: The ocular tissues of guinea pigs express muscarinic subtypes M1 to M5. In the posterior sclera, expression
of the M1 and M4 subtypes significantly increased in FDM eyes. This finding indicates that muscarinic antagonists may
have the potential to act directly on the sclera as a strategy to prevent myopia.
the retina, retinal pigment epithelium, choroid, and ciliary body
of chicks [17]. Using a reverse-transcription polymerase chain
reaction (RT-PCR) in a tree-shrew model of myopia, Truong
et al [18] found the M1 and M4 subtypes in the retina, choroid, ciliary body, and sclera. The M2 subtype was present in
only the ciliary body whereas the M3 and M5 subtypes were
present in all ocular tissues including the retina, choroid, ciliary body, and sclera. The presence of mAChRs in the sclera
has been confirmed in humans [19].
Muscarinic receptor antagonists such as atropine (a nonselective mAChR antagonist) [20], oxyphenonium (a nonselective mAChR antagonist) [21], pirenzepine (an M1-selective antagonist) [22], and himbacine (an M4-selective antagonist) [23] can inhibit axial myopia in animals and the structural changes that cause myopia. In clinical practice, topical
application of atropine and pirenzepine effectively slows the
progression of myopia in humans [24,25]. These observations
implicate the retina, choroid, and/or sclera as potential sites of
action for muscarinic-active drugs.
Despite these observations, radioligand-binding assay
showed no change in the number or affinity of mAChRs in
the retina, choroid, or sclera of chick eyes during the development of myopia [26]. Ablation of most retinal cholinergic
amacrine cells, the major prejunctional source of acetylcholine in the retinal cholinergic system, had no observable effect
on myopic progression in chickens; moreover, treatment with
atropine was still effective in preventing the progression [27].
Clinically significant refractive errors are the most common visual disorders with myopia affecting approximately half
of the world’s young adult population [1-3]. In several Asian
countries, the prevalence of myopia may be approaching epidemic proportions [4].
Deprivation of pattern vision in human infants such as
those due to ptosis or hemangioma of the lid causes axial elongation of the deprived eye and high degrees of myopia [5-7].
Studies of many vertebrates including chicks [8,9], guinea pigs
[10], mice [11], tree shrews [12], marmosets [13], and monkeys [14] have demonstrated a mechanism involving environmental factors, visual mediators, and active emmetropization.
Degradation or defocusing of an image falling on the retina
may alter retinal neurochemistry, resulting in a signal or signal cascade that traverses the choroid and influencing the
growth and remodeling of the sclera. This process may facilitate changes in eye size. Furthermore, this local system can
detect signs of defocusing and accurately regulate subsequent
changes in eye size with respect to the degree of defocus [15].
To date, five distinct subtypes of muscarinic acetylcholine receptors (mAChRs), designated M1 to M5, have been
characterized [16]. Expression of the mAChRs differs among
ocular tissues. The M2, M3, and M4 subtypes were found in
Correspondence to: Dr. Zeng Junwen, State Key Laboratory of Ophthalmology Zhongshan Ophthalmic Center, SunYat-sen University,
Guangzhou, 510060, China; Phone: 86-020-87333721; FAX: 86-2087333271; email: [email protected]
1234
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
©2007 Molecular Vision
These findings suggest that mAChRs in the retina may not
participate in regulating eye growth during the induction of
myopia. However, pirenzepine inhibits myopia in a dose-dependent fashion; this finding suggests that these drugs exert
their effects by means of receptors [28].
Given the results described, it is necessary to identify the
precise sites and role of mAChR signaling in both normal and
myopic eye growth. The aims of this study were to identify
the presence of mAChRs in normal ocular tissues of guinea
pigs and to determine if the expression of muscarinic receptor
subtypes change in the ocular tissues of guinea pigs with formdeprived myopia (FDM).
METHODS
Animals: Forty one- to two-week-old pigmented guinea pigs
(Cavia porcellus) were maternally reared and housed in large
cages with a cycle of 12 h of darkness and 12 h of white fluorescent lighting. The temperature was maintained at 25 °C.
Food and water were available ad libitum. All experiments
conformed to the statement of the Association for Research in
Vision and Ophthalmology for the use of animals in vision
and ophthalmological research.
We randomly assigned the guinea pigs to a formed-deprived myopia (FDM) group (n=24) or a normal group (n=16).
The FDM group was raised with a diffuser placed over one
randomly selected eye for 21 days and the other eye served as
an internal control group. The diffusers were translucent lenses
with a diameter of 12 mm and a thickness of 0.8 mm. They
were mounted on a matching plastic ring and glued to the periorbital fur of the animals. The diffusers were checked twice
a day and if necessary, briefly removed for cleaning. Animals
in the normal group were chosen from the same litters as the
FDM animals.
Biological measurements: Cycloplegia was induced with
two drops of tropicamide and refractive errors were measured
by means of steak retinoscopy in hand-held, awake animals.
Stable refractive errors were generally obtained after 15 min
when no pupillary response was observed. All refractive errors referred to the spherical-component refractive error, which
was defined as the mean refractive error in the horizontal and
vertical meridians. The axial dimensions of the eyes were
measured by performing ultrasonography with a 10-MHz transducer while the animals were anesthetized with 10% ether in
oxygen. The axial length of the eye was defined as the distance from the front of the cornea to the back of the sclera.
Ocular refraction and axial ocular dimensions were collected
at the start and end of the experiment.
Tissue preparation: After specific treatment periods were
completed, the animals were given a lethal dose of chloral
hydrate and their eyes were enucleated. The conjunctiva, extraocular muscles, and orbital fat were dissected away from
the globe. Digital calipers were used to immediately measure
the equatorial diameters and axial lengths.
Using a surgical microscope (Topcon, Tokyo, Japan) and
razor blade, we cut the eyes of the guinea pigs perpendicular
to the anteroposterior axis and approximately 1 mm posterior
to the ora serrata on the ice plate. The anterior segment of the
eye was discarded except for the iris and the ciliary body. The
retina including the adjacent retinal pigment epithelium was
separated from the choroid and care was taken to avoid crosscontamination of the tissues. From this point on, we referred
to the retina-retinal pigment epithelial complex as the retina.
The posterior sclera was excised by using a 7 mm-diameter
trephine and the head of the optic nerve was discarded. The
iris-ciliary body, retina, choroid, and sclera were snap frozen
in liquid nitrogen and stored at -80 °C.
Reverse-transcriptase polymerase chain reaction: Total
RNA was isolated from the iris-ciliary body, retina, and choroid tissues with a kit (RNeasy Mini kit; Qiagen, Hilden, Germany) and from the sclera with another kit (RNeasy Fibrous
Tissue Mini kit; Qiagen) according to the manufacturer’s instructions. The concentration and purity of the RNA were determined by using a spectrophotometer. The absorbance ratio
of optical densities at 260 and 280 nm (OD260/OD280) was
consistently around 1.90. The integrity of the purified RNA
was verified by means of formaldehyde agarose gel electrophoresis followed by ethidium bromide staining.
We then used a reverse-transcriptase polymerase chain
reaction (RT-PCR) kit (OneStep; Qiagen, Hilden, Germany)
to reverse-transcribe and clone 1.5 µg of the total RNA sample.
This step consisted of reverse transcription at 50 °C for 30
min followed by 95 °C for 15 min. PCR cycle parameters were
45 s of denaturation at 94 °C, 45 s of annealing, 1 min of
extension at 72 °C, and a final 10-min extension at 72 °C. We
performed 31-35 cycles with annealing temperatures of 4859 °C depending on the abundance of the particular message.
Table 1 lists the sequence-specific primers for glyceraldehyde3-phosphate dehydrogenase (GAPDH) and subtypes M1 to
M5 as previously described [29].
Interexperimental variations were avoided by analyzing
samples from various groups in the same run. All of the PCR
products yielded single bands corresponding to the expected
sizes in base pairs (Table 1). PCR reaction products were separated on 2% agarose gels by using ethidium bromide for visualization. The relative abundance of each PCR product was
determined by quantitatively analyzing digital photographs of
gels by using software (Labworks; UVP Products, Upland,
TABLE 1. REVERSE-TRANSCRIPTASE POLYMERASE CHAIN REACTION
PRIMER SEQUENCES FOR MRNAS AMPLIFIED
Target
(GenBank
accession
number)
---------GAPDH
(AB060340)
M1
(AY072058)
M2
(AY072059)
M3
(AY072060)
M4
(AY072061)
M5
(AY072062)
Sequences (5'-3')
(S:Sense, A: Anti-sense)
-----------------------S: AGTCCACTGGCGTCTTCAC
A: GCTTGACAAAGTGGTCGTTGA
S: CTGGCCTGTGACCTCTGG
A: TGAGCTGCTGCTGCTGCC
S: AGCAATGCCTCAGTCATG
A: TTTGATGCATGTTTGCTT
S: AGAATCTATAAGGAAACT
A: TTTTTGAAAACTGCCGCC
S: CTCTGGGCGCCTGCTATC
A: GTCTCTGTGGTGGACAG
S: ACAGAGAAGCGAACCAAA
A: GAGTGTGTGAGCAGCAGC
Temperature
(°C)
----------51
Cycles
-----31
Product
length
(bp)
------639
59
31
437
51
35
659
48
35
506
53
35
466
53
35
455
1235
This table describes the primer sequences used in the RT-PCR experiments. T (°C)&cycles indicate the annealing temperature and
number of PCR cycles for each primer set, respectively. GAPDH is
glyceraldehydes-3-phosphate dehydrogenase.
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
©2007 Molecular Vision
Figure 1. Differences in refractive error and axial length after induction of myopia. Differences in refractive error (A) and axial length (B)
among form-deprived myopic (FDM), internal control (FC), and normal (N) eyes of guinea pigs is illustrated. At 21 days, monocularly
deprivation produced relative myopia, and axial lengths of FDM eyes were significantly greater than those of control eyes. The asterisk
denotes p<0.001 versus N and FC eyes. Data are the mean±standard error of the mean.
Figure 2. Difference in axial length and equatorial diameter after induction of myopia. Differences in (A) axial length and (B) equatorial
diameter with in form-deprived myopic (FDM), internal control (FC), and normal (N) eyes of guinea pigs. Axial lengths of the FDM eyes with
digital caliper measurements were significantly greater than those of control eyes, but equatorial diameters did not significantly differ in FDM
versus control eyes. The asterisk indicates p<0.05 and the double asterisks denote p<0.01. Data are the mean±standard error of the mean.
1236
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
CA). RNase-free water was used to replace the template RNA
as a negative control.
Before we semiquantitatively applied the experimental
samples, we equalized the amount of RNA in all of them. In
addition, optimal conditions (e.g., annealing temperature) for
each set of primers were determined. Cycle-dependent reactions were subsequently performed for each mRNA species to
determine the linear range of detection with ethidium bromide.
After this range was established, PCR was performed with
the lowest cycle number that reliably produced a detectable
product. To minimize variability, we performed duplicate runs
for each mRNA amplified and averaged the data.
To assess levels of various mRNAs in the ocular tissues,
all values were normalized to that of the housekeeping gene,
GAPDH. Thus, GAPDH acted as an internal standard to correct for any variations in RNA isolation.
Western blotting: Tissues were homogenized in ice-cold
extraction buffer (0.01 M Tris-HCl at pH 7.4, 0.15 M NaCl,
1% w/v Triton X-100, 0.1% SDS, 1% deoxycholic acid, 1 mM
EDTA) as well as protease inhibitors (1 µM pepstatin, 1 µg/
ml leupeptin, and 0.2 mM PMSF). After homogenization,
samples were placed on ice for 20 min and centrifuged at
11,000x g for 30 min. The supernatant was decanted and the
pellet was discarded. Protein concentrations were determined
according to the Bradford method by using a Bradford protein
quantization reagent (Shen Neng Bocai, Shanghai, China).
©2007 Molecular Vision
For each experimental condition, 40 µg of total protein
per line was mixed with 5X sample buffer for SDS polyacrylamide gel electrophoresis. The mixture was boiled for three
min, electrophoresed on an 8% SDS polyacrylamide gel, and
transferred to nitrocellulose membranes (Pall Corporation, East
Hills, NY). Protein loading and transfer efficiency were monitored by staining the membranes with 1% Ponceau S. The
membranes were washed three times with TBST (pH 7.6) and
soaked in a blocking solution (5% w/v skim milk powder in
2.5 mM Tris-HCl and 14 mM NaCl plus 0.05% Tween-20) for
one h at room temperature. The membranes were incubated
overnight with primary antibodies to the M1, M2, M3, M4,
and M5 subtypes at a 1:400 dilution (0.5 µg/mL, Santa Cruz
Biotechnology, Santa Cruz, CA) at 4 °C in blocking solution.
The membranes were then washed three times with TBST and
incubated with a horseradish peroxidase-conjugated secondary antibody at a 1:5000 dilution (0.4 µg/mL; Boster, Wu Han,
China) for one h at room temperature. The membranes were
again washed three times with TBST. They were then incubated with enhanced chemiluminescent detection reagents
(Pierce, Rockford, IL) and exposed to film (Kodak, Rochester, NY). GAPDH (Kang Chen, China) was used as a housekeeping protein to normalize the protein load.
Data and statistical analysis: Ocular refraction and biometric measures data were expressed as absolute values and
the mean interocular differences between FDM and control
Figure 3. mRNA and protein expression for receptor subtypes M1 to M5 in the retina, choroid, sclera, and iris-ciliary body of normal guinea
pigs. In A is gel electrophoresis analysis of polymerase chain reaction (PCR) products from the total RNA of the tissues. On RT-PCR,
amplified products were about 437, 659, 506, 466, and 455 bp for the M1, M2, M3, M4, and M5 subtypes, respectively. The M1 to M5
subtypes were found in the retina, choroid, sclera, and iris-ciliary body. RT- represents the negative control, where PCR was run without an
RNA template. B are the protein blots. Lanes were loaded with 40 µg of protein extracted from the various tissues. Proteins for the M1-M5
subtypes were present in normal ocular tissues. Molecular masses (left of each blot) indicate the positions of molecular-mass standards on the
same gel. R: retina; CH: choroid; SC: sclera; I: iris-ciliary body.
1237
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
©2007 Molecular Vision
Figure 4. Changes in mRNA expression in the retina, choroid, and iris-ciliary body of guinea pigs after induction of form-deprived myopia.
Changes in mRNA expression in the retina (A), choroid (B), and iris-ciliary body (C) of guinea pigs after induction of form-deprived myopia.
Ethidium-bromide agarose gels indicate the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) message relative to levels for
receptor subtypes M1 to M5 from total RNA. Bar graphs show changes in mRNA expression (mean±standard error of the mean) where values
were normalized to GAPDH and expressed as ratio of optical density. Semiquantitative reverse-transcription polymerase chain reaction
showed no significant change for M1 to M5 in FDM (F) compared with the internal control (C) and normal (N) eyes.
1238
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
eyes or between the right and left eyes. In the absence of evidence for a skewed distribution, values were analyzed by using t tests. Groups were compared by using a one-way analysis of variance (ANOVA) with a Tukey post hoc test where
p<0.05 indicated a statistically significant difference. All analyses were performed with software (SPSS version 11.5; SPSS,
Chicago, IL).
RESULTS
Ocular biometry and refraction: At 21 days, monocularly deprived eyes had myopia of -5.52±2.54 D and an axial length
of 7.90±0.24 mm (p<0.001 versus normal and internal control eyes, ANOVA and Tukey post hoc test; Figure 1). Axial
lengths of the FDM eyes were significantly greater than those
of control eyes (8.58±0.16 versus 8.42±0.17 mm, p=0.011,
ANOVA and Tukey post hoc test) but equatorial diameters
did not significantly differ in FDM versus control eyes
(9.38±0.2 versus 9.32±0.15 mm, respectively, p=0.64, ANOVA
and Tukey post hoc test; Figure 2).
Reverse-transcriptase polymerase chain reaction and
western blotting for muscarinic acetylcholine receptors in
normal eyes: Table 1 shows the approximate sizes of the amplified products for each mAChR subtype. M1 to M5 were
found in the retina, choroid, sclera, and iris-ciliary body (Figure 3A).
©2007 Molecular Vision
On western blotting with polyclonal mAChRs antibodies
that recognized subtypes, M1 immunoreactivity was detected
in tissue extracts of the retina, choroid, sclera, and iris-ciliary
body at an apparent molecular mass of about 52 kDa. M2 immunoreactivity was weakly detected in these tissues at an apparent molecular mass of about 62 kDa. An intense M3-immunoreactive band was observed for the sclera, choroid, and
iris-ciliary body (molecular mass of about 65 kDa) but the
band was weak in the retina. Immunoreactivity for M4 with
an apparent molecular mass of about 75 kDa was detected in
the retina, choroid, sclera, and iris-ciliary body. A weak M5immunoreactive band was detected in the retina, choroid,
sclera, and iris-ciliary body at molecular mass of about 80
kDa (Figure 3B).
Changes in mRNA expression for muscarinic acetylcholine receptors subtypes: Results from ANOVA of mAChR
gene expression normalized to the expression of GAPDH
showed no significant differences in the retina, choroid, or
iris-ciliary body of FDM eyes relative to the internal control
and normal eyes (all p>0.05 for M1 to M5; Figure 4). In the
posterior sclera, mRNA expression of FDM eyes was significantly greater than that of internal control or normal eyes for
subtypes M1 (p=0.021 or p<0.05, respectively, ANOVA) and
M4 (p=0.010 or p<0.05, respectively, ANOVA). However,
mRNA expression for the M2, M3, and M5 subtypes was not
Figure 5. Typical ethidium-bromide agarose gels indicate the level of glyceraldehyde-3-phosphate dehydrogenase message relative to those of
the subtypes from total RNA. Bar graph shows changes in mRNA expression of receptor subtypes M1 to M5 in the posterior sclera during
form-deprived myopia (F) in guinea pigs. Semiquantitative reverse-transcription polymerase chain reaction showed a significant increase in
mRNA expression for M1 and M4 but not for M2, M3, and M5 compared with the internal control (C) and normal (N) eyes. Values
(mean±standard error of the mean) were normalized for GAPDH and expressed as ratios of optical density. The asterisk denotes p<0.05.
1239
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
©2007 Molecular Vision
significantly altered in FDM eyes (p>0.05, ANOVA; Figure
5). Figure 6A shows the effect of myopia induction on the
mRNA expression for subtypes M1 and M4. After 21 days of
visual deprivation, we found significant increases in M1
(+18.67%, p<0.01) and M4 (+26.48%, p<0.01) compared with
the internal control eyes in the same animals.
Changes in protein expression for muscarinic acetylcholine receptors subtypes: Figure 6B shows the effect of myopia induction on the protein expression for the M1 and M4
subtype. After 21 days of visual deprivation, significant increases were found for M1 (+24.25%, p<0. 01) and M4
(+49.11%, p<0.01) compared with the internal control eyes of
the same animals. On ANOVA, protein expression significantly
increased in the posterior sclera of FDM eyes compared with
internal control and normal eyes for M1 (p=0.014 and p<0.05,
respectively) and M4 (p=0.007 and p<0.01, respectively).
However, protein expression for M2, M3, and M5 was not
significantly altered 21 days after the induction of myopia
(p>0.05; Figure 7).
When we compared FDM eyes with internal control and
normal eyes using ANOVA, we observed no significant alterations in mAChR protein expression in the retina, choroid, or
iris-ciliary body (all p>0.05 for M1 to M5; Figure 8).
DISCUSSION
In guinea pigs, FDM is characterized by an increased axial
dimension of the eye [10]. Studies in other animal models and
humans have implicated muscarinic signaling in the development of myopia [23,30]. In the current study, RT-PCR and
western blotting showed expression of the M1 to M5 subtypes
in all ocular tissues of normal guinea pigs. Furthermore, expression of M1 and M4 in the posterior sclera significantly
increased during the induction of myopia. To our knowledge,
our report is the first to document changes in mAChRs in the
ocular tissues of guinea pig during myopic induction. Our finding suggests that mAChR signaling may participate in scleral
remodeling during the induction of myopia and that the sclera
may be potential sites of action for the mAChRs antagonists
currently used to prevent myopia.
Ligand-binding studies have historically been conducted
to investigate muscarinic receptors. Several specific muscarinic agonists and antagonists exist and have been used to define the distribution of muscarinic receptors in the eye. The
major disadvantage of this method is that the specificity of
these substances is modest in most cases. However, in our
study, antibodies were raised against peptides sequenced in
the third intracellular loop (i3) of each receptor. This area had
the least sequence homology among subtypes and the manufacturer confirmed the specificity of the primary antibodies to
the mAChRs (M1 to M5) by using preabsorption control. Furthermore, mammalian muscarinic subtypes have 89-98% identity in their amino acid sequences [31]. Antihuman mAChR
polyclonal antibodies were used to detect protein expression
of the mAChR subtypes and to specifically distinguish the
mAChRs of guinea pigs. Moreover, our specific primers were
designed to detect mRNA expression of mAChRs and yielded
products of about 500 bp based on an alignment of human,
mouse, and rat mAChRs sequences. Therefore, we combined
RT-PCR with western blotting to investigate specific changes
in mAChR expression.
Acetylcholine is a neurotransmitter in the brain, retina,
and parasympathetic neurons. It is also involved in regulating
the function of basic cells, in cellular differentiation, and in
gene expression during development [32]. Cholinergic signaling has been implicated in the regulation of the maturation
of organs including ocular structures. For instance, inhibition
1240
Figure 6. Effects of form-deprived myopia (FDM) on mRNA and
protein expression for M1 and M4 in the posterior sclera of guinea
pigs. A shows the effect of myopia induction on mRNA expression
for subtypes M1 and M4. After 21 days of visual deprivation, significant increases in M1 (+18.67%, p<0.01) and M4 (+26.48%,
p<0.01) were found, compared with the internal control eyes in the
same animals. B shows the effect of myopia induction on protein
expression for the M1 and M4 subtype. After 21 days of visual deprivation, significant increases were found for M1 (+24.25%, p<0.01)
and M4 (+49.11%, p<0.01), compared with the internal control eyes
of the same animals. Values (mean±standard error of the mean) were
normalized for GAPDH and expressed as the percentage change in
the treated versus control eyes or left versus right eyes of the normal
(N) group (n=5). The double asterisks denote a p<0.01.
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
of cholinesterase activity induced morphological abnormalities of the eye as well as the brain and heart during embryogenesis in chicks [33]. Acetylcholine receptors can be segregated into ionotropic receptors that are selectively activated
by nicotine-like ligands and metabotropic receptors that are
selectively activated by muscarinic-like ligands (mAChR). The
mAChRs belong to a family of receptors that contain seven
transmembrane domains and that elicit cellular responses by
means of interactions with GTP-binding proteins
Cell culture or tissue studies in mammals have demonstrated the expression of mAChRs in various ocular tissues.
Examples of these tissues include the chicken retina (M2-M4)
[17]; the bovine iris sphincter and ciliary processes (M2, M3,
and M4) [34]; cultured rabbit corneal cells including epithelial cells (Ml and M5), endothelial cells (M5), and keratocytes
(Ml and M5) [35]; and cultured human cells including the ciliary smooth muscle and iris sphincter cells (M3) [36]; and human ciliary smooth muscle tissue (M1 to M5) [37]. Furthermore, researchers have demonstrated the expression of
mAChRs in scleral tissues of humans and tree shrews [18].
Immunoreactivity of the M1 subtype was not previously found
in the chick eyes [17] but our study and other mammalian
studies have demonstrated M1 expression in the retina. This
discrepancy may be due to species-related differences.
Studies revealed the existence of mAChRs in the chicken,
rat, and human retina where they were mainly found in the
inner plexiform layer [38-40]. Physiological evidence suggests
that muscarinic binding sites in the inner plexiform layer are
associated with amacrine and/or ganglion cells [41,42]. The
release of acetylcholine from displaced amacrine cells under
©2007 Molecular Vision
the influence of light in rabbits is well documented [43] and
the effects of acetylcholine from these cells on the inner plexiform layer appear to play a role in subsequent signal transduction [44,45]. In different stages of embryological and postnatal development, the subtype, number, and distribution of
the muscarinic proteins change during retinal synaptogenesis
[46]. These findings indicate the crucial role of muscarinic
signaling in embryonic development. Several patterns of expression appear to guide the layout of retinal structures and
later participate in visual function throughout ocular growth.
They also suggest that muscarinic receptors may participate
in the development of experimental myopia in chicks and
mammals, though the location of the mAChRs that participate in growth-regulating pathways in the eye remains unknown. Because regulatory phenomena can occur in eyes separated from central mechanisms by sectioning the optic nerve
[47], the detection of signs of defocusing and the control of
eye growth involve local intraocular mechanisms. One or more
mAChR subtypes in the retina, retinal pigment epithelium,
choroid, or ciliary body may be involved in FDM and in the
visual regulation of ocular growth.
We found that expression of the mAChR subtypes was
not significantly altered in the retina, choroid, and iris-ciliary
body in FDM eyes compared with internal control and normal
eyes. This finding indicates that mAChRs of these tissues may
not be involved in regulating ocular growth during the induction of myopia. Previous observations support this suggestion. Vessey et al [26] found that mAChR density and affinity
in the retina and choroid were not altered during induction of
myopia. Moreover, selective ablation of mAChRs and cholin-
Figure 7. Typical gel indicates the level of glyceraldehyde-3-phosphate dehydrogenase protein relative to those for receptor subtypes M1 to
M5. Bar graph shows the change in protein expression in the posterior sclera during form-deprived myopia (F) in guinea pigs. Semiquantitative
western blotting showed a significant increase in protein expression for M1 and M4 but not M2, M3, and M5, compared with the internal
control (C) and normal (N) eyes. Values (mean±standard error of the mean) were normalized for GAPDH and expressed as ratios of optical
density. The asterisk denotes p<0.05.
1241
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
©2007 Molecular Vision
Figure 8. Changes in protein expression in the retina, choroid, and iris-ciliary body of guinea pigs. There were changes in protein expression
in the retina (A), choroid (B), and iris-ciliary body (C) of guinea pigs. Typical gels indicate the level of GAPDH protein relative to those of
receptor subtypes M1 to M5. Bar graph show changes in protein expression where values (means±standard error of the mean) were normalized for GAPDH and expressed as ratios of optical density. Semiquantitative western blotting showed no significant change for M1 to M5
subtype protein expression in form-deprived myopia (F) versus internal control (C) and normal (N) eyes.
1242
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
©2007 Molecular Vision
pia associated with neonatal eyelid closure in human infants.
Am J Ophthalmol 1981; 91:197-200.
6. O’Leary DJ, Millodot M. Eyelid closure causes myopia in humans. Experientia 1979; 35:1478-9.
7. Robb RM. Refractive errors associated with hemangiomas of the
eyelids and orbit in infancy. Am J Ophthalmol 1977; 83:52-8.
8. Schaeffel F, Glasser A, Howland HC. Accommodation, refractive
error and eye growth in chickens. Vision Res 1988; 28:639-57.
9. Wallman J, Turkel J, Trachtman J. Extreme myopia produced by
modest change in early visual experience. Science 1978;
201:1249-51.
10. Howlett MH, McFadden SA. Form-deprivation myopia in the
guinea pig (Cavia porcellus). Vision Res 2006; 46:267-83.
11. Tejedor J, de la Villa P. Refractive changes induced by form deprivation in the mouse eye. Invest Ophthalmol Vis Sci 2003;
44:32-6.
12. McBrien NA, Norton TT. The development of experimental myopia and ocular component dimensions in monocularly lid-sutured tree shrews (Tupaia belangeri). Vision Res 1992; 32:84352. Erratum in: Vision Res 1993; 33:2381.
13. Troilo D, Nickla DL, Wildsoet CF. Form deprivation myopia in
mature common marmosets (Callithrix jacchus). Invest
Ophthalmol Vis Sci 2000; 41:2043-9.
14. Wiesel TN, Raviola E. Myopia and eye enlargement after neonatal lid fusion in monkeys. Nature 1977; 266:66-8.
15. Troilo D, Wallman J. The regulation of eye growth and refractive
state: an experimental study of emmetropization. Vision Res
1991; 31:1237-50.
16. Bonner TI. The molecular basis of muscarinic receptor diversity.
Trends Neurosci 1989; 12:148-51.
17. Fischer AJ, McKinnon LA, Nathanson NM, Stell WK. Identification and localization of muscarinic acetylcholine receptors in
the ocular tissues of the chick. J Comp Neurol 1998; 392:27384.
18. Truong HT, Cottraill CL, McBrien NA. Expression of muscarinic receptor in tree shrew ocular tissues. Invest Opthalmol Vis
Sci 2000; 41:s132.
19. Qu J, Zhou X, Xie R, Zhang L, Hu D, Li H, Lu F. The presence of
m1 to m5 receptors in human sclera: evidence of the sclera as a
potential site of action for muscarinic receptor antagonists. Curr
Eye Res 2006; 31:587-97.
20. McBrien NA, Moghaddam HO, Reeder AP. Atropine reduces
experimental myopia and eye enlargement via a
nonaccommodative mechanism. Invest Ophthalmol Vis Sci
1993; 34:205-15.
21. Luft WA, Ming Y, Stell WK. Variable effects of previously untested muscarinic receptor antagonists on experimental myopia. Invest Ophthalmol Vis Sci 2003; 44:1330-8.
22. Cottriall CL, McBrien NA. The M1 muscarinic antagonist
pirenzepine reduces myopia and eye enlargement in the tree
shrew. Invest Ophthalmol Vis Sci 1996; 37:1368-79.
23. Cottriall CL, Truong HT, McBrien NA. Inhibition of myopia development in chicks using himbacine: a role for M(4) receptors? Neuroreport 2001; 12:2453-6.
24. Bedrossian RH. The effect of atropine on myopia. Ophthalmology 1979; 86:713-9.
25. Siatkowski RM, Cotter S, Miller JM, Scher CA, Crockett RS,
Novack GD, US Pirenzepine Study Group. Safety and efficacy
of 2% pirenzepine ophthalmic gel in children with myopia: a 1year, multicenter, double-masked, placebo-controlled parallel
study. Arch Ophthalmol 2004; 122:1667-74.
26. Vessey KA, Cottriall CL, McBrien NA. Muscarinic receptor protein expression in the ocular tissues of the chick during normal
ergic amacrine cells of the retina did not affect myopic development [27]. Also, topical administration of atropine could
inhibit axial myopia but did not change the density and affinity of mAChRs in the brain and retina [48]. Retinas of chicks
or tree shrews showed no changes in acetylcholine concentrations as a consequence of FDM [49]. Additionally, investigators reported only a weak correlation between the potency of
muscarinic antagonists to stimulate ZENK, also known as Zif
269, Egr-1, NGFI-A, and Krox-24, expression in glucagon
amacrine cells and their potency to suppress the development
of myopia [50].
The sclera might be the presumed site at which muscarinic antagonists act to prevent myopia since expression of the
M1 and M4 subtypes in posterior sclera significantly increased
in FDM eyes. In the chicken scleral chondrocytes, pirenzepine
(an M1-selective antagonist) inhibited the synthesis of DNA
and glycosaminoglycans [51]. The reduction in glycosaminoglycan synthesis were not caused by direct drug toxicity of
scleral cells because the changes were reversible and because
DNA content was not notably reduced in pirenzepine-treated
eyes [52]. These molecular changes could restore the strength
of the sclera, inhibit axial elongation of the eye, and therefore
prevent axial myopia. In our study, expression of M1 and M4
in the posterior sclera was upregulated in FDM. As reduced
choroidal blood flow [53] and decreased acetylcholine synthesis in chick choroid and ciliary ganglion has been reported
in eyes developing myopia, we postulate that the upregulated
expression might have resulted from signals in the retina and
choroid [54]. Because acetylcholine is a neuromodulator and
a ligand of the neurotransmitter mAChRs, it plays an important role in regulating the expression of these receptors.
In conclusion, our study provided a comprehensive profile of the expression of mAChRs in the ocular tissues of guinea
pigs. Expression of the M1 and M4 subtypes significantly increased in the posterior sclera of FDM eyes. Therefore, the
sclera is a possible site of action for muscarinic antagonists in
preventing mammalian myopia.
ACKNOWLEDGEMENTS
This study was supported by grant 30572005 from the National Natural Science Foundation, China and by grant
SUMS98677 from the CMB Foundation.
REFERENCES
1. Au Eong KG, Tay TH, Lim MK. Race, culture and Myopia in
110,236 young Singaporean males. Singapore Med J 1993;
34:29-32.
2. Mavracanas TA, Mandalos A, Peios D, Golias V, Megalou K,
Gregoriadou A, Delidou K, Katsougiannopoulos B. Prevalence
of myopia in a sample of Greek students. Acta Ophthalmol Scand
2000; 78:656-9.
3. Rose K, Smith W, Morgan I, Mitchell P. The increasing prevalence of myopia: implications for Australia. Clin Experiment
Ophthalmol 2001; 29:116-20.
4. Seet B, Wong TY, Tan DT, Saw SM, Balakrishnan V, Lee LK, Lim
AS. Myopia in Singapore: taking a public health approach. Br J
Ophthalmol 2001; 85:521-6.
5. Hoyt CS, Stone RD, Fromer C, Billson FA. Monocular axial myo1243
Molecular Vision 2007; 13:1234-44 <http://www.molvis.org/molvis/v13/a134/>
and myopic eye development. Brain Res Dev Brain Res 2002;
135:79-86.
27. Fischer AJ, Miethke P, Morgan IG, Stell WK. Cholinergic amacrine cells are not required for the progression and atropinemediated suppression of form-deprivation myopia. Brain Res
1998; 794:48-60.
28. Leech EM, Cottriall CL, McBrien NA. Pirenzepine prevents form
deprivation myopia in a dose dependent manner. Ophthalmic
Physiol Opt 1995; 15:351-6.
29. So I, Yang DK, Kim HJ, Min KW, Kang TM, Kim SJ, Kim KW,
Park KH, Jeon JH, Choi KH, Kim IG. Five subtypes of muscarinic receptors are expressed in gastric smooth muscles of guinea
pig. Exp Mol Med 2003; 35:46-52.
30. Syniuta LA, Isenberg SJ. Atropine and bifocals can slow the progression of myopia in children. Binocul Vis Strabismus Q 2001;
16:203-8.
31. Nietgen GW, Schmidt J, Hesse L, Honemann CW, Durieux ME.
Muscarinic receptor functioning and distribution in the eye:
molecular basis and implications for clinical diagnosis and
therapy. Eye 1999; 13:285-300.
32. Wessler I, Kirkpatrick CJ, Racke K. The cholinergic ‘pitfall’:
acetylcholine, a universal cell molecule in biological systems,
including humans. Clin Exp Pharmacol Physiol 1999; 26:198205.
33. Kitos PA, Anderson DS, Uyeki EM, Misawa M, Wyttenbach CR.
Teratogenic effects of cholinergic insecticides in chick embryos—II. Effects on the NAD content of early embryos.
Biochem Pharmacol 1981; 30:2225-35.
34. Honkanen RE, Howard EF, Abdel-Latif AA. M3-muscarinic receptor subtype predominates in the bovine iris sphincter smooth
muscle and ciliary processes. Invest Ophthalmol Vis Sci 1990;
31:590-3.
35. Lind GJ, Cavanagh HD. Identification and subcellular distribution of muscarinic acetylcholine receptor-related proteins in rabbit corneal and Chinese hamster ovary cells. Invest Ophthalmol
Vis Sci 1995; 36:1492-507.
36. Woldemussie E, Feldmann BJ, Chen J. Characterization of muscarinic receptors in cultured human iris sphincter and ciliary
smooth muscle cells. Exp Eye Res 1993; 56:385-92.
37. Gil DW, Krauss HA, Bogardus AM, WoldeMussie E. Muscarinic
receptor subtypes in human iris-ciliary body measured by immunoprecipitation. Invest Ophthalmol Vis Sci 1997; 38:143442.
38. Zarbin MA, Wamsley JK, Palacios JM, Kuhar MJ. Autoradiographic localization of high affinity GABA, benzodiazepine,
dopaminergic, adrenergic and muscarinic cholinergic receptors
in the rat, monkey and human retina. Brain Res 1986; 374:7592.
39. Hruska RE, White R, Azari J, Yamamura HI. Muscarinic cholin-
©2007 Molecular Vision
ergic receptors in mammalian retina. Brain Res 1978; 148:4938.
40. Sugiyama H, Daniels MP, Nirenberg M. Muscarinic acetylcholine receptors of the developing retina. Proc Natl Acad Sci U S
A 1977; 74:5524-8.
41. Jardon B, Bonaventure N, Scherrer E. Possible involvement of
cholinergic and glycinergic amacrine cells in the inhibition exerted by the ON retinal channel on the OFF retinal channel. Eur
J Pharmacol 1992; 210:201-7.
42. Negishi K, Kato S, Teranishi T, Laufer M. An electrophysiological study on the cholinergic system in the carp retina. Brain Res
1978; 148:85-93.
43. Masland RH, Mills JW, Cassidy C. The functions of acetylcholine in the rabbit retina. Proc R Soc Lond B Biol Sci 1984;
223:121-39.
44. Linn DM, Massey SC. Homocysteate-evoked release of acetylcholine from the rabbit retina. J Neurochem 1996; 66:153-60.
45. Neal MJ, Cunningham JR, Hutson PH, Semark JE. Calcium dependent release of acetylcholine and gamma-aminobutyric acid
from the rabbit retina. Neurochem Int 1992; 20:43-53.
46. Hutchins JB. Development of muscarinic acetylcholine receptors in the ferret retina. Brain Res Dev Brain Res 1994; 82:4561.
47. Norton TT, Essinger JA, McBrien NA. Lid-suture myopia in tree
shrews with retinal ganglion cell blockade. Vis Neurosci 1994;
11:143-53.
48. Tigges M, Iuvone PM, Fernandes A, Sugrue MF, Mallorga PJ,
Laties AM, Stone RA. Effects of muscarinic cholinergic receptor antagonists on postnatal eye growth of rhesus monkeys.
Optom Vis Sci 1999; 76:397-407.
49. McBrien NA, Cottriall CL, Annies R. Retinal acetylcholine content in normal and myopic eyes: a role in ocular growth control? Vis Neurosci 2001; 18:571-80.
50. Bitzer M, Kovacs B, Feldkaemper M, Schaeffel F. Effects of
muscarinic antagonists on ZENK expression in the chicken
retina. Exp Eye Res 2006; 82:379-88.
51. Lind GJ, Chew SJ, Marzani D, Wallman J. Muscarinic acetylcholine receptor antagonists inhibit chick scleral chondrocytes.
Invest Ophthalmol Vis Sci 1998; 39:2217-31.
52. Truong HT, Cottriall CL, Gentle A, McBrien NA. Pirenzepine
affects scleral metabolic changes in myopia through a non-toxic
mechanism. Exp Eye Res 2002; 74:103-11.
53. Shih YF, Fitzgerald ME, Norton TT, Gamlin PD, Hodos W, Reiner
A. Reduction in choroidal blood flow occurs in chicks wearing
goggles that induce eye growth toward myopia. Curr Eye Res
1993; 12:219-27.
54. Pendrak K, Lin T, Stone RA. Ciliary ganglion choline
acetyltransferase activity in avian macrophthalmos. Exp Eye Res
1995; 60:237-43.
The print version of this article was created on 20 Jul 2007. This reflects all typographical corrections and errata to the article through that date.
Details of any changes may be found in the online version of the article. α
1244