Download Fall Semester Exam Review

2013 FALL SEMESTER EXAM REVIEW!
CHEMISTRY/BIOMOLECULES
1. What are the 12 levels of organization starting with atom -> biosphere?
2. How do monomers and polymers relate?
3. What are the monomers of proteins?
4. What are the monomers of carbohydrates?
5. What are the monomers of lipids?
6. What are the monomers of nucleic acids?
7. Label the following as protein, carbohydrate, lipid, or nucleic acid:
8. Each of the molecules above contains hydrogen, oxygen, and carbon. What element is only found
in proteins and nucleic acids?
9. What is the function of carbohydrates?
10. What is the function of an enzyme?
11. What about an enzyme allows it to “work” with a substrate?
PHOTOSYNTHESIS/CELLULAR RESPIRATION
12. Which process temporarily stores energy in ATP molecules?
13. The picture to the left is an ATP molecule. Where must the molecule be broken
to release energy and become ADP?
14. What is the equation for photosynthesis?
15. What is the equation for cellular respiration?
CELLS and their ORGANELLES
16. Schleiden, Schwann and Virchow came up with the cell theory. What are the 3 parts to the cell theory?
17. What is a eukaryote?
18. What is a prokaryote?
19. Label the next 4 pictures as prokaryotes or eukaryotes:
20. What is the function of the ribosome?
21. What is the function of the nucleus?
22. What is the function of the vacuole?
23. What is the function of the mitochondria?
24. What is the function of the lysosome?
25. What is the function of the chloroplast?
26. Draw a mitochondrion.
27. Draw a chloroplast.
CELL TRANSPORT
28. What is osmosis?
29. Which type of transport requires energy, active or passive?
30. Which type of transport moves molecules against their concentration gradient from an area of low to high,
active or passive?
31. Water moving into a cell is known as _________tonic.
32. Water moving out of a cell is known as ________tonic.
33. Using the diagram to the left, which molecule is moving by active transport
and which one is moving by passive transport?
ECOLOGY
34. What does this pyramid represent?
35. What is succession?
36. What is a pioneer species?
37. At which step in the following picture of succession is the community most stable?
38. What is an organism’s niche?
39. What is an organism’s habitat?
40. What is the role of a decomposer?
41. If biodiversity in an area decreases, does the ecosystem become more or less stable?
42. What does the phrase “carrying capacity” mean?
43. Look at the graph to the left. What does the area labeled “X” represent?
44. If the phytoplankton starts with 100% of the energy from the sun,
what percentage of energy would go to the next four levels in this food chain?
45. If the small invertebrates suddenly decreased would the clams,
crabs, water plants, and crayfish populations go up or down?
46. What is mutualism?
47. What is parasitism?
48. What is commensalism?
49. What is a producer/autotroph?
50. What is a consumer/heterotroph?
51. What is a carnivore?
52. What is an omnivore?
53. What is a herbivore?
54. What is a native species?
55. What is an invasive species?
56. What is the difference between predators and prey?
57. Review the nitrogen cycle. If nitrogen fixing bacteria were removed from the nitrogen cycle, how would that
affect the cycle?
58. What is the difference between biotic and abiotic?
59. Give an example of something biotic and something abiotic.
60. The black line represents squirrels, the dotted line represents coyotes.
Using the graph, what type of relationship is shown between the two animals?
61. If there was a long environmental change, would large mammals or small insects be more likely to survive?
VIRUSES
62. A virus must have a living _________ cell to reproduce.
63. Influenza, the flu, is caused by a ___________.
64. A _________________ in immunity to influenza could cause a worldwide outbreak.
65. Antibiotics can be used to treat ____________ infections, but not _____________ infections.
66. HIV attacks what type of cells?
CELL CYCLE
67. Label each step of the cell cycle above.
68. During mitosis, a parent cell that has 6 chromosomes would produce two daughter cells, each containing
____ chromosomes.
69. What process is represented by the arrows in the diagram to the left?
70. The process of mitosis is when a parent cell divides to produce two genetically _____________ daughter
cells.
71. Cell specialization means that all cells have the same DNA but may look differently because they all have
different _____________.
72. The diagram to the left shows that from a fertilized egg cell, heart cells, brain
cells and lung cells are produced. This means that all cells have the same ________.
73. Cancer is when a cell loses the ability to control how fast it ________________.
74. Where would the words mutations, radiation, and cancer be placed on the diagram to the
left?
75. Label the steps of the cell cycle and write what happens at each step.
DNA/DNA REPLICATION/TRANSCRIPTION/TRANSLATION
76. What two scientists were given credit for discovering the structure of the DNA double helix?
77. Where does the process of transcription occur?
78. Where does translation occur?
79. What is produced during transcription?
80. What happens during translation?
81. In your own words, describe how protein synthesis occurs starting with RNA polymerase binding to one DNA
strand to make an mRNA copy of the selected DNA section, and ending with the polypeptide chain folding into
the appropriate functional protein to be used in or by the cell.
82. Decode the following mRNA section: 5’ AUGGUCCCCUCAGGGAACAGAUGCUAA 3’
83. What is DNA Replication?
84. Where does DNA Replication take place in the cell?
85. What enzyme is used to separate the 2 sides of the DNA double helix so DNA Replication can occur?
86. A DNA molecule is found to contain 30% cytosine. What percentage of the molecule is adenine?
87. The sides of the DNA molecule are composed of what?
88. The rungs, or steps, of the DNA molecule are composed of what?
89. What holds the 2 sides of the DNA double helix together?