Download and Cells Sequence Analysis and Expression of Met

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Transcript
Mol. Cells, Vol. 8, No. 2, pp. 2 19-225
Molecules
and
Cells
© Springer-Verlag 1998
Sequence Analysis and Expression of Met-rich Storage Protein
SP-1 of Hyphantria cunea
Cheon Hyang Mi, Hwang In Hwan; Chung Duck Hwa,2 and Seo Sook Jae*
Department of Biology, College of Natural Sciences, Gyeongsang National Uni versity, Chinju 660- 701, Korea;
I Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National Uni versity, Chinju 660-701 , Korea;
2 Department of Food Science and Technology, Gyeongsang National University, Chinju 660-701, Korea.
(Received on December 8, 1997)
We isolated and se quenced a cDNA clone
corresponding to the 2.5 kb storage protein (SP-I) from
fall webworm, Hyphantria cunea. The SP-I gene
encoded a pre-protein of 753 amino acids, including a
signal peptide of 15 amino acids. The deduced amino
acid sequence of SP-I contained one potential Nglycosylation site, and the calculated isoelectric point
and molecula r weight of secreted SP-I were pI = 8.38
and 86.8 kDa, respectively. A Northern blot of mRNA
from various developmental stages revealed that the
SP-I mRNA in fat body appears in early last instar
larvae and accumulates to a maximum level at the end
of last instar larvae. The persistence of SP-I transcript
through the early pupal stage suggests that its mRNA
might be stable or expressed during the pupal stage.
SP-I transcription was also found in the ovary as well
as testis. This local expression of SP-I in both
reproductive organs seems to allow the insect to keep
its reproductive activity under a nutritional stress.
Keywords: Hyphantria cunea; Met-rich Storage Protein ;
Ovary; Storage Protein.
Introduction
Storage proteins are considered to be major components in
the hemolymph of immature stages of insects and have
been identified in a wide range of species, both
hemimetabolous and holometabolous (Kanost et ai., 1990;
Telfer and Kunkel, 1991).
They are synthesized primarily in the larval fat body
and are abundant in the hemolymph, particularly during the
* To whom correspondence should be addressed.
Tel: 82-591-751-5951 ; Fax: 82-591-54-0086
E-mail:sookjae@ gshp.gsnu.ac.kr
feeding phase of the last larval stadium (Levenbook,
1985). Some are taken up by the fat body during the
wandering and prepupal stages and deposited as protein
granules (Locke and Collins, 1968; Miller and Silhacek,
1982; Sakurai et ai. , 1988a). Synthesis, release into the
hemolymph , uptake by the fat body, and subsequent
utilization of the storage protein appear to be under precise
developmental regulation.
These proteins have molecular masses of about 500 kDa
and are hexamers composed of approximately 72-80 kDa
subunits, which mayor may not be identical. These
molecules function as a storage reservoir or amino acids
used to support the intense biosynthetic activity that
underlies metamorphosis (Levenbook and Bauer, 1984).
The two main classes of storage proteins are (a)
arylphorin which is a designation for proteins with tyrosine
and phenylalanine contents totalling more than 15% and
which can be incorporated into cuticles , and (b)
methionine-rich storage proteins which exceed 4% of the
methionine contents that are predominantly expressed in
females (Telfer and Kunkel, 1991).
The storage proteins represent important model proteins
because their ge nes are highly expressed and are
developmentally regulated. In order to investigate gene
regulation, it is necessary to know the sequence of the
genes and mRNAs which code for the proteins. The cDNA
and gene structure for the methionine-rich storage protein
from B. mori have been reported (Leven book and Bauer,
1984; Sakurai et ai. , 1988b). The cDNAs of two basic
j uvenile hormone suppressible proteins (BJHSPs) from T
ni were reported (Jones et ai., 1993). The genes for the
three arylphorin subunits from D. melanogaster (Dalaney
Abbreviation s: B. mori, Bombyx mori ; D. melanogaster,
Drosophila melanogaster; H. cunea, Hyphantria cunea; M. sexta ,
Manduca sexta ; SP-l , storage protein-l ; T. ni, Trichoplusia ni.
220
Storage Protein-l Gene in Hyphantria cunea
et al., 1986 ; Lepesant et al., 1986; Srrtith et al. , 1981) and
for the arylphorin from M. sexta (Willott et al., 1989) have
been cloned and its sequence data reported. However, to
date, the sequence for H. cunea storage protein has not
been reported.
Two forms of storage proteins termed SP-l and SP-2
accumulate in the larval hemolymph of the fall webworm,
Hyphantria cunea (Kim et al., 1989). Both storage proteins
are hexamers and phosphorylated glycolipoproteins. They
show sirrtilar quantitative changes during development in
males and females ; however, SP-I is more abundant (Kim
et al., 1989).
In this paper, we report the complete cDNA sequence
for the storage protein-l (SP-I) subunit from H. cunea. In
addition, we report that SP-l shows a remarkable degree of
sequence homology to the juvenile hormone suppressible
protein from T ni, as well as the female specific storaoe
"
b
protem from B. mOrL.
Materials and Methods
Animals Fall webworms, H. cunea, were reared on artifi cial
diet at 27°C and rel ative humidity of 75 % with a photoperiod of
16 L:8 D.
Isolation of nucleic acids Total RNA was isolated from ti ssues
by lysis buffer, spin column, and wash buffer according to the
protoco l reco mm ended by the manufacturer (Qi age n In c .
Chatsworth, USA). From total RNA, poly(A/ RNA was prepared
by oli gotex suspen sion and sp in columns according to the
protocol reco mm ended by th e manufac turer (Qi age n In c .
Chatsworth, USA) . All RNA samples contained intact rRNA and
were free of contaminating DNA as evaluated in agarose gels.
Primer sy nthesi s, PCR, and s ubcloning of PCR
products Oligo nucleotide primers were synthesized by Korea
Bioneer Inc. The 20 mer and 17 mer oligonucleotide degenerated
prim e rs were sy nthesized for th e amino acid sequ ences
YYKDDTY (17-23 amino acids) and NQFINT (84-89 amino
acids),
respec tive ly:
Primer
I
(2 0
mer )
5'GTNGTNAARGAYGAYAAYTA-3' , Primer 2 ( 17 mer) 5 ' GTRTTDATRAAYTGRTT-3' . Using 5 ~g of poly(A / RNA
prepared fro m larval fat bodies, the first strand of cDNA was
synthesized with AMY reverse transcriptase and the degenerated
primers as a template for PCR. The PCR cycles were as follows;
3 min at 94°C; 40 cycles of 30 s at 94°C I I min at 40°C I I min
at n oc; 3 min at n °e.
The amplified DNA fragment was used as the template in the
second PCR, which was performed with Taq DNA polymerase
and the same degenerated primers.
The resulting PCR products were separated on a 1% agarose
gel, and a 0.2 kb fragment was obtained. This fragment was
excised from the agarose gel , purified, ligated into a T-vector, and
amplified in XLI Blue competent cells.
Screening of the cDNA library The cDNA library of H. cunea
was kindly provided by Dr. Ho-Yong Park (Genetic Engineering
Research Institute, KIST, Korea).
For screening, 50,000 plaques were plated on l5 cm diameter
agar plates. Nitrocellulose filters (Schleicher & Schuell Dassel
Germany)
were taken from the plates and hybridi zed' at hicrh
.
0
stnngency (65°C and 0.1 X SSC) with the radioactive-l abelled
PCR product. The positi ve clones were rescreened at low density
on 9 cm diameter agar plates. Colony hybridization yielded 5
po sitiv e clones from the library. Po sitiv e pl aqu es were
indi vidually isolated in phage buffer by the plate lysate method
followed by lambda DNA extraction (Sambrook et aL. , 1989). The
insert of the positive clone was subcloned into an EcoRl site of
pBluescript KS (+).
Subcloning and DNA sequencing Suitable cDNA fraoments
which hybridi zed with the radioactive-labelled PCR ;'oduct:
were removed from the gels by electroelution , followed by
phenol extraction and ethanol precipitation in the presence of
2 ~g glycogen. Subsequently, these DNA fragments were ligated
into pBluescript KS (+), followed by electroporation into JMI09
cells (Sambrook et ai., 1989).
The sequencing reaction was based on the dideoxynucleotide
chain termination method of Sanger et al. (1977) and was carried
out according to the thermal cycle DNA sequencing protocol with
DNA pol ymerase from Thermus thermophilus HB7 (Korea
Bioneer Inc.). Template-specific and uni versal primers derived
from pBluescript were used in the sequence reactions in the
presence of ex-35S-labelled dATP. Subclones for sequencing were
prepa red by ligatin g suitable re striction fragments into
pBluescript followed by transform ation into JML09 cell s.
Computer-assisted analysis of sequence data The EMBL
DataBank was searched with FASTA and BLAST. Editing and
analysis of the DNA sequence data were performed with the
DNASIS (Hitachi Software Engineering Co. , Hitachi , Japan).
Northern blotting Ten microgram of total RNA from fat body
and other tissues were denatured and subjected to electrophoresis
in a 1.2% agarose gel containing 2.2 M formaldehyde. Following
eletrophoresis, gels were rinsed in LO X SSC and transferred to
nitrocellulose (Schleicher & Schuell, Dassel, Germany) in lO x
SSe. Blots were prehybridized with 1.5 X SSPE, 7% SDS, 10%
PEG, 0.1 mglml sonicated denatured salmon sperm DNA and
0.25 mgl ml BSA for 4 h at 65 0e. Hybridization was performed
for 18 h at 65°C in the prehybridization buffer with 5 X 105 cpml
mI of 32P-Iabelled probes, prepared according to the method of
random priming (Feinberg and Yolgelstein, 1983).
The filter was then washed twice with I X SSC, 0.1 % SDS at
65°C for 15 min, and subsequently two more times for 15 min
with 0.1 X SSC, 0.1% SDS at 65°C before exposure to X-ray fi lm
at -70°C.
Results and Discussion
In the present study, the mRNA sequence coding for the
major storage protein of H. cunea, fall web worm, was
molecularly cloned and its nucleotide sequence was
deterrrtined. This is the first complete arrtino acid sequence
of a storage hexamer from Hyphantria.
The cDNA library from fall webworm mRNA was
. h a 32P-Iabelled probe of 216 bp peR product
screened WIt
Cheon Hyang Mi et at.
which are complementary from 17 to 89 of the amino acid
sequence. From a total of 50,000 screened plaques, five
positive plaques were isolated. They were checked for
insert lengths after plasmid isolation by digestion with
EcoRI and XhoI. One insert was 2.5 kb showing two
fragments of 2.3 and 0.2 kb, which was expected from the
presence of the EcoRI site in the SP-I cDNA . The
transcript (2.5 kb) was of sufficient size to code for the
polypeptide subunit of SP-I - the major Hyphantria
hexamerin (Kim et aI., 1989) . The fragments were
subcloned into pBluescript SK and sequenced.
Figure I shows a restriction map of a 2.5 kb EcoRIXhoI fragment and the strategy used to sequence the SP-I
cDNA. DNA sequence data and the deduced amino acid
sequence for the SP-I are presented in Fig. 2. Sequence
analysis of SP-I revealed a 2259 bp open reading frame
and the 753 amino acids. The 753 amino acids encoded by
the open reading frame contained a typical signal peptide
and one N-glycosylation site (NXT/S) , which should
provide the accepting site of sugar (Fig. 2, dotted line). We
identified the presence of carbohydrate in Hyphantria SP1 with PAS staining (data not shown). The result of the Nterminal primary structure of SP-I clearly showed the
presence of a signal sequence for secretion in the nascent
SP-I. The N-terminus of SP-I was preceded by a sequence
encoding 15 amino acids , typical for a signal peptide.
Hence, a putative signal peptide cleavage site was assigned
between Ala 1s and Ser l6 as indicated in Fig. 2. In the
deduced amino acid sequence of SP-l , the positively
charged amino terminus (Met-Lys) was followed by 13
amino acids , most of which were hydrophobic, with a
single serine residue following the hydrophobic domain .
Analogous structures have been found for many secretory
proteins (Pearlman and Halvorson, 1983). Signal peptides
of other insect storage hexamers vary between 15 and 18
amino acids (Fujii et al., 1989; Jones et aI., 1990;
Levenbook and Bauer, 1984; Memmel et aI. , 1992; 1994;
Willott et aI., 1989). The calculated isoelectric point and
molecular weight of the secreted SP-I were pI = 8.38 and
86.8 kDa, respectively. One translational stop codon TAA
was located at +2260. A single polyadenylation signal site
(AATAAA) was present at 35 bp from the stop codon.
The derived sequence of SP-l was used to search the
EMBL Data Bank using FASTA and BLAST for sequence
similarities. Multiple sequence alignment was carried out
EI
T3
I
Sc
EV
P P
I
SI
EV
I
I
EI
...
X
T7
Fig. 1. Restriction map and sequencing strategy of the SP-l
eDNA. The direction and extent of sequencing are shown by
arrows. EI, EcoRI; Sc, Sad; EV, EcoRV; P, PstI ; S1, Sail ; X,
XhoI.
221
with amino acid sequences of SP-l and six other storage
hexamers, which were found to have extensive homology
to SP-l from H. cunea. The result of the amino acid
alignment is illustrated in Fig. 3.
Based on common positions in amino acid sequence
alignments, the SP-I exhibits a more closely related
identity with T ni BJHSPI compared to other storage
proteins (Figs. 3 and 4). Amino acid identities between SP1 of H. cunea and BJHSPI of T ni and SPI of B. mori
were 66.3% and 64.4%, respectively. Between SP-l and
arylphorin from M . sexta, the amino acid identity showed
a very low value of 12.6% (Fig. 4). Its relatively high
content of methionine (6%) and low content of aromatic
amino acid residues (Tyr+ Phe 8.5%) correlated with its
high homology to the Met-rich storage proteins from T ni
(Jones et aI. , 1993) and B. mori (Sakurai et aI., 1988a)
(Table 1, Fig. 3). Generally, Met-rich storage protein is
known to exhibit sexual dimorphism ; in some species, only
traces of it occur in males (Telfer and Kunkel, 1991). On
a structural basis, Hyphantria hexamerin SP-I meets the
criteria of a Met-rich storage protein, but it is not sexspecifically accumulated as are Met-rich storage proteins
in other species.
Changes in the amount of SP-I mRNA in fat body
during the development of H. cunea was studied by means
of RNA blot hybridization. Fat bodies were dissected from
staged insects. RNA was extracted from each fat body
preparation and electrophoresed under denaturing
conditions. SP-l transcripts appeared in small amounts in
the early 7th instar larvae, and then increased to a
maximum level in the late 7th instar larvae. The levels
gradually declined and remained low throughout the
middle pupal development (Fig. 5A). A weak hybridization
signal in the lower part of the membrane was found in
RNA from almost all the staged fat bodies. It seemed to be
a part of the smeared band of 2.5 kb SP-l RNA. The longer
persistence of SP-I mRNA during the pupal stage may be
due to a reduced level of expression or a greater stability
of this mRNA. It is noteworthy that a small but significant
amount of RNA complementary to the SP-l cDNA
sequence was detectable at the early pupal stage in B. mori
(Izumi et aI. , 1988). Although significant overlap occurred
in the fifth larval instar, the pHV-I transcript coding for the
82 kDa storage protein persisted into early pupal
development, while pHV-2 RNA coding arylphorin
appeared in fourth instar larvae and abruptly disappeared at
the cessation of feeding in the final instar larvae of
Heliothis virescens (Leclerc and Miller, 1990). Juvenile
hormone (JH)-suppressible hexamerins, synthesized only
during the last instar, usually persist in the hemolymph
well into the pupal stage of development and thus do not
exhibit the typical storage protein profile (Jones et aI.,
1990; Leclerc and Miller, 1990; Ray et aI., 1987a, 1987b).
In H. cunea, the lack of complete clearance of SP-I in the
pupal hemolymph may be related to the persistence of its
Storage Protein-I Gene in Hyphantria cunea
222
CCT TGG ACA CGC CGC ATT CTT GAC AAC ACC GAA GAA ATC AGT GGA 1800
ATG AGG GTC CIT GTG GTA GTA GeT GeT CTT Gee CTG GCT TCG Gee" 45
M
R
V
L
V
V
V
A
A
L
A
LAS
A
AGe GTG GTe AAA GAT GAC Ace TAC TCT AGe Ace GTe ATe GGC AGA
y
s
y
P
K
P
T
X
s
§
T
V
G
B
GAA TCC ATG GTT Me GTG GAC GTe AAG Ace AAG GAG GTC TCC ATe
E
M
V
N
V
D
V
K
T
K
E
LSI
CTT AAG TTA CTG Me CAe ATT TTG CAG CCA Ace ATG TAC GAT GAT
L
K
L
L
N
H
L
Q
P
Y
M
Y
0
0
ATT eGG GAG ATe Gee AGG GAG TGG Gee ATe GAA GAG Me AAG GAC
IRE
I
ARE
W
A
U
E
E
B
J
D
AAA TAT CIG AAA ACT GAT ATe GTA AAT CAG TTT ATe AAT Ace TTC
K
Y
L
K
T
0
V
N
Q
FIN
T
F
AAG ATG GGT ATG CIT eCG eGG GGT GAA GTG TTC GTC CAC AGe Me
K
M
G
M
L
P
R
G
E
V
F
V
H
N
Me TTG CAe ATT GAC CAG GCG GTT AAG GTG TTC AGG ATT CTT TAC
N
L
HID
Q
A
V
K
V
F
R
L
Y
TTT GeT AAG GAC TTT GAT GTA TTC ATT AGG ACT TGC TGT TGG CTA
F
A
K
0
F
0
V
FIR
Tee
W
L
AGG GAG eGC ATe AAe GGe GGC ATG TTC GTG TAT Gee CTT ACT GCA
R
E
R
I
N
G
G
M
F
V
Y
A
L
T
A
GeT GTG TTT CAC AGG AAC GAC TGC AGA GGA ATT ATT CTT CCT GCC
A
V
F
H
R
N
0
C
R
G
L
P
A
CCC TAC GAG ATC TAC cce TAT TTC TTT GTC GAC AGC MC ATA ATC
P
Y
ElY
P
Y
F
F
VON
I
I
CAA - AAG GCC CTC ATG ATG AAA ATG ACC AGA GCC GCA ACT GAT CCA
Q
K
A
L
M
M
K
M
GTC ATC ATG GAC TAC TAT GGT ATC
V
M
0
Y
Y
G
T
R
A
A
T
K
P
AAA GTG ACC GAC AAG AAT CTG
K
V
T
0
K
N
L
ATT GTA ATT GAC TGG CGC AAG GGA GTC CGT CGC ACC TTG ACT GAA
I
V
lOW
R
K
G
V
R
R
T
L
T
E
AAT GAC CGA ATT GGG TAC TTC ACT GAG GAC GTC GAT CTC AAT ACA
NOR
I
G
Y
F
TED
VOL
N
T
TAT ATG TAT TAC CTG CAC ATG AGC TAT CCA TTC TGG ATG ACT GAT
Y
M
Y
Y
L
H
M
S
Y
P
F
W
M
T
0
GAT ATT TAT AAC TTG MC AAG GAG eGA CGT GGT GAA ATC TTG TCT
o
Y
N
L
N
K
ERR
G
E
L
TGC GCT AAT ACG CAG CTG TTA GCT AGG TAT AGG CTG GAA CGC CTT
T
CAN
Q
L
L
A
R
Y
R
L
E
R
L
15
90
30
135
45
180
60
225
75
270
90
315
105
360
120
405
135
450
150
495
165
540
180
585
195
630
210
675
225
720
240
765
255
810
270
855
285
ACT CAT GAA ATG TGe GAC ATC AAG ACC ATT ATG TGG CAT GAG CCT
900
K
300
THE
M
C
0
T
M
W
H
E
P
TTG AGG ACC GGT TAT TGG CCC AAA ATe ATT CTT CAC AAT GGA GAA
L
R
T
G
Y
W
P
L
K
H
N
G
E
CAC ATG CCT GTG CGC AGC AAC AAT ATG GTG GTG CTT ACC GAC ATG
H
M
P
V
R
S
N
N
M
V
V
L
TOM
V
K
L
K
R
Q
L
0
0
V
E
R
M
315
990
330
0
M
G
T
G
K
ERR
0
G
T
360
GTA ATC AGT CTA AGA AAA CCT GAA GAT GTT GAA AAC CTG GCT AGA 1125
V
I
S
L
R
K
P
E
0
V
E
N
L
A
R
375
CTG CTA CTT GGT GGT ATG CAG TTA GTT AAT GAT GAT GCT AAG ACT 1170
L
L
L
G
G
M
Q
L
V
NOD
A
K
T
390
ATC CAC ATA ATG CAC CTG ATG AGG AAG ATG CTA ACT TAC AAT ACA 1215
M
H
H
L
M
R
K
M
L
T
Y
N
T
405
TAT AAC ACT GAC AAG TAT ACC TAC GTA CCT ACT GCT CTG GAT ATG 1260
Y
N
T
0
K
Y
T
Y-
V
PTA
L
0
M
420
TAT ACC ACT TGT CTG CGT GAT CCT GTT TTC TGG CAG CTG ATA AAA. 1305
Y
T
T
C
L
R
0
P
V
F
W
Q
K
L
435
CGC GTC ACA AAC ACC GTT CAA ACT TTC AAG AAT ATG CTT CCT AAG 1350
R
v
TNT
V
Q
T
F
K
N
M
L
P
K
450
TAT ACT CGC GAT GAA eTC GAC TTC CCT GGT GTC AAG ATC GAC AAG 1395
~
T
ROE
L
0
F
P
G
V
o
K
K
465
ATC TCT ACC GAC AAA CTC GTC ACT TTT ATG GAT GAA TAT GAC ATG 1440
s
T
0
K
L
V
T
F
MOE
YOM
480
GAC ATC ACC AAT GCT GTA TAC eTC GAT GAG ACT GAG ATA AAA AAG 1485
o
T
N
A
V
Y
L
0
E
T
E
K
K
495
AAG CGC TCC GAT CTG ACA TTC GTG GCC CGC ACT CGA CGT CTG AAe 1530
K
R
SOL
T
F
V
ART
R
R
L
N
510
CAT CAT cce TTC AAG GTG GCT ATC GAT GTT ACA TCT GAC AAA. TCA 1575
H
H
P
F
K
V
A
I
0
V
T
SDK
S
525
GTT GAC GCT GTT GTC CGT ATT TTT ATC GGT CCT AAG TAC GAC TGT 1620
V
0
A
V
V
R
F
G
P
KYO
T
R
R
LON
TEE
S
G
600
T
T
F
K
N
V
0
lEW
W
Y
K
615
T
CGC ATC GGA TTC CCA CAC AGG CTT CTC CTG CCC CTA GGT CGT AAG 1890
RIG
F
P
H
R
L
L
L
P
L
G
R
K
630
GGA GGT TTG CCT ATG CAG ATG TTC GCC ATC GTC ACC CCA ATA AAG 1935
G
G
L
P
M
Q
MFA
I
V
T
P
I
K
645
ACC GGC GCG ATC CTA CCG AAC ATT GAC GTG AGC ATA ATG AAG GAA 1980
T
G
A
I
LPN
I
0
V
S
I
M
K
E
660
CGT AAA ATG TGT CGC TTC AGC GTG TGC TTC GAC ACA ATG CCG CTC 2025
R
K
M
C
R
F
S
V
C
F
0
T
M
P
L
675
GGC TTT CCC TTC GAC AGA AGA ATA GAT ACT TCG GAA TTC TTT ACT 2070
G
F
P
FOR
RID
T
S
E
F
F
T
690
AAG AAC ATG AAA TTC TAT GAC ATT GCG ATT TAC AGG ATT GAT ATG 2115
K
N
M
K
F
Y
0
I
A
I
Y
ROM
705
GAC ACG GCC AAC ATT AGC AAG GAC ATC GAC ATG TCG GAC ATG GTG 2160
o
T
A
Jj _
L _li..
K
0 .
10M
S
0
M
v
720
ATG AAG GAG GAC GAC CTT ACG TAC CTG CAC CAG GAT AAG CTG GTG 2205
M
K
Q
DOL
T
Y
L
H
Q
0
K
L
v 735
AAA GAT GTG ATG ATG TCA AGC GCA GAC AAC ATT 2250
AGA TGG TCG TAC
R
W
Y
K
0
V
M
M
S
SAD
N
750
ATG AGG ATG TAA CTATAAATGTATTAAGATTATCTGACAATTAATT~TAG 2305
M
R
M
754
2337
CATCTACAlt,lo.AAA:a.AAa.JU,AAA.a.aA.a.aAa.AA.all,a~
Fig. 2. cDNA and protein sequence of Hyphantria cunea SP-I.
The sequence is numbered relative to the transcription start site
and amino acid residues are denoted by the standard single letters
underneath the nucleotide sequence. Underlined amino acids
(a. a. 16-35) were confIrmed by N-terminal amino acid sequence
analysis of SP-I. The vertical arrow represents the signal peptide
cleavage site. An asterisk marks the translation stop codon and
the overlined AATAAA shows the polyadenylation signa\. The
dotted line indicates the potential N-glycosylation site.
Table 1. Amino acid composition of SP-I from H. cunea.
Residue
Number
Mature protein
Ala
Arg
AsniAsp
Cys
GlnlGlu
Gly
His
25
53
104
9
47
29
16
62
60
52
44
31
25
30
55
II
33
52
738
86809.16
3.98
7.17
13.80
a
Experimental b
345
CGT GAC GGC ATC ATG ACC GGC AAG ATA GAA CGT CGT GAT GGA ACT 1080
R
W
945
AAT GTT AAG CTT AAG CGT CAG TTG GAT GAC GTT GAG AGA ATG ATC 1035
N
P
ACT ACA TTT AAG AAC GTA GAT ATC GAA AGe TGG TGG TAC AAG ACT 1845
C
540
LIe
Leu
Lys
Met
Phe
Pro
Ser
Thr
Trp
Tyr
Val
Total
Mr
2.22
8.76
13 .85
1.19
1.19
6.23
3.85
2.12
8.23
8.36
6.90
5.97
4.11
3.32
4 .11
7.30
1.46
4.38
7.43
7.82
2.46
3.64
7.91
8.56
8.38
4.57
5.31
2.88
3.29
6.17
6.88
6.11
ATG GGC CTT CTT GTA TCA GTC AAT GAC AAA CGC CTe GAC ATG GTA 1665
M
G
L
L
V
S
V
N
0
K
R
L
0
M
V
555
GAG ATT GAT TCC TTC AGT TAC AAG CTG GAT ACT GGC AAG AAT TCT 1710
E
IDS
F
S
Y
K
LOT
G
K
N
S
570
ATC GTG CGT AAC TCT CAG GAA ATG CAT GGT ATC ATT GAG CAG AGG 1755
V
R
N
Q
E
M
H
G
E
Q
R
585
a Based
on the deduced amino acid sequence minus the signal
peptide.
b From purifIed SP-I .
Cheon Hyang Mi et ai.
HCSPI
BlHSPI
IlMSI'I
HR-VLN\.vAA lAlASASVVK DOI"iSS'IVlG RESKVNVDVK "ntELSIU:lL
/'IR- VLVLVAS LGL-RGSVVK OOl'--'1WIG KIJ>lMInMDIK Km.CIUaL
MR-VLVILAC I..AMSAS.\IS QT-YGn1VFT KEPKVNUJ« KKFl.CIMKlL
MRAVlLEVVS u.Al.RM---- ----ARP£ro
HKSVLIU\GL VAWtLSSAVP XPS - --TtXS
HK'TVVI£ML w.iAlSSAVP PPKYQHKYKT
~ILAGL ~ V- --1QtSFKV
OTn.VDoIDIK
!CNIIDo\VFYDt
SPVI».IfVEX
I<DVtIAAfVER
""""
NKIl.QPlM'iD
D~
I~
NHllOPlM'iD DIJU.v.\RElo/V
[J(ll.QP'IY.FE DIKEIAKEYN
IEEN1llKYU{
'TDIVNOFIm' fJOCMLl'RGE
'lUJVlOO"IDr f'KIoD«.PRGE
~
VLWKOFMEM 'LlG(;MLPRGE
"'~P2
NHVVEPIJm{ ILEEI..GIOO'l(
nDm:lFllt 'n7ILI'J)f'DCM RK\IGFLPI;I:GE
'''''''
MSARlI
Q[7.JSQUmX) E't'fKlGJa:nD ~ IO\AIJI:£FLKH YRl'GFMPKNL
()I7Vt:Q'.'NPtI E'f'tKIGKE'iN ~SN KKAVEEfLOL ~r
HCSPI
BJlISPI
8MSPI
M ISP2
BMSP2
MSAAA
MSAIW
VFVHSNNLKI ~VXVF1UL YPAKIFI7ffl
VF'VH'INEU\L FJJj\VlM"KIM 'tSMJ:l'tM'l
'I'FVIf'INEI..O fD-VKVFRVL ~
ll"'lUf'JmIOL nvvIM!"HHL Y'OoXIFITFV
Ef'SVFYtICMR IFAlALUXP YY.UIFEl'F'f
EFSIf'YDtMR £EUALF!U' ~
EFSPFYII'tUt IEAIGVFHIF Y'O.KIEf1f'fY
"""'"
' MSI'>
MSARA
MSARB
sntsPI
"'''''
MSARA
~ EYYKIGJaM)
QROLVIUaL
50
(!KK-- ILSFF
QKX--VPSlE
QKK- - VUll.F
100
VF...I.NDN'tSN KJ<VVEDfl...LL YRTGF'MPI<GF
R'l'CCWLRERI ~T
Rl'ACWLREIU NGGHfVfALT
~ ~
K'TA(.'WoI!U.'t'L NIG1fVYALT
KSACPARVHL ~FL,{AFY
KT~ NEQiFL'OWY
223
MSARA
MSARB
56.3 %
BMSP2
HCSPl
BJHSPl
BMSPl
BJHSP2
14.9%
66.3 %
28.5 %
KSAAWMVYL NIDQFLYAVY
GIILPAP'I'EI YPYFfVDSNl l~
Cl'It.PAP'tEI YPYVFVDSHl INM.fIMOrI'
GLYLPAPYEl \'P'lFfVDSHV I SKAf1+OOfJ'
GIILPPPrEI YPYVFVRAIN IQKArt.ua«
IAV'IQRPDCH GfWPAP'tEV ~ t.QJCn'VI1(HQ
UVIQRHD1N GLVLPAP'fEV ~ LF1M:IUKIf;)
MVFHRNOCR
IoC'VFHRItX:R
.v.cFHR'ltXlC.
VO\.VRHRE£lCK
IAVl~ ~~!'?"!'ANlNJ' ~
RM'l'OP'JIM)
KMRDPVHlD
KAAXDPVLWK
KGLU:UCl.a)
200
1G..mPF.AM
L'Cf'UOO:LM,
Fig. 4. Dendogram of sequence relationships of storage proteins
from various Lepidoptera. Percentages refer to identity. The
dendogram is based on the alignment shown in Fig. 3.
r:s:NIISM1J\A
~ ~ RRT-L~ I~ NI'YMYYUIKS
YYClJCVIU(N LWIDoIRl(GV RRT- L'l'nDt IS'tF'IEDIlX.o
YYGI'lVI.tQIl L~ RRS-I.StNCN MS'fFHEDIlL
FYGIlOC'l'tfCD VPI:nEN¥D ~ LRYFImIa.
~I-KKaW YPV"t1OOffSN AVL~ LT'iF'IEDlQi
YYQi-YiIElm N'fIIF'{}N{SN ~ IA'lFYEDIGL
m'YMYYUDtS
tlI'YK'fYLKIoti
N'IYYFYFHVD
w.rtYYFHSH
NS'tYYYFHMH
~I-VKE!<N Y'N'f'(AN'lSN SL~ ~IGL ~
MSARB
YPl"'rMlmIY NJ.NKElUlGBl t...SCAm"QLlA RYIUBUll'1iE I«::DIKTIK-.'H
~ 'I\'NKERRG£I KO-'IYn;;U.A P.lJUBU.SHE IC)IKSDW<
~ GDiKEJUIGEI ~ RKRLER1.SHK ~
~ InOOIRRFEL TYlMYOOIlA R'llUJU.SN:> ~
t.f>PtMJ'SEK'/ ~ YFYFY(.lQU.A RYYFERlJINJ LGKIPD'l>Wi
I.PfWtHSEXY GPf'KElUCEI YYYFYQQ[.IA RYYt.ER.LIlN:J LGEI~
t..PfW,fiSERY GIUJ<SRRGEI YYYP"iOQl.l9. RYYFJ::R.I..SN: LGDI PfFSWY
'ICSI"
EPLR'iGYWPK l~ \IRSNt>...~T ~L toJERKlRIX>
EPLK'IGYWPK IlU.Hl'GDEHP Vl'ISNNKIIVT k1NVY.VJ<RHL tDIERKLROO
HCSP'
1lIHSP'
''''''''
"'"'"
........
BMSP2
"''''''
""'"
"""'"
BMSP2
........
...
.. .
. ., ...
~lJoISS'tYYPFA~~~
prrGKlDUID G'iVI.SLIU<PE ~ Ga<lL~ KTnt - - - -n-.
I LTG!ttDlRO GTIINLKJ(AE WDiLAALLL GG«iL~ Ki'HH - - --i+I
''''''''
'MSI'>
MSARA
""""
HCSPI
BJl"'"
''''''''
"'15P2
~
ILTGKIUUU) G'IVIsuotSE Dll'NLARLVL GGLE~ KVrH---- LT
llXGPIEl - N
Q'lUD.'J'Kl1)
DreIUiKLIF
' GIUI»(V'(LD(
'n.NDSYRYLL
======,
LQJ<J:I{F'FAFC -QI(ID'llDPK AlNfVGN'iWl ao.DLYGEEV nmYQRSY£\I 1
HtMKRLLS':'N
1.I'{NFDC'(T'{V P'l'AULYS'TC LROl"If'WRLH KRV'ID1'PFLF
Nl.HKXI".I.SYG~P'l"SUMY'ITCLRD~I<:RVOttF"JVF
~ 'I'FliSIE\'FW PSIlLQYQJ''' LRDPVf"YKI.O XlUDLVHLF
- f'ARRVl.GAA ~ PSAHtI'YQTS LRDPAFYQLY NRIVEYrvEF'
- NAJUM.GAA l'!CP'mKYSFl PSAlLFtQTS LRDPVFYQLY IlUINYINEF
'!eSP'
JQflL.PKY'mD ELDFF'GVXUl
IO\KLPKY'I'RE I:f"Ilf'PCVKIE
KMiLPKYTRE: OfSFPCVK\IE.
KUU.PS'I'ntE DLYFFCVKID
KQYUIPYTOD KLYFtXMaT
lCQ't1.QP'tlO< r:utFVGVKIS
""'"
~P2
........
~
MSARB
HCSP'
"''''''
""'"
"""'"
........
BMSP2
MSARB
BlIISP '
""'"
BJHSP2
'MSARA
MSI'>
MSARB
,<=',
"""'"
OMSPI
"""'"
'MSARA
MSI'>
MSARIl
I!eSP!
MtSPI
IlMSP!
"'' 1MSI'
SP2>
MSARA
""""
,<="
antS!'1
BMSP'
~P2
OMSI'>
MSARA
MSARIl
HeSP!
Dn tSP!
SMSPI
Bn tSPl
BMSP1
MSAAA
MSAAD
actin . .
HI.JoIR!(MLT'iN TIN'It:IC'iTI'V PI'Al.LM'i'M'C LRDI"If'W\)LI KRIrJN'NQl'F'
MSARA
MSARB
"''''''
SP1 . .
transcript
EPtEI'G'iWPI't I:RLPSGtEMP ~T ~ 1:I:JIEHtIREX;
KTlKXGYWiW ~IP VRFtNiVIVR I:ttNRIWIRLC [E'fERlIJU»,.
SPIJcr'G'iYP- I.Mr:n(F'l'Pf? QRP(m'NUfT' EENYlJMIFt, D1YEK'l'!'VQf'
SPVKTGYYP- HLYGS'fYPFA QfU'N'iYDIJGII OKNYD;)IRFL Qo!FDfI'Ft.Q'f
MSARlI
~P2
A
)00
.
I«:SP!
BJlISP'
W...J
...J W :IE ...J a.. a..O N "'IitCD CO ~
CD ,.... ,.... ,.... a.. a..a.. a.. a..a.. a.. a..
<50
-~~~~Y~
"VYLCETE.IK
XISIDa..Vl'F MD£VIHDI 'lN
XFTltla.TTF' IIEYIMDI 'lN ~
JaTroELVl'F VIlE\'tHOISN ~TEH2
Nl/llVTJ:L1/T'f FOO'I'll1DfIN "VYL~IK
lMI:V[I(LTTF'
~ ~n;:
soo
8
Fb Gt Ov Te
J:lIJKVtI(LA'n' f"EYYlFWSN SVFVSKKDIK
~~SSE ~ ~vr; ~
SVFWSXEEVK
!OOtStL~
R't"RRU<HHPF
~
KXRSnfIMIIA
~
XVIVDV'rSa'; 'IVDCVVR.IFI CPK'iIlCLGRL
S'JI».WRIFI C PKYIX::K>U..
~ ~ QVSIlJIJHSIE ~WRIFL CPKYIX:K>lIL
Jm<SDo!VFMII ~PF XVlU)II,.SII( SVDCWRVFL GPKJa:M..NRL
!>HIVH-Eta: -A'nU.NHSPP NVNlE.VDSNV IoSDlWVIQoIl,L APKYtlNJIP
N-F'PY-GYKV RQf'R1m!Y.PP SVSIGVJ(S[JJ IoVI».VFXIFL CPKYDSN:;FI>
SS'tPH-[pJQ RQ~ ~m~ IoVOl\.~flt ~
~ VEIDSf'S¥KL D'I'G!(NSIVRN SQfl«trrE)'J
MSVNI»CRMIli nMlm'LY1<L ETCKNI'IVRN SLEMII'JVIe;)
H:S\INt:IOlLDi F'ELllSF'MYla. VlCKNI'IVRS SHtHilCFl PE
IDrnRNRlRF VElDI'FLYKL N'lCKm'IVRN SYtMINLVKI)
L~ ~ T1ICQ«IIRN SNEFVIF1<l!l)
t~ ~ KI'GO'tHIVRQ SSDFLFFKED
SLPKSEIYKL
~ ~ ~~ ~IFKOO
SVPKrELYKL
550
RPW'l"lUtIl.D.
IU'WI'RRII.HJ
actin . .
YISmRIIHES
RI'HmDf'MKK
SVPHTEIMKM
SP1 . .
transcript
60 0
Fig. 5. A. Developmental regulation of the accumulation of SPI transcript from fat body revealed by Northern blot analysis. 6L,
late 6th instar larvae; 7E-L, early, middle, and late 7th instar
larvae; PPE, PPL, early and late prepupae; PO-PIO, pupae at days
0-10 of development. B. Patterns of SP-I transcript accumulation
among tissue types. The total RNA from different tissues were
applied. For further explanation see Materials and Methods. Fb,
fat body ; Gt, midgut; Ov, ovary ; Te, testis.
TEEISIG'ITI'X NVDlESWWVX TRIGF'PHJU...L I,.l'LGRKGGLP HQKf'AZVI'PI
HIG'1VGTISK 'iV'WESi*i'tX -RHRLPHRHL LPLGR.RGGHP tQ(FVIVI'PI1
Dt<fi>SGDG-- ~ ~ LPLGTlOOLE IQI'tVIVSPV
VESIT'D--KR IlUUf'J)l.R- N YlnCF'PnU.L t.PKG:fP\IOGMH HHLYVrVl'PL
=~===== =~~~
r:::--'I'G1ULPN lWSDIKERK K:RfSVCFDI' Hl't.GFPPmR IDT'SEPf"J'KN
K--TNLlLPN lDINDIr:::ER.K 'l'CIoGASIISTR CR.SGPPFI:IUC ~
R--'roHLLPT I£IorlHoIXI:R: IoC»ISSCIST KPLGYPPDRP IIlO.SPFTSN
RLVDNDINl lDINRXI:UIR. ~ Kl'LGPPPt:I!.R II:M:2iPF'I'PN
55================
~~~~~
~~. ,
RWSYKA\'I'!K1 .s:KJXMo!RH ••
KR'J"tKDI.I!Ho
ss-- -~
..
-----Il1K\IN PlNNLIIN"
S:lPLRH'lltKI HlPQIUXF .,
yKFN....PFYVP
soo
0tW'E'J--- , .
YXFNIIPSH'JM KSNWPKH . .
Fig. 3. Alignment of the amino acid sequences of insect storage
hexamers. HCSPI , H. cunea storage protein-I , BJHSP2, basic
juvenile hormone suppressible protein I and 2 from T. ni (Jones
et ai. , 1993), BMSPI and BMSP2, storage protein I (female
specific protein, Levenbook and Bauer, 1984) and storage protein
2 from B. mori (Fujii et ai. , 1989), MSARA and MSARB , (X and
p subunits of M. sexta arylphorin (Willott et at. , 1989) .
Conserved amino acid residues are indicated by asterisks.
transcript through the middle pupal stage (Seo et a!. ,
1998). A profile of transcript accumulation generally
mirrored the developmental profiles of SP-1 synthesis in
Hyphantria cunea (Kim et a!. , 1989). The hemolymph
storage protein in Hyphantria cunea begins to appear on
the 4th day of the 7th larval instar and reach their peak on
the 8th day. The hemolymph storage protein begins to
decrease during the prepupal stage and is drastically
reduced immediately after pupation (Kim et a!. , 1989)
Hybridization of the SP-l eDNA insert to total RNA
224
Storage Prote in-l Gene in Hyphantria cunea
from several ti ssues revealed the accumulation of a 2500 nt
transcript in the ovary as well as in testi s, albeit at much
lower levels than in the fat body (Fig. 5B). LHP synthesis
in lepidopterans occurs primarily but not exclusively in
larval fat body cells (Kanost et aI., 1990). In this report, we
present definitive evidence fo r Met-rich storage protein
transcription in both male and female reproductive organs.
Levels of the SP-I transcript were much lower in the
gonads than in the fat body cells. Of particular interest is
the fac t that the expression of storage protein in the ovary
has never been reported in other species. Storage protein
synthesis and secretion has been identified in the fat body
and other organs in Calpodes ethlius. The alternative sites
of synthesis in thi s in sect included the epidermis (Palli and
Locke, I 987a), midgut (Pal\i and Locke, 1987b), and
pericardial cell s (Fife et aI. , 1987). Analogous results were
obtained with M. sexta through the demonstration that
arylphorin genes are transcribed in several larval ti ssues
(Webb and Riddiford, 1988). The two cDNAs coding 76
and 79 kDa polypeptides, which had been earlier shown to
be storage proteins in G. mellonella, are not expressed in
midgut, silk gland, and Malpighi an tubul es (Ray et aI. ,
1987a). Although seve ral ti ss ues are prese nted as
candidates for alternate expression sites of storage protein,
the types of ti ssues showing a positive signal are not
co nsistent between the different spec ies. Th e SP-l
transcript in the ovary and testis might have accessory
roles, compared to the bulk of hemolymphatic SP-l , but it
mi ght constitute an organ-specific storage system that
allows the insect to keep its reproductive activity under
nutritional stress.
Acknowledgments
We are very g rateful to Dr. D . L.
Silhacek (USDA, Gainsville, Florida) for valuable comments on
this wo rk a nd Dr. Jac que s d ' A layer (L a borato ire d e
Microsequencage des Proteines, Institut Pasteur) for the protein
sequence.
Thi s work was supported by a grant from the Researc h
Institute of Natural Science, Gyeo ngsang National University.
References
Corpuz, L. M., Choi , H. , Muthukrishnan, S., and Kramer, K. J.
( 199 1) Sequences of two cDNAs and expression of the genes
encoding methionine- ri ch storage proteins of Manduca sexta.
Insect Biochem. 21, 265- 276.
Delaney, S. J. , Smith, D. E, McClelland, A., Sunkel, e., and
Glover, D. M. (1986) Sequence conservati on around the 5'
e nds of the larval serum protein I genes of Drosophila
melanogaster. 1. Mol. BioI. 189, 1-11
Fe inberg, A. P. and Vo lgelstein , B. (1983) A tec hniqu e for
radiolabe ling D A restriction endonuclease fragments to high
specific activity. Anal. Biochem. 132, 6--13.
Fife, H. U. , Palli , S. R., and Locke, M. ( 1987) A function fo r the
pericardial cell in an insect. Insect Biochem. 17, 829-840.
Fuji i, T. , Sakurai , H., Izumi , S., and Tomino, S. (1989) Structure
of the gene for the arylphorin-type protein SP2 of Bombyx
mori. 1. BioI. Chem. 264, 11 020- 11025.
Izumi , S. , Sakurai, H., Fujii, T., Ikeda, w., and Tomino, S. ( 1988)
Cloni ng of mRNA sequence coding for sex-specific storage
protein of Bombyx mori. Biochim, Biophys. Acta. 949, 181 188.
Jones, G. , Brown, N. , Manczak, M ., Hiremath, S., and Kafatos, E
e. ( 1990) Molec ular cloni ng, regul ation , and co mpl e te
sequ e nce of a he mo cya nin-re la ted , ju ve nil e ho rm o ne suppressible prote in from insect hemol ymph . 1. BioI. Chem.
265, 8596--8602.
Jon es, G ., M anczak, M. , and Horn , M. ( 1993) Hormo na l
regulati on and properti es of a new group of basic hemolymph
prote in s ex pressed during insect metamorphos is. 1. BioI.
Chem. 268, 1284-- 129 1.
Kanost, M . R., Kawooya, J. K. , Ryan, R. D., Van Heusden, M . e.,
and Ziegler, R. (1990) Insect hemolymph proteins. Adv. Insect
Physiol. 22, 299-366.
Kim , H. R., Kang, e. S., and Mayer, R. T. ( 1989) Storage proteins
of the fa ll webworm, Hyphantria cunea Drury. Arch. Insect
Biochem. Physiol. 10, 115-130.
Leclerc, R. E and Miller, S. G. (1990) Identificati o n and
mol ec ul ar a nal ys is of sto rage prote in s from Heliothis
virescens. Arch. Insect Biochem. Physiol. 14, 13 1- 150.
Lepesant, 1. A. , Maschat, E , Kejzlarova-Lepesant, 1., Benes, H.,
and Yani costas, e. ( 1986) Developmental and ecdys teroid
regul ati on of gene ex press io n in the larv a l fat body of
Drosophila melanogaster. Arch. Insect Biochem. Physiol. 7,
133- 141.
Levenbook, L. (1985) Insect storage proteins; in Comprehensive
Insect Physiology, Biochemistry and Pharmacology Kerkut, G .
A. and Gilbert, L. I. (eds.) , Vol. 9, pp. 307- 346, Pergamon
Press, Oxford.
Levenbook, L. and Bauer, A. e. (1984) The fate of the larva l
storage protein ca lliphorin durin g adult development of
Calliphora vicina. Insect Biochem. 14, 77-86.
Locke, M. and Co llin s , J . V. (1968) Protein upt ake into
mu lti vesicular bodies and storage granules in the fat body of
an insect. 1. Cell BioI. 36, 453--483.
Memmel, N. A. , Trewitt, P. M ., SiLhacek, D. L. , and Kumaran, A.
K. ( 1992) Nuc leotide sequence and structure of the ary lphorin
gene from Galleria mellonella. Insect Biochem. Molec. BioI.
22, 333-342.
Memmel, N. A. , Trewitt, P. M. , Grezlak, K., Rajaratn am, V. S. ,
and Kumaran, A. K. ( 1994) Nucleotide sequence, structure
and developmental regulation of LHP82, a juvenil e hormone
suppressible hexamerin gene from the wax moth Galleria
mellonella. Insect Biochem. Molec. BioI. 24, 133-144.
Miller, S. G. and Silhacek, D. L. ( 1982) The sy nthesis and uptake
of haemolymph storage proteins by the fat body of the greater
wax moth, Galleria mellonella (L). Insect Biochem. 12, 292300.
Palli, S. R. and Locke, M . (l987a) The sy nthesis of hemolymph
proteins by the larval midgut of an insect, Calpodes ethlius
(Lepidoptera: Hesperiidae) . Insect Biochem. 17, 561-572.
Palli , S. R. and Locke, M. (l987b) The sy nthesis of hemolymph
proteins by the larva l epidermis of an insect, Calpodes ethlius
(Lepidoptera: Hesperiidae). Insect Biochem. 17,711- 722.
Pearlm an, D . and Halvorson, H. D . ( 1983) A putati ve signal
peptidase recognition site and sequence in eukaryotic and
prokaryotic signal peptides. 1. Mol. BioI. 167,391--409.
Ray, A. , Memmel , N. A., Orcheko wski, R. P., and Kumaran, A.
K. (1987 a) Isolation of two cDN A clones coding for larval
hemolymph proteins of Galleria mellonella. Insect Biochem.
17,603-6 17.
Ray, A. , Memm e l, N. A., a nd Kum ara n, A . K . ( 1987 b )
Develop mental regul ation of the larva l hemolymph protein
genes in Galleria mellonella. Roux's Archs Dev. BioI. 196,
4 14--420.
Cheon Hyang Mi et al.
Sakurai, H., Fujii , T. , Izumi, S. , and Tomino, S. (1988a) Structure
and expression of gene coding for sex-specific storage protein
of Bombyx mori. 1. BioI. Chem. 263, 7876-7880.
Sakurai , H., Fujii, T. , Izumi , S. , and Tomino, S. (1988b) Complete
nucleotide sequence of gene for sex-specific storage protein of
Bombyx mori. Nucleic Acids Res. 16,7717-7718 .
Sambrook, J., Fritsch, E. F. , and Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual , Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY
Sanger, E , Nicklen, S., and Coulson, A. R . (1977) DNA
sequencing with chain-terminating inhibitors. Proc. Natl.
A cad. Sci. USA 74,5463-5467.
Seo, S. J., Kang, Y J., Cheon, H. M. , and Kim , H . R . (1998)
Distribution and accumu lation of storage protein- I in ovary of
Hyphantria cunea. Arch. Insect Biochem. Physiol. 37, 115128.
225
Smith, D. F. , McClellend, A., White, B. N. , Addison, C. F. , and
Glover, D. M . (1981) The molecular cloning of a dispersed set
of developmentally regulated genes which encode the major
larval serum protein of Drosophila melanogaster. Cell 23,
441-449.
Telfer, W. H. and Kunkel , J. G. (1991) The function and evolution
of insect storage hexamers. Annu. Rev. Entomol. 36, 205-228.
Webb , B . A . and Riddiford , L. M. (1988) Regulation of
expression of arylphorin and female-specific protein mRNAs
in the tobacco horn worm, Manduca sexta. Dev. BioI. 130,
671-681.
Willott, E ., Wang, X . Y , and Wells, M. A . (1989) cDNA and gene
sequence of Manduca sexta arylphorin, an aromatic amino
acid -rich larval serum protein: hom o logy to arthropod
hemocyanins. 1. BioI. Chem. 264, 19052- 19059.
Document related concepts
no text concepts found
Similar