Download Length and Sequence Heterozygosity Differentially Affect

Genetics: Published Articles Ahead of Print, published on April 16, 2005 as 10.1534/genetics.104.026278
Jauert & Kirkpatrick, pg. 1
Length and Sequence Heterozygosity Differentially Affect HRAS1
Minisatellite Stability During Meiosis in Yeast
Peter A. Jauert
David T. Kirkpatrick
Department of Genetics, Cell Biology and Development
University of Minnesota
Minneapolis MN 55455
Jauert & Kirkpatrick, pg. 2
Running Head:
Minisatellite Stability Factors
Key Words:
Minisatellite Stability
Meiosis
Recombination
HRAS1
Corresponding author: David T. Kirkpatrick
Department of Genetics, Cell Biology and Development
University of Minnesota
6-160 Jackson Hall
321 Church St SE
Minneapolis MN 55455
Phone: 612 624-9244
Fax: 612-626-6140
Email: dkirkpat @ cbs.umn.edu
Jauert & Kirkpatrick, pg. 3
ABSTRACT
Minisatellites, one of the major classes of repetitive DNA sequences in eukaryotic
genomes, are stable in somatic cells but destabilize during meiosis. We previously established
a yeast model system by inserting the human Ha-ras/HRAS1 minisatellite into the HIS4
promoter, and demonstrated that our system recapitulates all of the phenotypes associated
with the human minisatellite. Here we demonstrate that meiotic minisatellite tract length
changes are half as frequent in diploid cells harboring heterozygous HRAS1 minisatellite
tracts in which the two tracts differ by only two bases, when compared to a strain with
homozygous minisatellite tracts. Further, this decrease in alteration frequency is entirely
dependent on DNA mismatch repair. In contrast, in a diploid strain containing heterozygous
minisatellite tract alleles differing in length by three complete repeats, length alterations are
observed at twice the frequency seen in a strain with homozygous tracts. Alterations consist
of previously undetectable gene conversion events, plus non-parental length alteration events
seen previously in strains with homozygous tracts. A strain containing tracts with both base
and length heterozygosity exhibits the same level of alteration as a strain containing only
length heterozygosity, indicating that base heterozygosity-dependent tract stabilization does
not affect tract length alterations occurring by gene conversion.
BACKGROUND
Minisatellites are tracts of tandemly repeated DNA in which the repeat unit ranges in length
from 10 to 100 nucleotides. In addition, within a given tract, variations on the canonical repeat
sequence can occur. For example, the human HRAS1 minisatellite tract is commonly composed of
tandem iterations of four variants of a 28 bp sequence: 5’-ACACTCGCCCTTCTCTCCAGGGGACGCC-3’.
Jauert & Kirkpatrick, pg. 4
Repeats contain either a C or G at the 7th and/or 15th nucleotide (CAPON et al. 1983) (as indicated
by the underlines). Additionally, in the human population there are four different common alleles
of the minisatellite, designated a1 through a4 (KRONTIRIS et al. 1985), which consist of a particular
combination of the four repeat types in a defined order. Alleles are considered common if they
occur in greater than 7% of the population (KRONTIRIS et al. 1986). The common alleles differ
from one another in the arrangement of the repeat types within each tract and the number of repeats
in the tract.
Unlike microsatellites, which usually alter during the DNA synthesis stage of the mitotic
cell cycle, minisatellites alter during meiosis, undergoing changes in overall length and repeat
composition (JARMAN and WELLS 1989; JEFFREYS et al. 1998). Minisatellite tracts have proven
very useful for genomic mapping. Some minisatellites (MS1 and MS32, for example) exhibit very
high rates of tract length alterations; these types are often utilized for forensic DNA fingerprinting.
Alterations in minisatellite tracts are often polar in nature (ARMOUR et al. 1993; JEFFREYS et al.
1994), occurring at one side of the tract preferentially. This polarity, and the meiotic timing of the
alterations, has led to the hypothesis that alterations in minisatellite sequences result from a
recombination event at the locus rather than during replication.
Identification of the meiotic factors underlying minisatellite stability has been complicated
by the high level of variability exhibited by minisatellite sequences in the human population. We
developed the yeast HIS4-HRAS1 model system to overcome these difficulties (JAUERT et al.
2002). We replaced the S. cerevisiae HIS4 promoter region with the a1 common allele of the
HRAS1 minisatellite from humans, and demonstrated that this model system recapitulated in yeast
all of the phenotypes associated with the HRAS1 minisatellite in mammalian systems. In yeast the
HRAS1 minisatellite tract stimulated transcription of the HIS4 locus. The tract length altered at
Jauert & Kirkpatrick, pg. 5
very high frequency during meiosis, but not during mitotic growth. The minisatellite also
stimulated meiotic recombination at the HIS4 locus, a stimulation that was dependent on the
meiotic double-strand break endonuclease Spo11p. Finally, we demonstrated that a meiotic DNA
large loop repair activity requiring the RAD1 endonuclease (KEARNEY et al. 2001; KIRKPATRICK
and PETES 1997) acts specifically to generate expansions in the HRAS1 minisatellite tract in yeast
(JAUERT et al. 2002).
These data were incorporated into the following model for HRAS1 minisatellite tract length
alteration during meiosis, based on the double-strand break repair model for meiotic recombination
(SZOSTAK et al. 1983). Meiotic recombination initiates by double-strand breaks (DSBs) adjacent to
the repetitive tract (JAUERT et al. 2002) (Figure 1a); other minisatellite tracts in yeast also generate
DSBs (DEBRAUWERE et al. 1999). Following processing (Figure 1b), a single-stranded DNA tail
invades the homolog, forming heteroduplex DNA (Figure 1c, d). The presence of repetitive DNA
in the heteroduplex allows possible misalignment of the repeats. If misalignment occurs, singlestranded loops of an integral number of repeat units will be extruded, as shown in Figure 1d. These
loops are substrates for meiotic DNA loop repair activities, one of which requires the RAD1 protein
(KEARNEY et al. 2001; KIRKPATRICK and PETES 1997). Depending on whether the loop is extruded
from the template or invading strand, subsequent DNA repair will lead to expansion or contraction
of the tract.
In this report, we examine structural factors that contribute to the stability of the HRAS1
minisatellite during meiosis in yeast. We demonstrate that tracts alter during meiosis in units of 28
bases (the repeat length), and that length alteration is dependent on Spo11p. Further, we find that
the primary sequence of the tract has a profound influence on stability when a diploid cell is
heterozygous for minisatellite tract alleles. A strain that is heterozygous for tracts that differ by
Jauert & Kirkpatrick, pg. 6
only two bases is twice as stable as a homozygous diploid. In contrast, a strain that is heterozygous
for differing tract lengths exhibits an elevated level of detectable alterations relative to
homozygous diploid strains. Most alterations are gene conversion events in which one parental
tract length allele is converted to the other parental allele’s tract length. Such tract conversion
events would be undetectable in strains with homozygous tract length alleles. In addition, tract
length alterations to a non-parental length are also observed. Thus, length and sequence
heterozygosity have diametrically opposed influences on HRAS1 minisatellite tract stability during
meiosis.
MATERIALS & METHODS
Strain Construction: All strains are derived from the haploid strains AS13 (MATa leu2 ura3
ade6 rme1) or AS4 (MATα trp1 arg4 tyr7 ade6 ura3 spt22). All strains are isogenic except for
alterations introduced by transformation. The HRAS1 minisatellite-containing strains are derived
from DTK314 (JAUERT et al. 2002) containing the 30 repeat his4-A1 allele of the minisatellite tract.
The his4-H10, his4-h10m, and his4-H7 alleles were cloned from meiotic spore colonies of
DTK314 that contained shortened tracts. PCR primers (Cloning F and R) that anneal to the HIS4
DNA flanking the minisatellite tract were used to amplify the minisatellite tracts. These PCR
products were transformed into PD57 (AS13 his4-∆52) or PD63 (AS4 his4-∆52), selecting for a
His+ phenotype. The his4-lopc allele was then introduced into the AS13-derived strains (JAUERT et
al. 2002). To construct the his4-7m allele (the 7-repeat minisatellite tract containing the two base
alterations), an oligo, his4-7m, was designed that contained HIS4 promoter sequence and the first
two repeats of the minisatellite tract, but with a C to T change in the 4th position of the 1st repeat,
and an A to G change in the 1st position of the 2nd repeat. The his4-7m oligo and the Cloning R
oligo were used to simultaneously amplify the his4-H7 allele and alter the bases in repeats 1 and 2.
Jauert & Kirkpatrick, pg. 7
This PCR product was transformed into PD63, selecting for a His+ phenotype. Correct integration
and the primary sequence of the minisatellite tract were determined by sequencing. RAD1
deletions were introduced by transforming strains with BamHI-digested pDG18 (KIRKPATRICK and
PETES 1997). PMS1 deletions were constructed by transformation of a PCR product with 5’ and 3’
homology to the PMS1 locus and internal sequence of the KANMX4 cassette encoding geneticin
resistance (WACH et al. 1994).
Strains generated: AS13-derived: DTK608 (PD57 his4-lopc his4-H10), DTK669 (DTK608
∆rad1), DTK756 (DTK608 ∆pms1), DTK810 (PD57 his4-lopc his4-H10m), DTK658 (DTK608
∆pms1), DTK794 (PD57 his4-lopc his4-H7); AS4-derived: DTK750 (PD63 his4-H10), DTK796
(DTK750 ∆rad1), DTK757 (DTK750 ∆pms1), DTK607 (PD63 his4-H10m), DTK635 (DTK607
∆rad1), DTK666 (DTK607 ∆pms1), DTK774 (PD63 his4-H7), DTK798 (DTK774 ∆rad1),
DTK818 (PD63 his4-H7m); Diploids: DTK751 (DTK608 x DTK750), DTK802 (DTK669 x
DTK796), DTK758 (DTK756 x DTK757), DTK811 (DTK810 x DTK607), DTK611 (DTK608 x
DTK607), DTK764 (DTK669 x DTK635), DTK763 (DTK658 x DTK666), DTK795 (DTK794 x
DTK774), DTK777 (DTK608 x DTK774), DTK820 (DTK608 x DTK818), DTK825 (DTK669 x
DTK798)
Meiotic protocols and tract length analysis: Strains were sporulated at 18 degrees C and
dissected using protocols described in Jauert et. al (JAUERT et al. 2002). Four-spored tetrads were
scored for segregation of the his4-lopc allele on His- medium, and then whole-cell PCR was
conducted (JAUERT et al. 2002) to determine the tract length in each spore colony using tract length
diagnostic primers. Two independent diploids of each strain were examined and the data from
Jauert & Kirkpatrick, pg. 8
each were summed once statistical analysis demonstrated that the two data sets were not
statistically different. At least 200 complete tetrads were evaluated for recombination at HIS4 and
100 tetrads (400 spore colonies) were examined for tract length alterations. Tract allele length
PCR products were purified using a High Pure PCR Product Purification Kit (Roche Diagnostics)
and then sequenced by the Advanced Genetic Analysis Center at the University of Minnesota,
using the same primers as were used for tract length analysis.
Statistical analysis: Comparisons were done with Instat 1.12 (GraphPad) for Macintosh, using
either a chi-square or Fisher’s exact variant test. Results were considered statistically significant if
p was 0.05 or less. For some analyses on data sets with a small sample size, groups were combined
as appropriate (e.g. altered length versus parental length).
PCR oligonucleotides:
Cloning: F: 5’ CAGTTGGAACAGGCTCAAGCAC and R: 5’CTATTACACAGCGCAGTTGTGCTATG
Tract Length Diagnosis: F 5’ CCTCTGGGACGGGGACTTG and R 5’ GGGGAAGCTGGTCACTCGG
PMS1 knockouts:
5’GAACGCGAAAAGAAAAGACGCGTCTCTCTTAATAATCATTATGCGATAAACGTACGCTGCAGGTCGAC
5’CTCCCTGTATATAATGTATTTGTTAATTATATAATGAATGAATATCAAAGATCGATGAATTCGAGCTCG
his4-7m oligo (lower case are altered bases in repeats 1 and 2):
5’AGGCCATGCCGCTGGCTGGCCAGGGCTGCAGGGACACTCCCCCTTCTGTCCAGGGGACGCCACAtTCGCCCTTCTCT
CCAGGGGACGCCgCACTCCCCCT
Jauert & Kirkpatrick, pg. 9
RESULTS
Base heterozygosity: To examine the effect of sequence heterogeneity on the stability of the
HRAS1 minisatellite tract, we constructed two diploid control strains, each homozygous for one of
two HRAS1 minisatellite alleles. DTK751 is homozygous for the his4-H10 allele which contains
10 copies of the 28 bp repeat sequence, while DTK811 bears the his4-H10m allele, which is
identical to his4-H10 except for a C to T change in the 4th position of the 3rd repeat (3.4
heterozygosity), and an A to G change in the 1st position of the 4th repeat (4.1 heterozygosity)
(Figure 2). The minisatellites in DTK751 (10/10) and DTK811 (10m/10m) exhibit the same level
of meiotic instability. In DTK751, 28% of the tetrads contained at least one spore with an altered
tract, while 31% of the tetrads from DTK811 had alterations. The distribution of classes was also
equivalent (Table 1). Therefore, in DTK811 the presence of the two sequence differences in
repeats 3 and 4 of the HRAS1 minisatellite does not affect the stability of the minisatellite during
meiosis when these differences are homozygous.
We constructed a diploid strain that was heterozygous for the base alterations (DTK611),
and found that there was a significant 50% reduction in the meiotic instability of the minisatellite
tract compared to the two control homozygous strains. Only 15% of the tetrads exhibited meiotic
tract length alterations (p = 0.004 compared to DTK751). The distribution of classes was
unaltered, but the percentage of tetrads in each class was reduced by approximately half (Table 1),
indicating that the reduction in instability was not limited to a particular type of rearrangement.
The four minisatellite tracts in 22 tetrads of DTK611 (10/10m) were sequenced, including 8
tetrads that had no observable length alterations, 10 with a single tract length deletion, and 4 with a
single tract length insertion. The segregation of the two heterozygous base pair alterations (in
repeat 3 at position 4 (3.4 heterozygosity) and in repeat 4 at position 1 (4.1 heterozygosity)) was
Jauert & Kirkpatrick, pg. 10
determined for each of these tetrads. Of the 19 that could be scored, 13 (68%) exhibited aberrant
segregation of the 3.4 and 4.1 heterozygosities. In 12 of the 13 aberrant segregations, the
alterations occurred in the same direction at both the 3.4 and 4.1 position, a 25 bp separation,
indicating co-conversion of the two mismatches. Of these 12 tetrads, 6 converted the wild type
sequence to the mutant sequence, and 6 converted in the opposite direction, indicating no bias in
directionality. Finally, 7 of the 8 tetrads that had no observable length alterations exhibited gene
conversion of the 3.4 and 4.1 heterozygosities; no directional bias was observed. In conclusion, the
base heterozygosities undergo a high level of gene conversion, but this high level of recombination
is not reflected in the frequency of alteration of the minisatellite tract.
When we deleted the DNA mismatch repair gene PMS1 (WILLIAMSON et al. 1985) in
DTK611 (10/10m), generating DTK763, the level of meiotic instability significantly increased (p <
0.0001), becoming equivalent to that in DTK758, the pms1 derivative of DTK751 (10/10) (Table
1). This result indicates that the increased stability conferred by the sequence heterozygosity is
dependent on DNA mismatch repair. Deletion of RAD1, required for meiotic DNA loop repair and
HRAS1 minisatellite stability (JAUERT et al. 2002), resulted in a small increase in tract instability,
from 15% to 21%. This increase was not statistically significant (p = 0.2; altered versus unaltered
in DTK611 and DTK764) (Table 1). However, given the small number of events observed, we
cannot determine conclusively if loop repair influences overall stability when tracts contain
sequence differences. The level of meiotic tract alteration was not significantly affected by pms1
or rad1 mutations in derivatives of DTK751 (p = 0.35 altered versus unaltered with DTK802
(∆rad1 10/10) and p = 0.18 with DTK758 (∆pms1 10/10)).
The frequency of recombination at the HIS4 locus can be determined by monitoring the
aberrant segregation frequency of the heterozygous his4-lopc insertion allele in the coding
Jauert & Kirkpatrick, pg. 11
sequence of HIS4. DTK751 (10/10) had an aberrant segregation frequency of 52% (Table 2). The
presence of the 3.4 and 4.1 heterozygosities did not significantly affect aberrant segregation of
his4-lopc in DTK611 (10/10m) relative DTK751 (48%, p = 0.3). DTK811 (10m/10m) exhibited a
significantly higher frequency of aberrant segregation (63%) than either DTK751 or DTK611.
Length heterozygosity: To examine the effect of length heterozygosity on minisatellite stability
during meiosis, we constructed a diploid strain containing two alleles of the minisatellite that
differed in the number of repeats in the tract. The his4-H10 allele contains 10 repeats, while the
his4-H7 repeat is identical in sequence but lacks the first three repeats present in his4-H10 (Figure
2). When homozygous, his4-H7 was altered in 25% of the tetrads during meiosis (DTK795, Table
1). This level of instability is slightly lower than seen with his4-H10 (28% in DTK751) but is not
significantly different. The diploid strain DTK777 is heterozygous for his4-H10 and his4-H7. If
the model presented in Figure 1 is correct, when heteroduplex DNA includes the minisatellite
tracts, the 10 repeat tract will extrude three repeats as a single-stranded loop. Consistent with the
model, we find that diploid cells containing both his4-H7 and his4-H10 have a very high level of
observable meiotic tract length alteration - 63% (DTK777 - Table 3). This increase in alteration is
highly significant (p < 0.0001). Both gene conversion events (in which a seven repeat tract was
converted to a ten repeat tract or vice versa) and non-parental alterations were detected (Figure 3).
The majority (73%) of the length alterations in DTK777 are gene conversion events; the
altered tract has a new length that is equivalent to the length of the other allele (Table 3). This
‘tract conversion’ occurs in both directions (a seven repeat tract increasing in length to a ten repeat
tract and vice versa). In 118 DTK777 tetrads examined, 27.1% were gain-of-length tract
conversions, and 19.2% were loss-of-length tract conversions, while 15.9% involved alterations to
Jauert & Kirkpatrick, pg. 12
a non-parental length or both gene conversions and non-parental length alterations (Table 3). In
conversion events, gain-of-length alterations were more prevalent than loss-of-length events, but in
non-parental alterations, loss-of-length events were more common.
We deleted RAD1 in DTK777 to determine the effect of the loss of loop repair on tract
length alteration when the strain contains heterozygous length alleles of the HRAS1 minisatellite.
RAD1 has previously been shown to be involved in meiotic HRAS1 minisatellite tract expansions
(JAUERT et al. 2002). If RAD1 is involved in tract length gene conversion events in a similar
manner, loss of RAD1 should lead to a loss in gain-of-length tract conversions relative to the wildtype parental strain. In DTK825 (DTK777 ∆rad1) the minisatellite tract was altered in 67% of 116
tetrads examined by PCR analysis (Table 3). Gain-of-length tract conversions occurred in 20.9%
of the tetrads, while loss-of-length conversions occurred in 27.5%. This bias is the reverse of that
seen in DTK777 (27.1% versus 19.2%). Non-parental length alterations were also slightly biased
towards loss events in DTK825. While this trend is consistent with RAD1 involvement in tract
expansion, approximately twice as many tetrads would need to be evaluated for the difference to be
statistically significant, and so no conclusion can be drawn at this time. Aberrant segregation of
the heterozygous his4-lopc allele also increased in DTK825 relative to DTK777 (p = 0.05); other
∆rad1 strains exhibited an elevation of his4-lopc aberrant segregation, but the increase was not
statistically significant in those strains (Table 2).
Base versus length heterozygosity: To determine if the increase in stability due to base
heterozygosity can influence the high level of tract conversion seen with length heterozygosity, we
constructed a strain, DTK820, containing both base and length heterozygosities. In order to
accomplish this, we constructed a version of his4-H7 that contains two point mutations (a C to T
Jauert & Kirkpatrick, pg. 13
change in the 4th position of the 1st repeat, and an A to G change in the 1st position of the 2nd repeat),
and then mated this his4-H7m strain with the his4-H10 strain. If we had used a diploid his410m/his4-H7 strain, the point mutations might have been contained in loops during heteroduplex
formation, and would therefore not have been present as base mismatches. In DTK820, the point
mutations in the 7-repeat tract will be incorporated into heteroduplexed DNA, rather than loops,
during meiotic recombination, leading to separate base mismatches and loop formation. The point
mutations in his4-7m are the same alterations as in his4-10m.
DTK820 (his4-7m/his4-H10) has a very high frequency of tetrads exhibiting tract
alterations (70% - Table 3). DTK777, which is heterozygous for length alleles but lacks the base
heterozygosities (his4-7/his4-H10), actually has a slightly lower level of tract alteration (63%),
indicating that the presence of the point mutations in the his4-7m allele in DTK820 does not
decrease the high level of tract conversion observed when the tracts are heterozygous in length.
Thus, tract conversion appears to be dominant over base mismatch-dependent stabilization. In 112
DTK820 tetrads examined, 23.3% were gain-of-length gene conversions, while 23.1% were lossof-length gene conversions, with the remaining 23.4% involving alterations to a non-parental
length or a mixture of non-parental length and gene conversion events. Among the gene
conversion events, no bias in direction of alteration was seen, while in non-parental alterations
loss-of-length events were more frequent than gain-of-length events (Table 3).
Mechanism of Tract Length Alteration: To determine the precise alterations that occur in the
HRAS1 minisatellite tracts during meiosis, we sequenced 160 minisatellite tracts from six different
strains. The tract length alterations (13 insertions, 62 deletions) are shown in Figure 4a and 4b.
Among the 62 deletions sequenced, four tracts had a single repeat loss, 18 had two repeats deleted,
Jauert & Kirkpatrick, pg. 14
25 were missing three, 9 were missing four, 2 were missing five, two were missing six, and one
lost nine repeats. Among the insertions, 3 had a single extra repeat, 5 had two extra, 2 had three
extra, and 3 had four repeats added to the tract length. All tract length alterations occurred in
multiples of 28 bases with two exceptions as noted in Figure 4a. The alterations were conservative
– no sequence rearrangements were detected in the tract surrounding the deletions, although one
insertion had repeats that, while still 28 bp in length, had a number of internal sequence alterations
that were not consistent with any of the standard repeat sequences (@ in Figure 4a).
As described above, the tracts from all four meiotic spore products were sequenced in 22
tetrads of DTK611 (10/10m). Other than the gene conversions of the 3.4 and 4.1 base
heterozygosities described above and the observed length alterations shown in Figure 4a, no
alterations were detected in the minisatellite tracts in DTK611. This result indicates that meiotic
alterations in the HRAS1 minisatellite are conservative – they do not appear to affect other
homologs or sister chromatids in a detectable manner.
We previously demonstrated that Spo11p was required for the formation of DSBs at HIS4
and for the high frequency of aberrant segregation of the heterozygous his4-lopc allele during
meiosis in strains containing the 30-repeat his4-A1 allele of the HRAS1 minisatellite (JAUERT et al.
2002). To determine if tract alterations in the minisatellite also are dependent on Spo11p, we
compared the level of tract alteration in DTK633 (his4-A1 spo13) and DTK639 (his4-A1 ∆spo11
spo13); these strains were previously used to investigate DSB formation and aberrant segregation
of his4-lopc (JAUERT et al. 2002). Strains lacking Spo11p arrest during meiosis, but the spo13
mutation bypasses this arrest by eliminating the first meiotic division. Two diploid meiotic
products are formed, rather than four haploid products (KLAPHOLZ and ESPOSITO 1980). We
dissected dyads from DTK633 and DTK639 and performed whole-cell PCR after colonies had
Jauert & Kirkpatrick, pg. 15
formed from each diploid spore. In DTK633, 19/50 dyads (38%) exhibited an altered tract in at
least one spore colony. In contrast, 0/48 dyads (0%) from DTK639 had an altered tract. Of the 19
altered tracts observed, 3 were a one-tract/spore increase in length, 8 were a one-tract/spore
decrease in length, 5 were a two-tract/spore decrease in length, and 3 were dyads in which both
spores had one of the two alleles decrease in length. These data indicate that, in the absence of
Spo11p, alterations in tract length do not occur, but in the presence of Spo11p, a wild-type pattern
of tract alterations is observed.
Jauert & Kirkpatrick, pg. 16
DISCUSSION
We previously introduced the HRAS1 minisatellite into the HIS4 locus of S. cerevisiae to
allow us to identify structural and genetic factors that influence the stability of the minisatellite
during meiosis (JAUERT et al. 2002). In the human population there are a large number of HRAS1
minisatellite alleles; these alleles differ in total number of repeats (and thus overall length) and in
the primary sequence of the 28 basepair repeat units. Individuals are therefore likely to be
heterozygous at the HRAS1 minisatellite tract for both length and base composition. In this report
we used our yeast model system to identify the relative influences of sequence heterozygosity and
length heterozygosity on meiotic tract length stability by constructing strains that vary in either
length (repeat number) or composition (primary repeat sequence) and comparing the frequency of
tract length changes when heterozygous and homozygous.
We find that diploid strains that are heterozygous for either point mutations or length alleles
have dramatically different meiotic tract alteration frequencies. Length and sequence
heterozygosity have diametrically opposed influences on HRAS1 minisatellite tract stability during
meiosis. A strain that is heterozygous for tracts differing by three repeats has four times as many
observable tract length alterations as a strain with tracts that differ by only two bases.
Our data demonstrate that base sequence differences between the two alleles of the HRAS1
minisatellite tract in a diploid cell act to stabilize the minisatellite during meiosis. Further, we find
that this stability increase is dependent on a functional DNA mismatch repair system. Three
different models could account for this effect: 1) the base mismatches lead to a decreased level of
heteroduplex formation and consequently a decreased level of loop extrusion, 2) the mismatches
are detected by the DNA mismatch repair pathway and corrected, and nearby extruded loops are
Jauert & Kirkpatrick, pg. 17
corrected incidentally, or 3) the presence of the mismatches stabilize the repeats during strand
annealing and heteroduplex formation, preventing loop extrusion.
Examination of HIS4 recombination levels, as measured by the frequency of aberrant
segregation at HIS4, argues against the first model. We find that aberrant segregation of the his4lopc heterozygous insertion allele is not significantly different between DTK611 (10/10m) and
DTK751 (10/10) (Table 2). Deletion of the PMS1 gene in DTK611 increases tract instability
(DTK611 versus DTK763, Table 1), but aberrant segregation of his4-lopc actually decreases, the
opposite of the result expected if decreased heteroduplex formation is responsible for the decreased
level of tract alteration observed in DTK611 (Table 2). In support of these results, a high level of
gene conversion of the 3.4 and 4.1 heterozygosities (68%) was detected by sequence analysis in 19
tetrads from DTK611, indicating that these mismatches are incorporated into heteroduplex DNA at
a high level, even though the tracts show a significant reduction in tract length alterations. As the
base heterozygosities have no readily-scorable phenotype, the sequenced DTK611 tetrads represent
a random sampling with respect to aberrant segregation of the 3.4 and 4.1 base heterozygosities.
Sample bias could have arisen through choice of the tetrads that were sequenced (for example due
to the selection of tetrads in which at least one spore colony exhibited an altered tract length).
However, seven of the 8 tetrads that were chosen for sequencing specifically because they did not
have any detectable tract alterations had gene conversion events at the base heterozygosities.
These genetic data do not, however, rule out the possibility that recombination-initiating DSB
formation differs in the heterozygous and homozygous strains. Previous analysis of DTK314,
containing the 30-repeat HRAS1 minisatellite allele, indicated that meiosis-specific DSBs formed
5’ and 3’ of the minisatellite insertion (JAUERT et al. 2002). If, in the heterozygous strain, the
frequency of the 5’ BIK1-proximal breaks was reduced, while the normal frequency of the 3’ HIS4-
Jauert & Kirkpatrick, pg. 18
proximal breaks was maintained, minisatellite tract alterations could be reduced while his4-lopc
aberrant segregation remained relatively unaltered, explaining the reduction in tract alteration
without a reduction in his4-lopc aberrant segregation.
The second model predicts that the repeats adjacent to the mismatches are less likely to be
involved in an alteration event, as these repeats would be corrected efficiently if extruded as a loop.
However, sequencing of altered tracts indicated that the distribution of alteration events is similar
in DTK611 and DTK751 (Figure 4a). The locations of deletions in DTK751 and in DTK611 are
distributed across the entire minisatellite tract; only DTK758 (10/10 ∆pms1) may be exhibiting a
bias in deletions. Insertions are also found adjacent to the 3.4 and 4.1 heterozygosities in DTK611
(Figure 4a). If the mismatches were directing loop repair, one would expect that the intervals
adjacent to the 3.4 and 4.1 heterozygosities would exhibit less tract length alteration. The high
level of gene conversion of the 3.4 and 4.1 heterozygosities (68%) indicates that these mismatches
are recognized and repaired at a high level. This repair may include adjacent loops, but the repair
would require a bias in direction such that two 7-repeat and two 10-repeat tracts are maintained,
but with no directionality in gene conversion of the 3.4 and 4.1 heterozygosities. While the
evidence does not support the second model, we cannot rule it out completely, as the number of
events in DTK611 and DTK751 that are directly relevant is relatively small.
Our data are consistent with the third model, in which loop formation is repressed in some
manner by the presence of the base heterozygosities. The exact mechanism by which this
suppression is occurring is not evident from our data. However, DNA mismatch repair has been
implicated in suppression of homeologous recombination – recombination between diverged
sequences (reviewed in BORTS et al. 2000; HARFE and JINKS-ROBERTSON 2000)). The role of
PMS1 in homeologous recombination is complex, as PMS1 has been shown to be involved directly
Jauert & Kirkpatrick, pg. 19
in some studies of homeologous recombination (CHAMBERS et al. 1996), but in other studies it had
no influence (SELVA et al. 1995).
Our results demonstrate that a high level of tract conversion is detectable when there are
length differences between the two alleles of the HRAS1 minisatellite tract. This finding is
predicted by our model for tract alteration (Figure 1), which involves loop formation during
heteroduplex DNA; the sequencing and ∆spo11 data presented here further support this model. In
strains heterozygous for tract length, heteroduplex formation involving the minisatellite tract
should lead to loop formation, with loop size dependent on the difference in tract length size.
Thus, it might be expected that a strain heterozygous for length alleles would have an elevated
level of tract alteration, observable as tract length gene conversion events. Such gene conversions
are not detectable in strains homozygous for a tract length allele, but can be seen in heterozygous
strains. We observe a high level of aberrant segregation of minisatellite tract length in DTK777
(10/7), DTK820 (10/7m) and DTK825 (10/7 ∆rad1), with a majority of these events being gene
conversions. If we eliminate those tetrads exhibiting only gene conversion events, considering
only tracts that altered to a non-parental length (Table 3), the frequency of alteration is reduced to
16% in DTK777, 19% in DTK820, and 23% in DTK825. In comparison, the alteration frequency
in DTK751 (10/10) was 28% and in DTK795 (7/7) was 25% (Table 1). The only statistically
significant deviation is between DTK777 and DTK751 (p = 0.02; altered versus unaltered only).
While a trend towards a lower frequency of non-parental length alterations can be seen in strains
with heterozygous length alleles, this result is not generally significant statistically, due to the small
number of tetrads of the appropriate classes available for analysis. Thus, the high level of meiotic
tract alterations in the heterozygous strains is the sum of the random formation of loops seen in
homozygous length strains (which can lead to non-parental length tracts) plus the extrusion of
Jauert & Kirkpatrick, pg. 20
loops during heteroduplex formation due to alignment of the unique DNA sequences that flank the
heterozygous minisatellite tracts (which leads to parental tract length gene conversion events).
The presence in DTK611 (10/10m) of HRAS1 minisatellite tract length alterations that are
gene conversion events indicates that the factors acting on the extruded single-stranded loop are not
capable of discriminating an alteration repair event from a restoration event, or, if capable, are
preferentially repairing the loops to yield gene conversions. This finding is similar to other
observations of gene conversion versus restoration repair at the HIS4 locus. Gene conversion of
base mismatches at the HIS4 locus exhibits a polarity gradient, with those at the 5’ end of the gene
being preferentially repaired as gene conversion events, and an increasing fraction being repaired
as restoration events when the mismatch occurs further from the site of initiation (reviewed in
NICOLAS and PETES 1994).
Our data demonstrate that length differences between the two alleles of the HRAS1
minisatellite tract lead to a high level of observable alteration during meiosis. The high level of
alteration is not likely to be the result of an increase in the overall frequency of heteroduplex
formation: the amount of aberrant segregation of his4-lopc is not statistically different in DTK751
(10/10 - 52%), DTK795 (7/7 – 60%), and DTK777 (10/7 – 54%) (Table 2), and the heterozygous
strain DTK777 does not exhibit the highest amount of aberrant segregation. A similar high level of
tract length alteration was detected in another yeast minisatellite model system, using 31- and 51repeat alleles of the human MS205 tract, although there was significant internal repeat variation
between the 31 and 51-repeat alleles that may have influenced stability (HE et al. 2002) and
complicates interpretation of the data. Additionally, the authors reported a high level of spore
inviability that they attributed to uncorrected double-strand breaks. We observed no alteration in
spore viability in any of our strains (data not shown).
Jauert & Kirkpatrick, pg. 21
In strains that are heterozygous for minisatellite tract length alleles, the level of detectable
tract length alterations (tract conversions plus non-parental length alterations) (Table 3) is higher
than the aberrant segregation of his4-lopc in those same strains (Table 2). This difference may be
due to the difference in distance between the recombination initiation site(s) and the minisatellite
tract and the initiation site and the his4-lopc insertion, with his4-lopc being further down the
gradient of heteroduplex formation (Figure 1). It is possible that aberrant segregation events at
his4-lopc may also only be generated by heteroduplex tracts initiating from HIS4-proximal DSBs,
while the minisatellite alterations may be generated by heteroduplex from both HIS4-proximal and
BIK1-proximal DSB regions, depending on the length of the heteroduplex DNA tracts resulting
from the different initiation events.
In conclusion, our data indicate that during meiosis the length and sequence heterogeneity
of the two HRAS1 minisatellite alleles will have competing influences on the final structure of the
tract that is included in a gamete’s genome. Human cells are likely to contain alleles that are
heterozygous for both length and base composition, as the most common allele, a1, is only found in
approximately 50% of the population (GARRETT et al. 1993). Factors that influence minisatellite
tract length or sequence composition may potentially affect essential genes, including genes
important in oncogenesis or development, as minisatellite tracts have been shown to influence the
transcription of surrounding genes. For example, rearranged alleles of the HRAS1 minisatellite
have been correlated with cancers, including primary tumors of the brain (VEGA et al. 2001), lung
(ROSELL et al. 1999), ovaries (WEITZEL et al. 2000), colon (KRONTIRIS et al. 1993), bladder
(KRONTIRIS et al. 1993) and breast (DING et al. 1999; KRONTIRIS et al. 1993). Some studies also
show a positive correlation between BRCA1 mutations, rare alleles of the HRAS1 minisatellite, and
ovarian cancer incidence (PHELAN et al. 1996). A link between the HRAS1 minisatellite and
Jauert & Kirkpatrick, pg. 22
transcriptional activity of the HRAS1 gene has been demonstrated (COHEN et al. 1987; SPANDIDOS
and HOLMES 1987). Different HRAS1 minisatellite alleles have differing enhancer activities, with
some of the rare alleles having a stronger transcription enhancement in vitro than the common
forms (GREEN and KRONTIRIS 1993), implicating the rare alleles in cancer formation (KRONTIRIS et
al. 1985) possibly by H-ras protein level elevation through enhanced HRAS1 transcription. Our
results identify DNA sequence elements that may contribute to the formation of rearranged and
potentially oncogenic minisatellite tracts. Finally, our findings may be applicable to other
minisatellites in the human genome, including some that have been associated with diseases, such
as progressive myoclonus epilepsy (LAFRENIERE et al. 1997; VIRTANEVA et al. 1997) and insulindependent diabetes mellitus (KENNEDY et al. 1995).
ACKNOWLEDGEMENTS:
This work was supported in part by Basil O’Connor Starter Scholar Research Award Grant No. 5FY00-573 from the March of Dimes Birth Defects Foundation.
Jauert & Kirkpatrick, pg. 23
LEGENDS:
Figure 1: A Model for Minisatellite Tract Alteration During Meiotic Recombination. Paired
meiotic chromosomes are shown, with each chromosome being double-stranded. Relative
locations of the BIK1 and HIS4 genes are shown. Square boxes indicate the repeats of the
introduced HRAS1 minisatellite. The black dot on the grey homolog pair represents the his4-lopc
mutation used to monitor HIS4 meiotic recombination. (a) Processing of the DSB adjacent to the
tract yields a long single-stranded tail. (b) The tail invades the analogous region on the homolog,
forming heteroduplex DNA. The minisatellite tract can either completely anneal (c) or improperly
anneal (d), leading to the extrusion of a single-stranded loop. If the end of the invading strand is
within the minisatellite tract rather than flanking unique DNA (not shown) then polymerase
extension could lead to an alteration in tract length if the invading strand was misaligned with
respect to flanking unique DNA. (d) depicts a one-repeat loop; larger loops are possible. Removal
of the loop would lead to a contraction in the length of the tract; cleavage of the DNA strand
opposite the loop followed by repair synthesis using the loop as a template will result in tract
expansion.
Figure 2: The Structure of the HIS4-BIK1 Locus in Diploid Strains. The dark grey rectangle
represents the BIK1 gene, while the light grey box represents the HIS4 gene. One copy of the HIS4
gene carries the his4-lopc allele, indicated as a dark vertical line. The open ovals represent the
TATAA box for HIS4. Open rectangles represent the individual 28 bp repeats of the HRAS1
minisatellite. Thick dark lines adjacent to the repeats indicate the location of unique human DNA
flanking the HRAS1 minisatellite. Dots within the repeats represent the two point mutations in
Jauert & Kirkpatrick, pg. 24
his4-H10m and his4-H7m. Light grey repeats have a C at the 7th position and a G at the 15th, white
repeats have a G at the 7th and a C at the 15th, and dark grey indicates a G at both positions. The
repeats are numbered in DTK751 to indicate orientation.
Figure 3: Representative Tract Alterations in DTK777. PCR products of the minisatellite tract
from four complete tetrads are shown. Spore colonies are marked a – d, and the type of tetrad is
indicated above each. GC = Gene Conversion. The white arrow marks the non-standard band in
the 4th tetrad.
Figure 4: Analysis of Deletions in Minisatellite Tracts. (a) The locations of insertions and
deletions in the 10-repeat HRAS1 minisatellite tracts are shown. Insertions are depicted above the
minisatellite tract; deletions are below the tract diagram. Each repeat is indicated by a shaded
rectangle and numbered (1-10 or 1-7, with BIK1 to the left and HIS4 to the right of the tract as
diagrammed); repeats that have the same shade have the same nucleotides at the variable +7 and
+15 positions as discussed in the Introduction. The extent and approximate position of each
sequenced alteration is shown as a thin bar. Bracketed arrows indicate the repeat in which the
insertion occurred. The exact deletion and insertion endpoints cannot be determined precisely due
to the repetitive nature of the repeats. For deletions, the position in the figure is given relative to
the first variable base that defines the left edge of the deletion. The strain from which each
insertion/deletion was isolated is shown to the left. Bars indicating insertions/deletions from the
same strain are colored similarly to aid in distinguishing them. Numbers in parentheses to the right
of the bars indicate the number of times that altered sequence was isolated independently. All
insertions and deletions occurred in units of 28 nucleotides, except * which had a GGG
Jauert & Kirkpatrick, pg. 25
trinucleotide insertion in the polyG tract within repeat 6 and ** which had an additional A in repeat
7. The DTK611 insertion marked with @ had base substitution alterations within the second and
third repeats that caused them to deviate from the consensus sequence, although the overall length
was not affected. (b) The locations of insertions and deletions in the 7-repeat HRAS1 minisatellite
tract strain DTK95 are shown.
Jauert & Kirkpatrick, pg. 26
LITERATURE CITED:
ARMOUR, J. A. L., P. C. HARRIS and A. J. JEFFREYS, 1993 Allelic diversity at minisatellite MS205
(D16S309): evidence for polarized variability. Human Molecular Genetics 2: 1137-1145.
BORTS, R. H., S. R. CHAMBERS and M. F. ABDULLAH, 2000 The many faces of mismatch repair in
meiosis. Mutat Res 451: 129-150.
CAPON, D. J., E. Y. CHEN, A. D. LEVINSON, P. H. SEEBURG and D. V. GOEDDEL, 1983 Complete
nucleotide sequences of the T24 human bladder carcinoma oncogene and its normal
homologue. Nature 302: 33-37.
CHAMBERS, S. R., N. HUNTER, E. J. LOUIS and R. H. BORTS, 1996 The Mismatch Repair System
Reduces Meiotic Homeologous Recombination and Stimulates Recombination-Dependent
Chromosome Loss. Molecular and Cellular Biology 16: 6110-6120.
COHEN, J. B., M. V. WALTER and A. D. LEVINSON, 1987 A repetitive sequence element 3' of the
human c-Ha-ras1 gene has enhancer activity. Journal of Cellular Physiology (Supplement)
5: 75-81.
DEBRAUWERE, H., J. BUARD, J. TESSIER, D. AUBERT, G. VERGNAUD et al., 1999 Meiotic instability
of human minisatellite CEB1 in yeast requires DNA double-strand breaks. Nature Genetics
23: 367-371.
DING, S., G. P. LARSON, K. FOLDENAUER, G. ZHANG and T. G. KRONTIRIS, 1999 Distinct mutation
patterns of breast cancer-associated alleles of the HRAS1 minisatellite locus. Human
Molecular Genetics 8: 515-521.
FAN, Q., F. XU and T. D. PETES, 1995 Meiosis-Specific Double-Strand DNA Breaks at the HIS4
Recombination Hot Spot in the Yeast Saccharomyces cerevisiae: Control in cis and trans.
Molecular and Cellular Biology 15: 1679-1688.
Jauert & Kirkpatrick, pg. 27
GARRETT, P. A., B. S. HULKA, Y. L. KIM and R. A. FARBER, 1993 HRAS protooncogene
polymorphism and breast cancer. Cancer Epidemiol Biomarkers Prev 2: 131-138.
GREEN, M., and T. G. KRONTIRIS, 1993 Allelic variation of reporter gene activation by the HRAS1
minisatellite. Genomics 17: 429-434.
HARFE, B. D., and S. JINKS-ROBERTSON, 2000 Mismatch repair proteins and mitotic genome
stability. Mutat Res 451: 151-167.
HE, Q., H. CEDERBERG and U. RANNUG, 2002 The influence of sequence divergence between
alleles of the human MS205 minisatellite incorporated into the yeast genome on lengthmutation rates and lethal recombination events during meiosis. J Mol Biol 319: 315-327.
JARMAN, A. P., and R. A. WELLS, 1989 Hypervariable Minisatellites: Recombinators or Innocent
Bystanders? Trends in Genetics 5: 367-371.
JAUERT, P. A., S. N. EDMISTON, K. CONWAY and D. T. KIRKPATRICK, 2002 RAD1 controls the
meiotic expansion of the human HRAS1 minisatellite in Saccharomyces cerevisiae.
Molecular and Cellular Biology 22: 953-964.
JEFFREYS, A. J., D. L. NEIL and R. NEUMANN, 1998 Repeat instability at human minisatellites
arising from meiotic recombination. EMBO Journal 17: 4147-4157.
JEFFREYS, A. J., K. TAMAKI, A. MACLEOD, D. G. MONCKTON, D. L. NEIL et al., 1994 Complex
gene conversion events in germline mutation at human minisatellites. Nature Genetics 6:
136-145.
KEARNEY, H. M., D. T. KIRKPATRICK, J. L. GERTON and T. D. PETES, 2001 Meiotic recombination
involving heterozygous large insertions in Saccharomyces cerevisiae: Formation and repair
of large, unpaired DNA loops. Genetics 158: 1457-1476.
Jauert & Kirkpatrick, pg. 28
KENNEDY, G. C., M. S. GERMAN and W. J. RUTTER, 1995 The minisatellite in the diabetes
susceptibility locus IDDM2 regulates insulin transcription. Nature Genetics 9: 293-298.
KIRKPATRICK, D. T., and T. D. PETES, 1997 Repair of DNA loops involves DNA mismatch and
nucleotide excision repair proteins. Nature 387: 929-931.
KLAPHOLZ, S., and R. E. ESPOSITO, 1980 Recombination and chromosome segregation during the
single division meiosis in SPO12-1 and SPO13-1 diploids. Genetics 96: 589-611.
KRONTIRIS, T. G., B. DEVLIN, D. D. KARP, N. J. ROBERT and N. RISCH, 1993 An Association
between the risk of cancer and mutations in the HRas1 minisatellite locus. New England
Journal of Medicine 329: 517-523.
KRONTIRIS, T. G., N. A. DIMARTINO, M. COLB, H. D. MITCHESON and D. R. PARKINSON, 1986
Human restriction fragment length polymorphisms and cancer risk assessment. J Cell
Biochem 30: 319-329.
KRONTIRIS, T. G., N. A. DIMARTINO, M. COLB and D. R. PARKINSON, 1985 Unique allelic
restriction fragments of the human Ha-ras locus in leukocyte and tumour DNAs of cancer
patients. Nature 313: 369-374.
LAFRENIERE, R. G., D. L. ROCHEFORT, N. CHRETIEN, J. M. ROMMENS, J. I. COCHIUS et al., 1997
Unstable insertion in the 5' flanking region of the cystatin B gene is the most common
mutation in progressive myoclonus epilepsy type 1, EPM1. Nature Genetics 15: 298-302.
NICOLAS, A., and T. D. PETES, 1994 Polarity of Meiotic Gene Conversion in Fungi: Contrasting
Views. Experientia 50: 242-252.
PHELAN, C. M., T. R. REBBECK, B. L. WEBER, P. DEVILEE, M. H. RUTTLEDGE et al., 1996 Ovarian
cancer risk in BRCA1 carriers is modified by the HRAS1 variable number of tandem repeat
(VNTR) locus. Nat Genet 12: 309-311.
Jauert & Kirkpatrick, pg. 29
ROSELL, R., R. CALVO, J. J. SANCHEZ, J. MAUREL, M. GUILLOT et al., 1999 Genetic susceptibility
associated with rare HRAS1 variable number of tandem repeats alleles in Spanish nonsmall cell lung cancer patients. Clin Cancer Res 5: 1849-1854.
SELVA, E. M., L. NEW, G. F. CROUSE and R. S. LAHUE, 1995 Mismatch correction acts as a barrier
to homeologous recombination in Saccharomyces cerevisiae. Genetics 139: 1175-1188.
SPANDIDOS, D. A., and L. HOLMES, 1987 Transcriptional enhancer activity in the variable tandem
repeat DNA sequence downstream of the human Ha-ras1 gene. FEBS Letters 218: 41-46.
SZOSTAK, J. W., T. L. ORR-WEAVER, R. J. ROTHSTEIN and F. W. STAHL, 1983 The Double-strand
Break Model for Recombination. Cell 33: 25-35.
VEGA, A., M. J. SOBRIDO, C. RUIZ-PONTE, F. BARROS and A. CARRACEDO, 2001 Rare HRAS1
alleles are a risk factor for the development of brain tumors. Cancer 92: 2920-2926.
VIRTANEVA, K., E. D'AMATO, J. MIAO, M. KOSKINIEMI, R. NORIO et al., 1997 Unstable
minisatellite expansion causing recessively inherited myoclonus epilepsy, EPM1. Nature
Genetics 15: 393-396.
WACH, A., A. BRACHAT, R. POHLMANN and P. PHILIPPSEN, 1994 New heterologous modules for
classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 17931808.
WEITZEL, J. N., S. DING, G. P. LARSON, R. A. NELSON, A. GOODMAN et al., 2000 The HRAS1
minisatellite locus and risk of ovarian cancer. Cancer Res 60: 259-261.
WILLIAMSON, M. S., J. C. GAME and S. FOGEL, 1985 Meiotic gene conversion mutants in
Saccharomyces cerevisiae. I. Isolation and characterization of pms1-1 and pms1-2. Genetics
110: 609-646.
Table 1: Comparison of minisatellite tract alterations in diploid strains containing HIS4 promoter minisatellite insertions:
Number (%) of tetrads with altered minisatellite tracts#
Strain
DTK751
HIS4
# of
promoters
repeats
mutation tetrads
10/10
wild type
148
106 (72)
6 (4)
20 (14)
12 (8)
4 (3)
0
28
10/10
∆rad1
117
77 (66)
2 (2)
22 (19)
11 (9)
5 (4)
0
34
10/10
∆pms1
114
72 (63)
7 (6)
22 (19)
8 (7)
3 (3)
2 (2)
37
118
82 (69)
4 (3)
18 (15)
11 (9)
3 (3)
0
31
10/10m wild type
213
180 (85)
4 (2)
20 (9)
7 (3)
2 (1)
0
15
10/10m
117
92 (79)
1 (1)
15 (13)
6 (5)
3 (3)
0
21
his4-H10
relevant
total
none
1 spore
1 spore
2
altered increase decrease altered
3
4
%
altered altered altered
his4-H10
DTK802
his4-H10
his4-H10
DTK758
his4-H10
his4-H10
DTK811
his4-H10m 10m/10m wild type
his4-H10m
DTK611
his4-H10
his4-H10m
DTK764
his4-H10
∆rad1
his4-H10m
DTK763
his4-H10
10/10m
∆pms1
113
72 (64)
4 (4)
25 (22)
8 (7)
4 (4)
0
36
7/7
wild type
216
162 (75) 10 (5)
29 (13)
10 (5)
5 (2)
0
25
his4-H10m
DTK795
his4-H7
his4-H7
# The first number represents the total number of four spore colony tetrads examined that exhibit the indicated alteration, and the second number in parentheses is the percentage
of the total number examined that exhibit the indicated alteration.
Table 2: Analysis of aberrant segregation of his4-lopc in strains containing HIS4 promoter minisatellite insertions:
Number of tetrads with various segregation
patternsa
Strainc
HIS4 promoters
DNY26
HIS4/HIS4
DTK751
# of
relevant
Total
repeats
mutations
Tetrads
4:4
6:2
2:6
5:3
Ab
Other
%
3:5
4:4
Ab Seg
Ab.Seg
cMb
-
wild type
493
244
29
17
88
67
15
33
51
31
his4-H10/his4-H10
10/10
wild type
235
112
14
12
35
35
10
17
52
38
DTK802
his4-H10/his4-H10
10/10
∆rad1/∆rad1
204
94
11
7
33
30
8
21
54
32
DTK758
his4-H10/his4-H10
10/10
∆pms1/∆pms1
208
99
15
9
34
31
8
12
52
44
DTK811
his4-H10m/his4-H10m
10/10
wild type
249
92
13
8
54
45
18
19
63
34
DTK611
his4-H10/his4-H10m
10/10m
wild type
709
366
44
17
111 110
27
34
48
42
DTK764
his4-H10/his4-H10m
10/10m
∆rad1/∆rad1
253
119
10
8
46
46
9
15
53
39
DTK763
his4-H10/his4-H10m
10/10m
∆pms1/∆pms1
204
116
5
7
39
25
4
8
43
38
DTK795
his4-H7/his4-H7
7/7
wild type
473
189
39
16
84
77
24
44
60
43
DTK777
his4-H10/his4-H7
10/7
wild type
250
115
13
4
48
50
8
12
54
42
DTK825
his4-H10/his4-H7
10/7
∆rad1/∆rad1
219
81
12
8
45
48
12
13
63
40
DTK820
his4-H10/his4-H7m
wild type
208
104
14
9
24
31
7
19
50
42
10/7m
aFor all segregation patterns, the first number represents the wild-type allele and the second, the mutant his4-lopc allele. The segregation patterns include: 4:4 (normal
Mendelian segregation), 6:2 and 2:6 (gene conversion), 5:3 and 3:5 (tetrads with a single PMS event), Ab 4:4 (aberrant 4:4; one wild-type, one mutant, and two sectored
colonies). The "Other Ab. Seg." class includes aberrant 6:2 and 2:6 tetrads as well as tetrads with three or four PMS or gene conversion events.
bGenetic map distance between LEU2 and HIS4.
c DNY26 data is from (FAN et al. 1995)
Table 3: Comparison of meiotic tract alterations in strains containing differing length alleles of the HRAS1 minisatellite tract.
Gene Conversion # (%)a
1 spore
repeat #
Strain
DTK777
DTK825
DTK820
10/7
10/7
10/7m
Non-Parental Length Change # (%)a
2 spore
1 spore
2 spore
3 spore
relevant
total #
no
mutation
tetrads
change
7⇒10
10⇒7
7⇒10
10⇒7
7
10
7⇒10 +
10⇒7 +
2 NP
wild type
118
44 (37)
26 (22)
18 (15)
6 (5.1)
5 (4.2)
⇑: 2 (1.7)
⇑: 0
1 ⇑ NP: 3 (2.5)
1 ⇑ NP: 1 (0.8)
1 (0.8)
0
⇓: 3 (2.5)
⇓: 5 (4.2)
1 ⇓ NP: 0
1 ⇓ NP: 4 (3.4)
⇑: 4 (3.4)
⇑: 2 (1.7)
1 ⇑ NP: 1 (0.9)
1 ⇑ NP: 0
4 (3.4)
2 (1.7)
⇓: 4 (3.4)
⇓: 2 (1.7)
1 ⇓ NP: 1 (0.9)
1 ⇓ NP: 2 (1.7)
⇑: 3 (2.7)
⇑: 1 (0.9)
1 ⇑ NP: 0
1 ⇑ NP: 0
5 (4.5)
1 (0.9)
⇓: 7 (6.3)
⇓: 3 (2.7)
1 ⇓ NP: 3 (2.7)
1 ⇓ NP: 3 (2.7)
∆rad1
wild type
116
112
38 (33)
34 (30)
16 (14)
19 (17)
21 (18)
18 (16 )
8 (6.9)
7 (6.3)
11 (9.5)
8 (7.1)
aThe first number represents the total number of four spore colony tetrads examined that exhibit the indicated alteration, and the second number in parentheses is the percentage
of the total number examined that exhibit the indicated alteration.
7⇒10 = GC changing a 7-repeat tract to a 10-repeat tract; 10⇒7 = GC changing a 10-repeat tract to a 7-repeat tract
⇑ = increase in length; ⇓ = decrease in length; NP = Non-Parental