Download Cooperative Function of Upstream and Core Domains of the Yeast

Mol. Cells, Vol. 3, pp. 133-136
Cooperative Function of Upstream and Core Domains of the Yeast
Ribosomal RNA Gene Promoter
Jae Kyun Rho, Hyuk Ran Kwon, Ronald H. Reeder l and Soo Young Choe*
Department of Biology, Chungbuk National University, Cheongju 360-763, Korea; Ifiutchinson
Cancer, Research Center, Seattle, WA 98104, USA.
(Received on February 27, 1993)
We have previously reported that the yeast, Saccharomyces cerevisiae, ribosomal gene promoter
contains at least two essential domains, an upstream domain located at the 5' boundary near
position - 150 and a core domain around the site of transcription initiation at + 1, by in
vitro analysis using whole cell yeast extracts. Here we show the activity of the promoter is
highly sensitive to spacing changes between two domains, but the activity can be partially
rescued when the spacing changes was either increased or decreased to 10 bp. The upstream
or core domain DNA sequences alone could not compete with wild promoter in transcription
initiation step, and the upstream and core domains are both necessary for transcription initiation
complex formation. The upstream domain of the promoter, however, can be severed from
the core promoter domain once the stable complex has been formed. These results suggest
that the yeast ribosomal gene promoter has a critical requirement for binding of protein or
protein complex to core and upstream domains to be located at precise positions on the
face of the DNA helix.
Saccharomyces cerevrszae ribosomal RNA genes,
which code for 35S rRNA precursor, are known to
contain two distinct DNA elements (diagrammed in
Fig. 1) which influence transcription initiation by
RNA polymerase I. One of these elements is the gene
promoter situated at the 5' end of the 35S coding region. Analysis of the gene promoter both in vivo (Musters et al., 1989) and in vitro (Kulkens et aI., 1991 ; Choe
et al., 1992) shows that it consists of about 150 bp
of sequence which slightly overlaps the site of transcription initiation and that it has a structure similar
to that of vertebrate ribosomal gene promoters. The
other DNA element is the ribosomal gene enhancer.
The enhancer was originally described as a 180 bp
EcoRl to HindIII fragment that is located at the 3'
end of the 35S coding region by in vivo studies (Elion
and Warner, 1984, 1986). Stewart and Roeder (1989),
however, found that another critical region for the transcription enhancement, just to the right of the
HindIII site.
We have recently reported a simple procedure for
obtaining whole cell extracts from yeast that are active
for polymerase I transcription as well as for transcription by polymerase II and III (Schultz et al., 1991).
Using this extract we also showed that the ribosomal
RNA gene promoter can be separated into core and
upstream domains (Choe et aI., 1992). Yeast and vertebrate promoters are of similar size and both can be
separated into core and upstream domains. In this
paper we show that these two domains seem to be
necessary for positioning of transcription initiation factors on the correct face of the DNA and to be con-
* To
whom correspondence should be addressed.
nected via transcription initiation protein or transcription initiation protein complex.
Materials and Methods
Plasmid constructs
pYrllA was the parent plasmid for all constructs.
It contains the 35S ribosomal gene promoter isolated
as a Smal-Taql fragment (- 216 to + 25) from pBD4
(Bell et al., 1977). The fragment was modified by ligating a 16 base pairs (bp) Xhol linker to the Taql site
at +25 and then it was cloned into the large HincIIXhoI fragment of a pGEM3 derivative (pGEM3-EX).
pYr12-5 is the same as pYrllA except that a 26 bp
Xhol linker was inserted into the Taql site at +25
(Schultz et al., 1991, Choe et al., 1992).
Novel Xbal sites were introduced into the promoter by oligonucleotide-directed mutagenesis (Kunkel,
1985). Spacing changes within the gene promoter were
constructed at the positions between -125 and - 105.
A 20 bp deletion mutant was made by digesting -129
/ -102 linker scanner mutant with Xbal and religating.
A 16 bp deletion mutant was made by digesting - 129
/ - 102 linker scanner mutant with Xbal, ftlling the
sticky ends, and religating. All other spacing mutants
were made by cutting 20 bp deletion mutant between
- 125/ -105 with Xbal and inserting the appropriate
size of double stranded oligonucleotide (sequences of
the final constructs are shown in Fig. 2A). All mutations were verified by direct sequencing of the final
construct.
In vitro transcription
Extracts (100,000 X g supernatants) were prepared
© 1993 The Korean Society of Molecular Biology
according to Schultz et al. (1991) from cells grown
in YEPD to OD600 1-4 and broken with a mortar and
pestle under liquid nitrogen. Transcription reactions
were performed at 22 °C as described (Choe et aI.,
1992), except that they were in 20 Iil, contained 90
mM KC1, and the nucleotides were at 500 f.LM each.
All reactions in a series received the same amount
of extract, in the range of 40-80 Ilg protein, and were
run for 30-60 min.
Assay of RNA polymerase I transcnptzon
Sl nuclease protection assays were performed essentially according to Labhart and Reeder (1986), using
single-stranded DNA probes. The Sl nuclease protection probe for transcription of the pYr11A was a 50nucleotide ·single-stranded oligonucleotide complementary to pYrllA from -15 to +35. The Sl probe
for detecting transcripts from pYr12-5 is 60-nucleotide
single-stranded oligonucleotide complementary from
-15 to +45.
Results and Discussion
Spacing between two domains gives a partial rescue of
promoter activity
All of the work in this paper was done with a promoter fragment which extends from an SmaI site at
position -216 upstream of transcription initiation to
a Taq I site at position + 25 downstream of initiation.
At the TaqI site a 16 or 26 bp linker has been inserted
to facilitate distinguishing transcripts from this promoter from endogenous transcripts. The sequence of
this fragment is shown in figure 1.
To examine the possible' role of domain spacing
in the yeast ribosomal gene promoter we made various
push _apart and pull together spacing mutants. As
shown in Figure 2 we first removed 20 bp between
the position of - 125 and -105. Secondly, we inserted
additional nucleotides to create push apart mutants.
The transcription activity of both the pull together
and push apart spacing mutants is shown in Figure
2B. Changing the spacing .at this location is very dele-
terious to promoter actIvIty. For example, either increasing or decreasing the spacing by 5 bp causes activity to drop to about 10% of wild type. The most interesting result, however, is that a partial rescue of promoter activity is observed when the spacing is further
increased or decreased to 10 bp. This type of periodic
dependence on spacing has been previously described
for domains of the Xenopus [aevis ribosomal gene promoter (McStay and Reeder, 1990; Pape et aI., 1990).
. We interpret these results to me~ n that spacing between the core and upstream domains of yeast promoter is critical. Furthermore, transcription factors bound
to the core and upstream domains of the yeast promoter must be positioned on the correct face of DNA
for maximal activity.
The upstream domain is dispensable after formation of
stable transcription initiation complex
As shown in Figure 2, precise spacing between these
two domains is essential for promoter activity but
much of the sequence betWeen the two domains can
be replaced with little effect as long as the original
spacing is maintained. Covalent linkage between the
two domains appears to be essential to allow stable
promoter complex formation. We wondered whether
covalent linkage was still essential after the stable complex had been formed. To answer this question a
promoter was incubated in extract, in the absence of
triphosphates, to allow stable complex formation.
Then a restriction enzyme was added to cut the pro-
A
·1 16
-100
I
I
~
I
I
-- - -TTTCTCGGCAAGAAATACGTAGTTAAGGCCGAGCGACAGAGAGGGCAAA----
I
tct--------------------aga
tctagct----------------aga
tctagagcggtct----------aga
tctagagcatggcggtct-----aga
tctagacgccggcatggcggtctaga
tctagacgccggcatggcggtctrga
gctct
I
-20
· 16
· 10
·S
+S
+ J()
' IS
+ 2U
tctagacgccggcatggcggtct~rg=--a_-,-...,
gcaccagtct
tctagaggcagctggtgcctaccf-'rg'---a--:-_ _-,---,
gccatgccggcgtct
tctagagccctggcagctggtgcaga
I
B
•
ctaccgccatgccggcgtct
,
CCCGGGCCACCTCTCAc.TTTCCAA.AAAAATATACCCTMGATTTTTCC.AGAATACCTT
,
-IJU
Core domain
A
.1)0
Mol. Cells
Yeast Ribosomal RNA Gene Promoter
134
,
s-J
.UXI
AAATTCAAGTTTrTCTCCGCMCAAATACGTACTTAAa:x:J:.CACCCN:ACAGAcaxAAAACAAAATAM
B
·20 ·16 ·I ll.~
0
..,
0
., - 10 'I ~
·2CJ
,
.jO
AGTAAGATITTAG1TTCT AA T'GCCACGGGGGCiiTAGTCATCGACTACAACTCl'CACCAAMCTAcrrcc
,.1
( 16 bp
CAGCTACTTCATCCGAAAGCAClTGAAGACMCITCCTCMCACCCT'CCAG
rr.. o
linl
xw
Transcription
signal
CCI<JTCTCACCCTCAAGAcccrCGAC ( 26 bp Iinl
"'"
Figure 1. (A) Diagram of the yeast ribosomal gene and its
spacer region. (B) Sequences of the ribosomal gene promoter. The promoter region was subcloned and tagged by inserting an XhoI linker (underlined) into the TaqI site 23 bp
downstream from the transcription start site.
Figure 2. Effect of changing the spacing between upstream
and core promoter domains. (A) Sequence of spacing mutants in -125/ - 105. Dotted line depicts the deleted sequences.
(B) Transcription activity from the - 125/ -105 spacing mutants.
----- - •••
I 2 3 4
A
5 6 7 8
•
9 10' 11 12
A
•
.2
Seal
1-------f:,/~
Seal
LS-1 2'J/-I02 1
Seal
LS-I O'J/- I02 1
7
8
9
.2
I
.2
L.....J
I
.2
L.....J
I
0
pmole
L.....J
-2 16/- 103 -21 6/-83 -2 16/-63 -21 6/-43
B
Xbal ", ,Xbal ,~
_
3
4
5
6
7
8
9
10 II
12
Transcription signal
Seal
Figure 4. Competition effect of the promoter fragments in
transcription. (A) 3' deleted promoter fragments were used
for competition. In case of lanes I, 3, 5, 7, 0.2 pmole DNA
was used for competition and in lanes 2, 4, 6, 8, one pmole
was used. Lane 9 shows the transcription signal in the absence of competitor. (B) The plasmids which contain the 5'
deletion promoters were used for competition. The final concentration of the competitor plasmids were 20 Ilg/ml.
----11- - - 1
Xbal ,~
'
Seal
/l-----i
_
,'/----r-=
2
-1 55/+35
-1 02/+35
-42/+35
pGEM
-2 16/+35
-142/+35
-82/+35
-22/+35
·1 62/+ 35
-1 22/+ 35
-62/+3 5
-2/+35
,~
__
I
Template
Xbal digestion
Xbal
XbaI
6
4
Transcription signal
- +++
II---.ic_
I
L.....J
Same as 1-4 Same as 1-4
p YR I I A
3
Transcription signal
pYrilA LS-129/-102 LS-I09/-102
- +++
2
Template
•
•
B
C
135
Jae Kyun Rho et at.
Vol. 3 (1993)
Seal
_ - - - - 11- - - 1
Figure 3, The upstream element of the promoter can be
severed from the core region, following stable complex formation. (A) Demonstration that XbaI completely digests templates in the presence of whole cell extract Constructs were
cut with Seal, end-labeled with 32p , put through the reaction
protocol up to the point of adding nucleotide, at which point
nucleic acids were isolated for electrophoresis. (B) Transcription results. Lanes I, 5, 9, initiation signal from three different promoter mutants. Lanes 2, 6, 10, addition of Xbal prior
to stable complex formation. Note that pYrilA does not
contain an XbaI site. Lanes 3, 7, II , addition of heat inactivated XbaI after stable complex formation. Lanes 4, 8, 12,
addition of active Xbal after stable complex formation, prior
to addition of nucleotides. (C) Diagram of the template
DNA
moter between the core and upstream domains. Finally, triphosphates were added and transcription capacity was measured. Figure 3B shows the results of this
type of experiment as perfonned on three different
variants of the promoter. The first promoter tested was
a wild type promoter (pYrllA) which does not contain
an XbaI site between two domains (Fig. 3C). Addition
of the enzyme XbaI, either before stable complex formation (lane2) or after complex fonnation (lane 4)
had no effect dn transcription.
The same experiment was then perfonned using a
promoter containing a large substitution of foreign sequence between positions - 129 and - 102. An XbaI
restriction site is present at either end of this substitution (Fig. 3C). As we have shown previously, this sub-
stitution mutation is relatively neutral when the intact
promoter is assayed (Choe et al., 1992). If this template
is digested with XbaI prior to stable complex fonnation, transcription is nearly eliminated as expected (7%
of control, lane 6 in Fig. 3B). However, if XbaI digested is perfonned after · stable complex fonnation, about
31 % of the control activity remains (Fig. 3B, lane 8).
Figure 3A, lane 8, shows that digestion was complete
in this particular reaction, even in the presence of
the prefonned stable complex. We repeated the experiment with another mutated promoter, LS-I09/-1Q2,
which contains a single XbaI site at the indicated location between the upstream and core domains (Fig.
3C). Cutting at this site prior to stable complex fonnation also destroys promoter activity (4% of control, Fig.
3B, lane 10). However, complete cutting after stable
complex fonnation still allows about 58% of the control activity (Fig. 3B, lane 12). This strongly suggests
that the upstream domain of the promoter is essential
for assembly of the stable promoter complex but physical linkage is not needed after that assembly has
occurred.
Both upstream and core domais are necessary for competing against wild type promoter
The promoter can be divided into two domains and
the upstream domain is proved to be necessary for
transcription as shown above (Fig. 3B, lane 6 and
lane 10). In general it is known that the promoter
sequences serve as the binding site for specific tra'n scription factor proteins. If there is a transcription factor,
which can bind only to the upstream domain, the
transcription activity of the promoter should be decreased in the presence of excess amounts of upstream
DNA.
136
Yeast Ribosomal RNA Gene Promoter
Figure 4 shows the results of competetion experiments. We used two different sets of DNA fragments
for the competition assay. All DNA fragments of one
set have upstream domain of the promoter and various downstream length of promoter. For example,
all the four DNA fragments in Figure 4A have the
same 5' boundary of the gene promoter and have various length of internal promoter sequences. Only the
fragment of -216/ -43 covers both of the upstream
and core domains. We preincubated these fragments
with yeast cell extracts for 10 min at room temperature
in order to form the DNA-protein complex and then
added the template DNA for the transcription. Interestingly all the fragments, except -216/- 43, could not
compete against the promoter (Fig. 4A). When the
fragment - 216/- 43 is used as the competitor, the
transcription from the intact promoter is strongly inhibited. This result shows that some protein(s) only can
bind to the upstream DNA at the presence of core
domain DNA
We also used the plasmids which contain core domain DNA and various length of upstream DNA as
the competitor against the promoter activity (Fig. 4B).
As expected the transcription was strongly inhibited
by the DNAs which contain both upstream and core
domains (lane 2-5). The core domain DNA, however,
still showed some transcription inhibitory effects, and
the transcription signals were basal level (lane 6-9).
These results strongly suggested two things. One is
that the core domain DNA could serve as the first
binding site for some protein(s), and another is that
the upstream DNA binding protein(s) could bind to
the upstream domain after formation of core DNAprotein complex.
Mol. Cells
Acknowledgments
This work was supported by a Genetic Engineering
Research grant from Ministry of Education, 1991.
References
Bell, G. I., DeGennaro, L. J., Gelfand, D. H., Bishop,
R J., Valenzuela, P., and Rutter, W. J. (1977) J Bioi.
Chern. 252, 8118-8125
Choe, S. Y., Schultz, M. c., and Reeder, R H. (1992)
Nucleic Acids Res. 20, 279-285
E1ion, E. A , and Warner, J. R (1984) Cell 39, 663-659
Elion, E. A , and Warner, J. R (1986) Mol. Cell. Bioi.
6, 2089-2097
Kulkens, R , Riggs, D. L., Heck, J. D., P1anta, R J.,
and Nomura, M. (1991) Nucleic Acids Res. 19, 53635370
Kunkel, T. A (1985) Proc. Nat!. Acad. Sci. USA 82, 488-
492
Labhart, P., and Reeder, R H. (1986) Cell 37, 285-289
McStay, B., and Reeder, R H. (1990) Genes and Dev.
4, 1240-1252
Musters, W., Knol, J., Maas, P., Dekker, A F., van
Heerikhuizen, H ., and P1anta, R J. (1989) Nucleic
Acids Res. 17, 9661-9678
Pape, L. K , Windle, J. J., and Sollner-Webb, B. (1990)
Genes and Dev. 4, 52-62
Schultz, M. c., Choe, S. Y., and Reeder, R H. (1991)
Proc. Natl. Acad. Sci. USA 88, 1004-1008
Stewart, S. E., and Roeder, G. S. (1989) Mol. Cell. Bioi.
9, 3463-3472