Download Name Unit 6 DNA Test (Chapters 8) Study Guide

Name ______________________________
Unit 6 DNA Test (Chapters 8) Study Guide - Honors
Complete the following multiple-choice questions. As we go over the correct responses, make notes for yourself about the question below
it.
______1.
The cells that make up the skin of an individual have some functions different from the cells that make up the
liver because
a. all cells have a common ancestor.
b. different cells have different genetic material.
c. environment and past history have no influence on cell function.
d. different parts of genetic instructions are used in different types of cells.
Notes:
______2.
Fruit flies with the curly-wing trait will develop straight wings if kept at a temperature of 16°C during
development and curly wings if kept at 25°C. The best explanation for this change in the shape of wings is
that the
a. genes for curly wings and genes for straight wings are found on different chromosomes.
b. type of genes present in the fruit fly is dependent upon environmental temperature.
c. environment affects the expression of the genes for this trait.
d. higher temperature produces a gene mutation.
Notes:
______3.
Genes involved in the production of abnormal red blood cells have an abnormal sequence of
a. ATP molecules.
c. sugars.
b. amino acids.
d. bases.
Notes:
______4.
Klinefelter’s syndrome is a genetic disorder caused by the presence of an extra chromosome in the body cells of
humans. This extra chromosome occurs in the gamete as a result of
a. an error in the process of cloning.
c. a gene mutation.
b. an error in meiotic cell division.
d. replication of a single chromosome during mitosis.
Notes:
5. Name the individual subunits on the left and the name of the structure they make on the right.
Answer the following.
6.
Transcribe the provided DNA strand, and then translate it into a protein using your amino acid chart from your notes.
DNA strand: TACCCGTTACCTGGCAACGATCACATC
MRNA:
Protein:
Show the following mutations of the above DNA strand and discuss how they would or would not affect the amino acids found
within the protein:
A. Point (Substitution):
Effect on protein:
B. Silent (Point)
Effect on protein:
C. Nonsense (Point)
Effect on protein:
D. Frame shift (insertion)
Effect on protein:
E. Frame shift (deletion)
Effect on protein:
7.
Arrange the following structures from largest to smallest. Explain how they are related.
A chromosome
A nucleus
A gene
Largest
____________________________
____________________________
Smallest
____________________________
8.
18. If a sample of DNA is 20% T, what % is it of C, G, and A according to Chargaff’s Rules?
9.
What is a mutation?
10. What is the difference between a gene mutation and a chromosomal mutation?
11. Describe and Draw (using ABCDEF as genes on the chromosome) the following chromosomal mutations:
a.
Deletion
b.
Inversion
c.
Duplication:
d.
Nondisjunction
e.
Translocation
12. What would a karyotype look like for an individual with Down Syndrome? Klinefelter Syndrome? Turner Syndrome?
13. Explain the three reasons why a gene mutation may not affect phenotype.
14. Describe DNA replication. When does it take place? Where does it take place? What are the steps? What is the purpose? How
is the information in DNA conserved?
15. Describe transcription. Where does it take place? What are the steps? What is the purpose?
16. Describe translation. Where does it take place? What are the steps? What is the purpose?
17. How are transcription and translation similar in all living things?
18. Trace the path of a membrane or secretory protein beginning with the instructions in the nucleus to the final destination of the
product at the cell membrane. (Trace the flow of the information, to the product, to where the product ends up.)
Nucleus - ____________ - ____________ - ___________ - __________ - Cell Membrane