* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Transcription and Translation Practice
Survey
Document related concepts
Zinc finger nuclease wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
DNA sequencing wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA profiling wikipedia , lookup
Homologous recombination wikipedia , lookup
Microsatellite wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA replication wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Transcript
DNA Practice Exam 1. 2. 3. 4. 5. 6. Name:________________________ Total number of amino acids _____________ Number of nitrogen bases found in DNA _____________ Number of nitrogen bases found in an anticodon _____________ Number of nitrogen bases found in a codon _____________ Number of strands that make up RNA _____________ Number of errors in a point mutation _____________ 7. Original (template) DNA strand TACTGCCTTATACATTACGGGTTAGAGATC 8. Replicate the original strand of DNA into a complimentary strand of DNA _____________________________ 9. Transcribe the original strand of DNA into mRNA _____________________________ 10. Divide the above strand of mRNA into triplet codons 11. Identify the anticodons attached to the tRNA that will match with the codon on the RNA strand 12. Translate the codons into Amino acids 1. Original (template) DNA strand TACCCCCTTGGAATTCCAATTAGAGCTATC 2. Replicate the original strand of DNA into a complimentary strand of DNA _____________________________ 3. Transcribe the original strand of DNA into mRNA _____________________________ 4. Divide the above strand of mRNA into triplet codons 5. Identify the anticodons attached to the tRNA that will match with the codon on the RNA strand 6. Translate the codons into Amino acids