Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download CpG Island Methylation and Drug Resistance
Document related concepts
Transcript
Chapter 19 / CpG Island Methylation 19 359 CpG Island Methylation and Drug Resistance Jens M. Teodoridis, PhD and Robert Brown, PhD CONTENTS INTRODUCTION CPG ISLAND METHYLATION AND EPIGENETIC SILENCING ANALYSIS OF DNA METHYLATION ABERRANT CPG ISLAND DNA METHYLATION AND DRUG RESISTANCE INHIBITORS OF DNA METHYLATION CONCLUSIONS REFERENCES SUMMARY Covalent epigenetic modifications such as DNA hypermethylation and histone posttranslational modifications are associated with transcriptional inactivation of many genes and are important during tumor development and progression. Genes involved in key DNA damage response pathways, such as cell cycle control, apoptosis signaling, and DNA repair, can frequently become methylated and epigenetically silenced in tumors. This may lead to differences in intrinsic sensitivity of tumors to chemotherapy, depending on the specific function of the gene inactivated. Furthermore, chemotherapy itself can exert a selective pressure on epigenetically silenced drug sensitivity genes present in subpopulations of cells, leading to acquired chemoresistance. Since the DNA sequences of epigenetically inactivated genes are not mutated but rather subject to reversible modifications via DNA methyltransferases (DNMTs) or histone modification, it is possible to reverse silencing using small molecule inhibitors. Such compounds show antitumor activity and can increase the sensitivity of drug-resistant preclinical tumor models. Clinical trials of epigenetic therapies are now underway. Epigenetic profiling, using DNA methylation and histone analysis, will provide guidance on optimization of these therapies with conventional chemotherapy and will help identify patient populations who may particularly benefit from such approaches. Key Words: Methylation; epigenetics; DNMT; histones; CpG islands. 1. INTRODUCTION DNA methylation, the addition of a methyl group to the carbon 5 position of cytosine residues, is the only common covalent modification of human DNA and occurs almost exclusively at cytosines that are followed immediately by a guanine (so-called CpG dinucleotides). In the bulk of the genome, CpG dinucleotides are relatively rare and are From: Cancer Drug Discovery and Development: Cancer Drug Resistance Edited by: B. Teicher © Humana Press Inc., Totowa, NJ 359 360 Teodoridis and Brown nearly always methylated. By contrast, small stretches of DNA, known as CpG islands, are rich in CpG nucleotides and in normal cells, are nearly always methylation-free. These CpG islands are frequently associated with the promoter regions of human genes, and methylation within the islands has been shown to be associated with posttranslational modification of histones, chromatin condensation, and transcriptional inactivation of the associated gene. Aberrant methylation of CpG islands and transcriptional silencing is frequently observed in tumors compared to normal tissue. Moreover, methylation does not occur randomly, as certain CpG islands are consistently methylated in several tumor types, whereas other CpG islands are predominantly methylated in specific tumor types. This is consistent with a model in which methylation of CpG islands at particular genes gives the cancer cell a growth or survival advantage, and so, patterns of methylation emerge depending on the selective pressure for gene silencing in the tumor type examined. Genes involved in key DNA damage response pathways, such as cell cycle control, apoptosis signaling, and DNA repair, can frequently become epigenetically silenced and methylated in tumors. This may lead to differences in intrinsic sensitivity of tumors to chemotherapy, depending on the specific function of the gene inactivated. Furthermore, it is proposed that chemotherapy itself can exert a selective pressure on epigenetically silenced drug sensitivity genes present in subpopulations of cells, leading to acquired chemoresistance. Because the DNA sequence of epigenetically inactivated genes are not mutated, but rather subject to reversible modifications that can be targeted by therapies that inhibit DNA methyltransferases (DNMTs) or histone modification, it is possible to reverse epigenetic silencing using small molecules. Such inhibitors show antitumor activity and can increase the sensitivity of drug-resistant preclinical tumor models. Clinical trials of epigenetic therapies are now underway, and epigenetic profiling using DNA methylation and histone analysis will provide guidance on optimization of the use of these therapies with conventional chemotherapy, as well as helping to identify patient populations who may particularly benefit from such approaches. 2. CPG ISLAND METHYLATION AND EPIGENETIC SILENCING Epigenetic change can be defined as a stable change in gene expression inherited through subsequent cell divisions that is not because of a change in DNA sequence. The only known epigenetic modification of DNA itself is the transfer of a methyl group to the carbon 5 position of cytosines, usuall in the context of CpG dinucleotides. This reaction is catalyzed by members of the family of DNMTs: DNMT1, DNMT3a, and DNMT3b (1,2). Two major changes in DNA methylation commonly occur in cancer compared to normal tissue. First, cancer cells show genome-wide hypomethylation, which has been associated with chromosomal instabilities (3,4), as well as activation of normally silenced repetitive DNA elements (5). Secondly, de novo methylation of CpG islands, often associated with the promoters of genes, can occur throughout tumor development. It is estimated that in tumors there are on average 600 CpG islands aberrantly methylated compared to normal tissue, although this can vary widely between tumor types and within particular histological subtypes (6). Moreover, methylation does not occur randomly, as there are CpG islands that are methylated in multiple tumor types, whereas other CpG islands are methylated in certain tumor types (6,7). This is consistent with a model in which methylation of CpG islands at particular genes would give the cancer cell a growth or survival advantage, and so patterns of methylation emerge depending on the selective pressure for gene silencing in the tumor type examined. Chapter 19 / CpG Island Methylation 361 During carcinogenesis, most cancers need to develop certain hallmarks such as evasion of apoptosis, insensitivity to antigrowth signals, limitless replicative potential, selfsufficiency in growth signals, sustained angiogenesis, and tissue invasion (8). Many genes that are known to be methylated in cancers can affect these hallmarks of cancer (Table 1), and selection for loss of expression of these genes during tumor development can act as a driving force behind the epigenetic inactivation of specific genes. In addition to methylation and silencing of specific genes involved in tumorigenesis, it has been suggested that tumors may acquire a methylator phenotype (9). Thus, some genes may become methylated by chance and be subsequently coselected during tumor development despite having no immediate effect on tumor phenotype. However, such changes may influence subsequent behavior of the tumor by affecting biological properties, such as propensity to undergo invasion and metastasis, or acquisition of drug resistance. 3. ANALYSIS OF DNA METHYLATION Originally, the methylation state of individual genes was determined by comparing restriction digests of DNA using methylation sensitive or insensitive isoschizomeres, e.g., HpaII and MspI, and subsequent Southern blotting. Size differences of detected bands indicated methylation at the recognition sites of the restriction enzymes. (For a detailed overview of this and other methods, see ref. 10). This approach has been largely replaced by methods based on bisulfite modification of DNA for which reaction parameters have been described in detail (11,12). Bisulfite treatment of DNA converts unmethylated cytosines into uracils but does not affect methylated cytosines, thereby converting differences in methylation into differences in sequence. One method of analyzing such changes in sequence is methylation-specific polymerase chain reaction ([PCR] MSP) (13). MSP is performed using primers specific for either unmethylated or methylated sequences, thereby allowing the detection of the respective methylation state. (A list of cancer-relevant genes and the primers used is given in Table 1.) Among the advantages of MSP are the simple experimental procedure, the easy signal detection because of its gain-of-signal character, and its high sensitivity, allowing the detection of as little as 0.1% methylation in a DNA sample (13). On the other hand, combined bisulfite restriction analysis (COBRA) uses primers that amplify the template following bisulfite modification, irrespective of its methylation state (14). The PCR product should therefore be heterogeneous and reflect the various methylation states represented in the template. Discrimination of methylation states is achieved by restriction digest using a restriction site whose presence depends on the methylation state of the DNA. COBRA allows the quantification of the methylation, but its disadvantage is that the methylation of one CpG site is not necessarily representative for the methylation state of other CpG sites within the analyzed sequence, and that not all CpG sites can be analyzed with this technique. The highest resolution of the methylation status of a DNA region is achieved by bisulfite sequencing (15). Following bisulfite modification, the DNA is amplified irrespective of its methylation state as in COBRA, but subsequently, methylation at all CpG sites is determined by cloning and sequencing of the PCR product. This method allows determination of methylation at single-nucleotide resolution but is relatively labor-intensive and time-consuming. Analysis of DNA methylation is also possible on the genome-wide level. Restriction landmark genomic scanning is performed by digesting genomic DNA with the methyla- APAF-1 Regulation of apoptosis 362 TMS1 SHP1 p73 p53 p14ARF Fas DLC-1 DcR2 DcR1 DAPK CASP8 BNIP3 Protein affected Function TTTCGGGTAAAAGGGATAGAATTAGA TATAACGCCCTTCCCCCGACGACG TAGGATTCGTTTCGCGTACG ACCGCGTCGCCCATTAACCGCG TAGGGGATTCGGACATTGCGA CGTATATCTACATTCGAAACGA GGATAGTCGGATCGAGTTAACGTC CCCTCCCAACAGCGCA TTACGCGTACGAATTTAGTTAAC ATCAACGACCGACCGAAACG GGGATAAAGCGTTTCGATC CGACAACAAAACCGCG CCCAACGAAAAAACCCGACTAACG TTTAAAGATCGAAACGAGGGAGCG AGAAAGGGTAGGAGGTCG ATCACTCTTACGCGAAATC GTGTTAAAGGGCGGCGTAGC AAAACCCTCACTCGCGACGA TTATAGTTTTGGTTTGTAGAAT TAACTCAAAAAAAACTCATCAA TTTTTATTTTAAAATGTTAGTA ATCAAATTCAATCAAAAACTTA GGACGTAGCGAAATCGGGGTTC ACCCCGAACATCGACGTCCG GAACGTTATTATAGTATAGCGTTC TCACGCATACGAACCCAAACG TTGTAGCGGGGTGAGCGGC AACGTCCATAAACAACAACGCG Primers (5'3') Table 1 Primers Used in Studies of Methylation States of Genes MSP MSP MSP NaBis MSP MSP MSP MSP MSP MSP MSP MSP MSP b Methoda (75) (74) (73) (72) (71) (70) (69) (68) (68) (67) (66) (65) (35) Reference 362 Teodoridis and Brown Insensitivity to antigrowth Signals 363 RARβ2 PTEN Pax5β Pax5α p57KIP2 p16INK4 a p15INK4b LOT1 CyclinD2 CRBP1 XAF1 WIF-1 TRAIL-R1 GAGCGTAGCGAGTGGGATAGAG CCGAACCCGAACACTAAATCCG GGGCGTTTTATTGGGCGTAT AAACCAACAATCAACGAAC GTTTAGGTTGGAGTGTAGTGG CATATTCTACTCTCTACAAAC TTGGGAATTTAGTTGTCGTCGTTTC AAACAACGACTACCGATACTACGCG TACGTGTTAGGGTCGATCG CGAAATATCTACGCTAAACG GGGGTAGTCGTGTTTATAGTTTAGTA CGAACACCCAAACACCTACCCTA ATAGTTTAGTAGCGCGGGGT CCTACCCTACGAAACGACGA GCGTTCGTATTTTGCGGTT CGTACAATAACCGAACGACCGA TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TTTCGTTTGTAGATAAAGGA CTAACTATCCGATAATAAACTCTTCTA GGGGGTGGGGAGTGTTGT ATATTTTCAATTTCAACAACACCA GGGTTTGTATATGGAGATGTTATAGG CAACATCACAAAATATCCCCAAACAC ATAAAAGTTTGGGGCGGCGC GCGCCCCCAACGCGCCG AGTTTGTGGGTTGTTTAGTTAATGG CAAAAAATCCCAACCACCAAAACC GAGTTGAGTTTCGGGCGGC GCCGCCGCCGCCGTCG TTCGTTCGTCGTCGTCGTATTT GCCGCTTAACTCTAAACCGCAACCG TGTCGAGAACGCGAGCGATTC CGACCAATCCAACCGAAACGA c MSP MSP MSPc MSP NaBis MSP MSP b b NaBis MSP MSP NaBis MSP MSP (continued) (78) (83) (82) (82) (81) (13) (13) (80) (79) (78) (77) (76) (70) Chapter 19 / CpG Island Methylation 363 364 Intercellular adhesion and tissue invasion Angiogenesis Limitless replicative potential Function CGAGAGCGCGTTTAGTTTCGTT CGATTAAACCCGTACTTCGCTAA TGGTAGTTTTTATGAAAGGCGTC CCTCTAACCGCCCACCACG TTGTTTTTTATTTTAAGTTGGTTATTG AAAAATAAACTAACCAAAACCTAAAAA TTATTTTTTTTAGGTTTTGGTTAGTT CCACCCAAACCTTTTATAACTC GACGTAAAGTTTTTTTCGGACG ACCCGATACGCTACCGAACG GGGAGTTTCGCGGACGTGAC ACGTCGAAACACGCCCCG TTCGCGTGTATTTTTAGGTCGGTC CGACACAACTCCTACAACGACCG TATATATTCGCGAGCGCGGTTT CGCTGCGCCCAGATGTT GGAGAGAGGAGTTTAGATTGGTT AATAAAAATTACTCCTAAAAAAC TGTATATTTTGATTTGGGA TTACCAACATTTATCTCAAAC GGGTGATGTTTGAGGTGTGGGAG CAAATCCCCTTAATACACACTT TGGAGGATTTTTTTGCGTACGC GAACCGAACGCCGCGAA TTTGTTTTGGATAAATTAAGGTTA CTACAAAAATCAAAACTAAATCTC GTATGTAAATATAAAGGATTGTAG ATAAAAATATATCCTCCTAAATAT TTAGGTTAGAGGGTTATCGCGT TAACTAAAAATTCACCTACCGAC RASSF1A E-Cadherin ADAM23 VHL THBS2 THBS1 SOCS-3 SOCS-1 pRb hTR CDX1 14-3-3σ Primers (5'3') Protein affected Table 1 (Continued) Primers Used in Studies of Methylation States of Genes d b MSP NaBis MSP COBRA COBRA MSP MSP MSP MSP NaBis MSP MSP Methoda b (13) (49) (13) (91) (90) (89) (88) (87) (86) (52) (85) (84) Reference 364 Teodoridis and Brown 365 DNA repair MSH2 MLH1 MGMT FancF BRCA1 TIMP3 SLIT2 OPCML Maspin LAMC2 LAMB3 LAMA3 CLDN-7 CLCA2 Cav-1 H-Cadherin TCGCGGGGTTCGTTTTTCGC MSP GACGTTTTCATTCATACACGCG GGTATTTTTGTAGGCGCGTC MSP CTAACAACAAAAAACGAAAAACG GGGATTTATTATTGTTTTTATTTTTAGAT NaBis ATCTACCCACTATAATACCCCCTAC GACGTTAGGTTATTTTCGGTC MSP AAACGCGTTTCTAAACGCCG TATAGGAATTATAGAGCGGTGC MSP CCTAAACGTCCGCTAACTACG ATCGATTAATTTATTTGTTTAGTTTC MSP GAATCTCAAAAATCTAACAACCG AGGTGTGCGTTTTTTTCGTTGC MSP TACAAAAATCGCTACCCGACG AAAAGAATGGAGATTAGAGTATTTTTTGTG NaBis CCTAAAATCACAATTATCCTAAAAAATA GCGCGGTGCGGGTTTATTTTC MSP TCCCGATACCGCCTCGAAACGAACG GGGAGGTGGGATTGTTTAGATATTT NaBis CAAAAACTCCTTAAACAACTTTAAATCCTAAAA CGTTTCGTTATTTTTTGTTTTCGGTTTC MSP CCGAAAACCCCGCCTCG GAGTTTCGAGAGACGTTTGG MSP AATCTCAACGAACTCACGCC TTTTTGCGTTTGTTGGAGAATCGGGTTTTC MSP ATACACCGCAAACCGCCGACGAACAAAACG TTTCGACGTTCGTAGGTTTTCGC MSP GCACTCTTCCGAAAACGAAACG ACGTAGACGTTTTATTAGGGTCGC MSP CCTCATCGTAACTACCCGCG TCGTGGTCGGACGTCGTTC MSP CAACGTCTCCTTCGACTACACCG (continued) (98) (98) (67) (26) (86) (97) (96) (51) (50) (95) (95) (95) (94) (93) (92) (53) Chapter 19 / CpG Island Methylation 365 366 RFC MDR GTTAGTTGGGGTTAGGTTGAG CATAACCTAACTACCTACCTCC TTCGGGGTGTAGCGCTCGTC GCCCCAATACTAAATCACGACG CTCTCTAAACCCGCGAACGAT TTGGGGGTTTGGTAGCGC CCGAATCGCAAATACCGATAAAAAACG GGTTTTGTAAATTTCGGTTCGC Primers (5'3') MSP MSP MSP NaBis Methoda bTwo methylation specific polymerase chain reaction (PCR); NaBis, bisulfite sequencing; COBRA, combined restriction analysis. rounds of PCR, first round of amplification with upper primer pair, second round with lower primer pair (italics). cNested amplification, first round with methylation unspecific primers, second round with methylation specific primers (italics). dBisulfite sequencing was performed on two overlapping PCR products. aMSP, CytP4501A1 Drug metabolism, detoxification GSTp1 Protein affected Function Table 1 (Continued) Primers Used in Studies of Methylation States of Genes (101) (101) (100) (99) Reference 366 Teodoridis and Brown Chapter 19 / CpG Island Methylation 367 tion-sensitive restriction enzyme NotI, end-labeling of the resulting DNA fragments, and subsequent digest with two different restriction enzymes and two-dimensional gel electrophoresis (6). Comparison of signal intensities between tumor and normal DNA after autoradiography allows estimation of the number of aberrantly methylated CpG islands in tumor samples, and individual aberrantly methylated CpG islands can be identified by sequencing. Differential methylation hybridization is an alternative means of examining genome-wide methylation patterns that uses restriction digest of genomic DNA and ligation to linkers (16), followed by digestion with a methylation-sensitive restriction enzyme such as BstUI, PCR amplification, and hybridization to arrayed CpG-rich DNA sequences (representing putative CpG islands). Comparison to hybridization signals obtained from undigested linker-ligated DNA allows the identification of aberrantly methylated CpG islands. 4. ABERRANT CPG ISLAND DNA METHYLATION AND DRUG RESISTANCE 4.1. DNA Methylation and Intrinsic Drug Resistance Variations in patterns of CpG island methylation can occur within the same tumor types. For example, late-stage ovarian cancers can be clustered using unsupervised hierarchical clustering into two groups based on differences in CpG island methylation (17). Increased methylation of a subset of CpG islands in these tumors significantly correlated with worse clinical outcome, as defined by the time of clinical disease recurrence after chemotherapy (17). These types of studies raise the possibility of using methylation profiling to identify which patients may benefit more from existing treatments, or identifying patient populations likely to be suitable for clinical trials of novel agents that target epigenetic mechanisms. Although identification of methylation of CpG islands as prognostic markers at clinical presentation of a patient’s tumor has potential for molecular classification of tumor pathology, this does not demonstrate an involvement of DNA methylation in drug resistance. However, a number of recent studies suggest a direct role for epigenetic inactivation of genes, especially those with a role in cellular drug response, in determining tumor chemosensitivity. The DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT) removes mutagenic alkyl groups from the O6 position of guanine, which could otherwise lead to G to A transitions after DNA replication (18). The level of MGMT expression is proportional to the resistance of cells to cyclophosphamide in xenografts (19), and glioma cells with reduced MGMT expression are more sensitive to alkylating agents (20,21). Epigenetic inactivation of the mgmt gene is frequently observed in colorectal cancer and gliomas (22). Methylation of a CpG island in the mgmt promoter is an independent predictor of longer survival for glioblastoma patients treated with a methylating agent (temozolomide), in addition to radiation, in a prospective study (23). Hypermethylation of the mgmt promoter also correlated with increased survival of patients with diffuse large B-cell lymphoma after chemotherapy that included cyclophosphamide (24). Fanconi anemia, complementation group F (FANCF) is crucial for the activation of a DNA repair complex containing BRCA1 and BRCA2. Inactivation of this pathway results in a decreased ability to repair DNA damage and an increased susceptibility to develop cancer (25). In ovarian cancer cell lines, methylation of the fancf gene was observed in cells with a defective BRCA2 pathway and increased sensitivity to cisplatin. Treatment with 2′-deoxy-5-azacytidine led to demethylation of the fancf gene and reduced sensitivity towards cisplatin in these cell line models (26). Methylation of the 368 Teodoridis and Brown fancf gene has also been observed in ovarian cancer (26), acute myeloid leukemia (27), and lung and head and neck cancers (28), although the relevance for clinical outcome, following chemotherapy, of methylation of fancf is still to be established. A two-step model for the role of the fancf gene in tumorigenesis and acquired chemoresistance has been proposed (26). According to this model, epigenetic inactivation of fancf is an early event in tumor progression, but subsequent chemotherapy selects for cells in which the fancf methylation was reversed and which therefore display higher resistance to platinum-based chemotherapy. In contrast to the above, where methylation of DNA repair genes during tumor development is proposed to lead to drug sensitivity, methylation of proapoptotic genes could lead to drug resistance. Many proapoptotic genes can become aberrantly methylated in tumors during tumor development (see Table 1). For instance, methylation of the DNA mismatch repair gene human mutL homologue 1 (hMLH1) and transcriptional silencing occurs in cisplatin-resistant ovarian cell line models. MLH1 has been shown to be necessary for engagement of a variety of downstream cellular responses to alkylating agent and cisplatin-induced DNA damage (29,30). It has been argued that because mismatch repair (MMR) proteins can recognize and bind to certain types of damage in DNA, that this is necessary for MMR-dependent engagement of DNA damage responses such as activation of p53, p73, and other downstream apoptosis-signaling pathways (30–32). Hence, loss of MLH1 expression may lead to reduced engagement of apoptosis either because of reduced cycles of futile repair (33) or reduced stalling (or increased bypass) of lesions in DNA during DNA replication (34). Apoptotic protease activating factor 1 (apaf1) represents another gene whose methylation may lead to increased resistance to chemotherapy (35,36). Methylation of apaf1 in melanoma cells can be reversed be DNMT inhibitors, leading to increased apaf1 transcription and increased doxorubicin-induced apoptosis (36). Apaf-1 is an adapter molecule that binds to and promotes procaspase 9 activation in the presence of cytochrome c. The release of mature caspase 9 activates a caspase cascade required for apoptosis (37,38). Thus, apaf1 is only one of a network of apoptotic and antiapoptotic genes whose expression can influence sensitivity to chemotherapy (39). Methylation of other members of this network and caspase cascade have the potential to influence apoptosis and hence, chemosensitivity. For instance, caspase 8 is frequently methylated in tumors and again demethylating agents can induce gene reexpression, increased apoptosis, and chemosensitization (40). It can be seen from the above discussion that there is growing evidence for a potential role of CpG island methylation of genes with a known direct role in drug responses in predicting clinical outcome following chemotherapy. However, there is a need for large, appropriately powered prospective studies to fully validate these initial hypotheses, generating studies and demonstrating the potential to use methylation patterns of known or unknown genes to identify which patients may benefit from particular chemotherapeutic regimes or are appropriate for novel agents that target aberrant methylation. Given the potential of opposing effects depending on which genes are methylated, e.g., methylation of DNA repair genes such as mgmt and fancf conferring sensitivity, whereas methylation of proapoptotic genes such as hMLH1 and apaf1 would confer resistance, it will be important to examine whether particular methylation events are dominant in conferring resistance and whether these markers are independent from each other in clinical studies. Chapter 19 / CpG Island Methylation 369 4.2. CpG Island Methylation and Acquired Drug Resistance Most clinical studies of drug resistance have focused on tumor characteristics at presentation, rather than at relapse. Whereas studies of tumors prechemotherapy are important for identifying prognostic markers and possible mechanisms of intrinsic resistance, they will provide limited information on mechanisms of acquired resistance. Thus, tumors at presentation will be heterogeneous, consisting of chemosensitive and resistant subpopulations, making it difficult to identify the subpopulations that lead to treatment failure of an initially responsive tumor. If the hypothesis is correct that chemotherapy positively selects for resistant subpopulations, analysis of tumors at relapse may allow these subpopulations of cells to become more apparent, and will allow mechanisms of acquired, rather than intrinsic, drug resistance to be identified and analyzed for associations with patient survival. Matched cell line models of acquired resistance have shown that common patterns of CpG island methylation can be identified as being selected for by chemotherapy in vitro (41). Acquired methylation of specific candidate CpG islands, such as at the hMLH1 gene, also can be selected for in vitro (42). However, so far the potential role for acquired methylation of CpG islands in matched tumors before and after chemotherapy from the same patient has not been examined. This is partly because of the difficulties in obtaining tumor samples routinely from patients postchemotherapy or at relapse. In order to overcome this practical difficulty, there has been increasing interest in the use of markers in plasma for the prognostication and monitoring of cancer (43). DNA can be detected in plasma from cancer patients with the same characteristic changes, including CpG island methylation, found in the corresponding tumor (44). DNA methylation is particularly suited for such analysis of plasma DNA, because sensitive methylation-specific PCRbased assays require only small amounts of DNA, and methylation of genes frequently aberrantly methylated in tumors is rarely observed in normal tissue, including peripheral blood mononuclear cell DNA that may be present with tumor DNA in plasma (45). Nevertheless, such analysis will have limited sensitivity, as not all patients may have detectable tumor DNA in plasma. Recently, we have examined plasma DNA of patients with epithelial ovarian cancer enrolled in the SCOTROC1 phase III clinical trial for methylation of the hMLH1 CpG island before carboplatin/taxoid chemotherapy and at relapse (46). Methylation of hMLH1 is increased at relapse, with 25% (34/138) of relapse samples having hMLH1 methylation that is not detected in matched prechemotherapy plasma samples. Furthermore, hMLH1 methylation is significantly associated with increased microsatellite instability in plasma DNA at relapse, providing an independent measure of function of the MMR pathway. Acquisition of hMLH1 methylation in plasma DNA at relapse predicts poor overall survival of patients, independent from time to progression and age (HR1.99, 95% CI 1.20–3.30, p = 0.007). These data support the clinical relevance of acquired hMLH1 methylation, and concomitant loss of DNA mismatch repair, following chemotherapy of ovarian cancer patients. 5. INHIBITORS OF DNA METHYLATION Several small molecule inhibitors of DNA methylation that are derivatives of 2′deoxycytidine are known (47), e.g., 5-aza-2′-deoxycytidine (decitabine), 5-azacytidine arabinosyl-5-azacytosine, and diyhdro-5-azacytidine. Demethylating agents have been 370 Teodoridis and Brown proposed to have antitumor properties, because they can activate the expression of epigenetically silenced genes including tumor suppressor genes (48–53). However, in addition, these demethylating agents can restore sensitivity to a range of chemotherapeutic agents including cisplatin, epirubicin, and temozolomide (42,54). These nucleoside DNMT inhibitors are phosphorylated to their nucleotide analogs before being incorporated into DNA. Once incorporated into DNA, they complex with, and inactivate, all three forms of DNA methyltransferases. Nucleoside DNMT inhibitors have been reported to have antitumor activity, especially against hematologic malignancies (55). Like many other novel therapeutics currently being developed against specific targets, demethylating agents are hoped to function in a specific manner, and thus have less side effects than the nonspecific conventional chemotherapy, by reversing repression of tumor suppressor and cell cycle genes aberrantly methylated in tumor cells, leading to inhibition of tumor growth (56). An important consequence of this is that, unlike conventional cytotoxic agents, it may be best to use such drugs at concentrations lower than the maximum tolerated dose. For example, there is an optimal concentration at which analogs of 5-azacytosine induce cellular differentiation; higher concentrations produce less differentiation and more cytotoxicity (57). Thus, in the case of decitabine, although its use at high doses may induce direct toxicity effects because of its incorporation into DNA, prolonged low-dose schedules (58) or low doses in combinations with other drugs (54) may be more biologically effective in inhibiting DNMT activity with less toxicity. The combination of decitabine and cisplatin showed a synergistic cytotoxic interaction in many human tumor cell lines. Although a possible underlying mechanism originally suggested is the increased binding of cisplatin to decitabine-substituted DNA that is independent of DNA hypomethylation (59), more-recent studies have focused on the effects of decitabine in reactivating drug sensitivity genes (54). Decitabine was used in vivo to sensitize MMR-deficient, drug-resistant ovarian (A2780/cp70) and colon (SW48) tumor xenografts that are MLH1-negative because of gene promoter hypermethylation. Treatment of tumor-bearing mice with the demethylating agent decitabine at a nontoxic dose induces MLH1 expression, and reexpression of MLH1 was associated with a decrease in hMLH1 gene promoter methylation. Decitabine treatment alone had no effect on the growth rate of the tumors. However, decitabine treatment sensitized the xenografts to cisplatin, carboplatin, temozolomide, and epirubicin, although this was schedule dependent with decitabine having to be given at least 6 d before the cytotoxic. Decitabine treatment did not sensitize xenografts of HCT116, which lacks MMR because of hMLH1 mutation, or A2780/cp70 that reexpressed MLH1 because of chromosome transfer. The human multidrug resistance gene 1 (MDR1) encodes P-glycoprotein, a transmembrane protein that acts as a drug efflux pump, reducing intracellular levels of certain anticancer drugs and thus reducing their effectiveness. Increased transcription of the MDR1 gene in chronic lymphocytic leukemia and bladder cancer following chemotherapy has been shown to be associated with decreased methylation. This would argue that treatment of sensitive tumors with a demethylating agent could lead to resistance to chemotherapy by increased expression of MDR1. Indeed, increased resistance of tumor cells after treatment with azacytidine analogs to drugs that are substrates of P-glycoprotein has been observed (60). However, increased sensitization and no effect has also been reported to be induced by DNMT inhibitors for MDR-drugs in different tumor models (54,61,62). This again emphasizes the possibility that these agents will have different effects depending on the pattern of genes methylated in a given tumor and argues that patient stratification depending on their methylation status may be necessary in clinical trials of demethylating agents. Chapter 19 / CpG Island Methylation 371 6. CONCLUSIONS There is accumulating evidence that aberrant CpG island methylation is a clinically relevant driving force behind gene-silencing events that have potential to alter intrinsic and acquired resistance to anticancer drugs. Epigenetic inactivation of genes occurs at a much higher rate than gene mutation (63). Multiple genes, and hence, multiple resistance mechanisms, have the potential to become simultaneously inactivated as tumors acquire methylation of multiple CpG islands. CpG methylation either of specific genes or global patterns has the potential to be used as predictive or prognostic markers (64), but further clinical studies are necessary to substantiate their significance. Methods for the analysis of the methylation states of specific CpG islands and global methylation states exist and have potential to define further patient populations, and in the next 5 yr, DNA methylation patterns will probably become increasingly important in the management of cancer patients. DNA methylation is being examined as a means of early diagnosis of cancer and, the detection of methylation in DNA isolated from body fluids of cancer patients could provide a noninvasive means of diagnosis (46). Small molecules that allow reversal of aberrant epigenetic modifications are now entering clinical trials. Nucleoside DNMT inhibitors, such as decitabine, have been reported to have antitumor activity, especially against hematologic malignancies. Such demethylating agents have been proposed to reactivate tumor suppressor genes aberrantly methylated in tumor cells, leading to inhibition of tumor growth because of induction of apoptosis or differentiation. An important consequence of this is that, unlike conventional cytotoxic agents, it may be best to use such drugs at concentrations lower than the maximum tolerated dose and in a manner dependent on their demethylating activity. Furthermore, synergistic activity with other types of investigational epigenetic therapies and existing chemotherapies opens the possibility of rational combinations and scheduling of these agents based on their biological activity. Perhaps the combination of epigenetic drugs with existing therapies holds the greatest promise in their clinical use, particularly if prospective studies continue to support CpG island methylation as a clinically relevant mechanism of resistance to chemotherapy. Epigenetic silencing does recur over time in cells where reexpression has been induced by treatment with DNMT inhibitors. Therefore, there is only a specific window of time within which tumor cells will die because of epigenetic reversal of silencing of tumor suppressor genes and subsequent apoptosis or differentiation. However, this window of demethylation can be used for appropriate scheduling of a cytotoxic or other treatment. The ideal scenario will be to have robust means of identifying CpG island methylation and to provide a personalized treatment for that patient based on the methylation profile. REFERENCES 1. Liu K, Wang YF, Cantemir C, Muller MT. Endogenous assays of DNA methyltransferases: evidence for differential activities of DNMT1, DNMT2, and DNMT3 in mammalian cells in vivo. Mol Cell Biol 2003; 23:2709–2719. 2. Bird AP, Wolffe AP. Methylation-induced repression—belts, braces, and chromatin. Cell 1999; 99(5):451–454. 3. Eden A, Gaudet F, Waghmare A, Jaenisch R. Chromosomal instability and tumors promoted by DNA hypomethylation. Science 2003; 300:455. 4. Gaudet F, Hodgson JG, Eden A, et al. Induction of tumors in mice by genomic hypomethylation. Science 2003; 300:489–492. 5. Walsh CP, Chaillet JR, Bestor TH. Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat Genet 1998; 20:116–117. 372 Teodoridis and Brown 6. Costello JF, Fruhwald MC, Smiraglia DJ, et al. Aberrant CpG-island methylation has non-random and tumor-type-specific patterns. Nat Genet 2000; 24:132–138. 7. Esteller M, Herman JG. Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. J Pathol 2002; 196:1–7. 8. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000; 100:57–70. 9. Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB, Issa JP. CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A 1999; 96:8681–8686. 10. Dahl C, Guldberg P. DNA methylation analysis techniques. Biogerontology 2003; 4:233–450. 11. Warnecke PM, Stirzaker C, Song J, Grunau C, Melki JR, Clark SJ. Identification and resolution of artifacts in bisulfite sequencing. Methods 2002; 27:101–107. 12. Grunau C, Clark SJ, Rosenthal A. Bisulfite genomic sequencing: systematic investigation of critical experimental parameters. Nucleic Acids Res 2001; 29:E65–E65. 13. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996; 93:9821–9826. 14. Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res 1997; 25:2532–2534. 15. Frommer M, McDonald LE, Millar DS, et al. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 1992; 89:1827–1831. 16. Huang TH, Perry MR, Laux DE. Methylation profiling of CpG islands in human breast cancer cells. Hum Mol Genet 1999; 8:459–470. 17. Wei SH, Chen CM, Strathdee G, et al. Methylation microarray analysis of late-stage ovarian carcinomas distinguishes progression-free survival in patients and identifies candidate epigenetic markers. Clin Cancer Res 2002; 8:2246–2252. 18. Gerson SL. MGMT: its role in cancer aetiology and cancer therapeutics. Nat Rev Cancer 2004; 4:296–307. 19. Mattern J, Eichhorn U, Kaina B, Volm M. O6-methylguanine-DNA methyltransferase activity and sensitivity to cyclophosphamide and cisplatin in human lung tumor xenografts. Int J Cancer 1998; 77:919–922. 20. Silber JR, Bobola MS, Ghatan S, Blank A, Kolstoe DD, Berger MS. O6-methylguanine-DNA methyltransferase activity in adult gliomas: relation to patient and tumor characteristics. Cancer Res 1998; 58:1068–1073. 21. Silber JR, Blank A, Bobola MS, Ghatan S, Kolstoe DD, Berger MS. O6-methylguanine-DNA methyltransferase-deficient phenotype in human gliomas: frequency and time to tumor progression after alkylating agent-based chemotherapy. Clin Cancer Res 1999; 5:807–814. 22. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation of the DNA repair gene O6methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 1999; 59:793–797. 23. Hegi ME, Diserens AC, Godard S, et al. Clinical trial substantiates the predictive value of O6methylguanine-DNA methyltransferase promoter methylation in glioblastoma patients treated with temozolomide. Clin Cancer Res 2004; 10:1871–1874. 24. Esteller M, Gaidano G, Goodman SN, et al. Hypermethylation of the DNA repair gene O-methylguanine DNA methyltransferase and survival of patients with diffuse large B-cell lymphoma. J Natl Cancer Inst 2002; 94:26–32. 25. Olopade OI, Wei M. FANCF methylation contributes to chemoselectivity in ovarian cancer. Cancer Cell 2003; 3:417–420. 26. Taniguchi T, Tischkowitz M, Ameziane N, et al. Disruption of the Fanconi anemia-BRCA pathway in cisplatin-sensitive ovarian tumors. Nat Med 2003; 9:568–574. 27. Tischkowitz M, Ameziane N, Waisfisz Q, et al. Bi-allelic silencing of the Fanconi anaemia gene FANCF in acute myeloid leukaemia. Br J Haematol 2003; 123:469–471. 28. Marsit CJ, Liu M, Nelson HH, Posner M, Suzuki M, Kelsey KT. Inactivation of the Fanconi anemia/ BRCA pathway in lung and oral cancers: implications for treatment and survival. Oncogene 2004; 23:1000–1004. 29. Papouli E, Cejka P, Jiricny J. Dependence of the cytotoxicity of DNA-damaging agents on the mismatch repair status of human cells. Cancer Res 2004; 64:3391–3394. 30. Stojic L, Mojas N, Cejka P, et al. Mismatch repair-dependent G2 checkpoint induced by low doses of SN1 type methylating agents requires the ATR kinase. Genes Dev 2004; 18:1331–1344. Chapter 19 / CpG Island Methylation 373 31. Shimodaira H, Yoshioka-Yamashita A, Kolodner RD, Wang JY. Interaction of mismatch repair protein PMS2 and the p53-related transcription factor p73 in apoptosis response to cisplatin. Proc Natl Acad Sci U S A 2003; 100:2420–2425. 32. Duckett DR, Bronstein SM, Taya Y, Modrich P. hMutSα and MutLα dependent phosphorylation of p53 in response to DNA methylator damage. Proc Natl Acad Sci U S A 1999; 96:12,384–12,388. 33. Karran P, Hampson R. Genomic instability and tolerance to alkylating agents. Cancer Surveys 1996; 28:69–85. 34. Moreland NJ, Illand M, Kim YT, Paul J, Brown R. Modulation of drug resistance mediated by loss of mismatch repair by the DNA polymerase inhibitor aphidicolin. Cancer Res 1999; 59:2102–2106. 35. Fu WN, Bertoni F, Kelsey SM, et al. Role of DNA methylation in the suppression of Apaf-1 protein in human leukaemia. Oncogene 2003; 22:451–455. 36. Soengas MS, Capodieci P, Polsky D, et al. Inactivation of the apoptosis effector Apaf-1 in malignant melanoma. Nature 2001; 409:207–211. 37. Slee EA, Adrain C, Martin SJ. Serial killers: ordering caspase activation events in apoptosis. Cell Death Differ 1999; 6:1067–1074. 38. Saleh A, Srinivasula SM, Acharya S, Fishel R, Alnemri ES. Cytochrome c and dATP-mediated oligomerization of Apaf-1 is a prerequisite for procaspase-9 activation. J Biol Chem 1999; 274:17,941–17,945. 39. Pommier Y, Sordet O, Antony S, Hayward RL, Kohn KW. Apoptosis defects and chemotherapy resistance: molecular interaction maps and networks. Oncogene 2004; 23:2934–2949. 40. Fulda S, Kufer MU, Meyer E, van Valen F, Dockhorn-Dworniczak B, Debatin KM. Sensitization for death receptor- or drug-induced apoptosis by re-expression of caspase-8 through demethylation or gene transfer. Oncogene 2001; 20:5865–5877. 41. Wei SH, Brown R, Huang TH. Aberrant DNA methylation in ovarian cancer: is there an epigenetic predisposition to drug response? Ann N Y Acad Sci 2003; 983:243–250. 42. Strathdee G, MacKean M, Illand M, Brown R. A role for methylation of the hMLH1 promoter in loss of hMLH1 expression and drug resistance in ovarian cancer. Oncogene 1999; 18:2335–2341. 43. Johnson PJ, Lo YMD. Plasma nucleic acids in the diagnosis and management of malignant disease. Clinical Chemistry 2002; 48:1186–1193. 44. Esteller M, Sanchez-Cespedes M, Rosell R, Sidransky D, Baylin SB, Herman JG. Detection of aberrant promoter hypermethylation of tumour suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res 1999; 59:67–70. 45. Toyota M, Kopecky KJ, Toyota MO, Jair KW, Willman CL, Issa JP. Methylation profiling in acute myeloid leukemia. Blood 2001; 97:2823–2829. 46. Gifford G, Paul J, Vasey PA, Kaye SB, Brown R. The acquisition of hMLH1 methylation in plasma DNA after chemotherapy predicts poor survival for ovarian cancer patients. Clin Cancer Res 2004; 10:4420–4426. 47. Goffin J, Eisenhauer E. DNA methyltransferase inhibitors-state of the art. Ann Oncol 2002; 13:1699–1716. 48. Arnold CN, Goel A, Boland CR. Role of hMLH1 promoter hypermethylation in drug resistance to 5-fluorouracil in colorectal cancer cell lines. Int J Cancer 2003; 106:66–73. 49. Costa FF, Verbisck NV, Salim AC, et al. Epigenetic silencing of the adhesion molecule ADAM23 is highly frequent in breast tumors. Oncogene 2004; 23:1481–1488. 50. Domann FE, Rice JC, Hendrix MJ, Futscher BW. Epigenetic silencing of maspin gene expression in human breast cancers. Int J Cancer 2000; 85:805–810. 51. Sellar GC, Watt KP, Rabiasz GJ, et al. OPCML at 11q25 is epigenetically inactivated and has tumorsuppressor function in epithelial ovarian cancer. Nat Genet 2003; 34:337–343. 52. Suh ER, Ha CS, Rankin EB, Toyota M, Traber PG. DNA methylation down-regulates CDX1 gene expression in colorectal cancer cell lines. J Biol Chem 2002; 277:35,795–35,800. 53. Toyooka KO, Toyooka S, Virmani AK, et al. Loss of expression and aberrant methylation of the CDH13 (H-cadherin) gene in breast and lung carcinomas. Cancer Res 2001; 61:4556–4560. 54. Plumb JA, Strathdee G, Sludden J, Kaye SB, Brown R. Reversal of drug resistance in human tumor xenografts by 2′-deoxy-5-azacytidine-induced demethylation of the hMLH1 gene promoter. Cancer Res 2000; 60:6039–6044. 55. Lyons J, Bayar E, Fine G, et al. Decitabine: development of a DNA methyltransferase inhibitor for hematological malignancies. Curr Opin Investig Drugs 2003; 4:1442–1450. 56. Issa JP. Decitabine. Curr Opin Oncol 2003; 15:446–451. 57. Taylor SM, Jones PA. Multiple new phenotypes induced in 10T2 and 3T3 cells treated with 5-azacytidine. Cell 1979; 17:771–779. 374 Teodoridis and Brown 58. Issa JP, Garcia-Manero G, Giles FJ, et al. Phase 1 study of low-dose prolonged exposure schedules of the hypomethylating agent 5-aza-2′-deoxycytidine (decitabine) in hematopoietic malignancies. Blood 2004; 103:1635–1640. 59. Ellerhorst JA, Frost P, Abbruzzese JL, Newman RA, Chernajovsky Y. 2′-deoxy-5-azacytidine increases binding of cisplatin to DNA by a mechanism independant of DNA hypomethylation. British Journal of Cancer 1993; 67:209–215. 60. Kantharidis P, El-Osta A, deSilva M, et al. Altered methylation of the human MDR1 promoter is associated with acquired multidrug resistance. Clin Cancer Res 1997; 3:2025–2032. 61. Efferth T, Futscher BW, Osieka R. 5-Azacytidine modulates the response of sensitive and multidrugresistant K562 leukemic cells to cytostatic drugs. Blood Cells Mol Dis 2001; 27:637–648. 62. Ando T, Nishimura M, Oka Y. Decitabine (5-aza-2′-deoxycytidine) decreased DNA methylation and expression of MDR-1 gene in K562/ADM cells. Leukemia 2000; 14:1915–1920. 63. Bhattacharyya NP, Skandalis A, Ganesh A, Groden J, Meuth M. Mutator phenotypes in human colorectal carcinoma cell lines. Proc Natl Acad Sci U S A 1994; 91:6319–6323. 64. Brown R, Strathdee G. Epigenomics and epigenetic therapy of cancer. Trends Mol Med 2002; 8(Suppl):S43–S48. 65. Okami J, Simeone DM, Logsdon CD. Silencing of the hypoxia-inducible cell death protein BNIP3 in pancreatic cancer. Cancer Res 2004; 64:5338–5346. 66. Teitz T, Wei T, Valentine MB, et al. Caspase 8 is deleted or silenced preferentially in childhood neuroblastomas with amplification of MYCN. Nat Med 2000; 6:529–535. 67. Balana C, Ramirez JL, Taron M, et al. O6-methyl-guanine-DNA methyltransferase methylation in serum and tumor DNA predicts response to 1,3-bis(2-chloroethyl)-1-nitrosourea but not to temozolamide plus cisplatin in glioblastoma multiforme. Clin Cancer Res 2003; 9:1461–1468. 68. van Noesel MM, van Bezouw S, Salomons GS, et al. Tumor-specific down-regulation of the tumor necrosis factor-related apoptosis-inducing ligand decoy receptors DcR1 and DcR2 is associated with dense promoter hypermethylation. Cancer Res 2002; 62:2157–2161. 69. Kim TY, Jong HS, Song SH, et al. Transcriptional silencing of the DLC-1 tumor suppressor gene by epigenetic mechanism in gastric cancer cells. Oncogene 2003; 22:3943–3951. 70. Hopkins-Donaldson S, Ziegler A, Kurtz S, et al. Silencing of death receptor and caspase-8 expression in small cell lung carcinoma cell lines and tumors by DNA methylation. Cell Death Differ 2003; 10:356–364. 71. Esteller M, Tortola S, Toyota M, et al. Hypermethylation-associated inactivation of p14(ARF) is independent of p16(INK4a) methylation and p53 mutational status. Cancer Res 2000; 60:129–133. 72. Kang JH, Kim SJ, Noh DY, et al. Methylation in the p53 promoter is a supplementary route to breast carcinogenesis: correlation between CpG methylation in the p53 promoter and the mutation of the p53 gene in the progression from ductal carcinoma in situ to invasive ductal carcinoma. Lab Invest 2001; 81:573–579. 73. Corn PG, Kuerbitz SJ, van Noesel MM, et al. Transcriptional silencing of the p73 gene in acute lymphoblastic leukemia and Burkitt’s lymphoma is associated with 5′ CpG island methylation. Cancer Res 1999; 59:3352–3356. 74. Oka T, Ouchida M, Koyama M, et al. Gene silencing of the tyrosine phosphatase SHP1 gene by aberrant methylation in leukemias/lymphomas. Cancer Res 2002; 62:6390–6394. 75. Stimson KM, Vertino PM. Methylation-mediated silencing of TMS1/ASC is accompanied by histone hypoacetylation and CpG island-localized changes in chromatin architecture. J Biol Chem 2002; 277:4951–4958. 76. Mazieres J, He B, You L, et al. Wnt inhibitory factor-1 is silenced by promoter hypermethylation in human lung cancer. Cancer Res 2004; 64:4717–4720. 77. Byun DS, Cho K, Ryu BK, et al. Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17p13.2 locus, in human gastric adenocarcinomas. Cancer Res 2003; 63:7068–7075. 78. Esteller M, Guo M, Moreno V, et al. Hypermethylation-associated Inactivation of the cellular retinolbinding-protein 1 gene in human cancer. Cancer Res 2002; 62:5902–5905. 79. Evron E, Umbricht CB, Korz D, et al. Loss of cyclin D2 expression in the majority of breast cancers is associated with promoter hypermethylation. Cancer Res 2001; 61:2782–2787. 80. Abdollahi A, Pisarcik D, Roberts D, Weinstein J, Cairns P, Hamilton TC. LOT1 (PLAGL1/ZAC1), the candidate tumor suppressor gene at chromosome 6q24-25, is epigenetically regulated in cancer. J Biol Chem 2003; 278:6041–6049. Chapter 19 / CpG Island Methylation 375 81. Li Y, Nagai H, Ohno T, et al. Aberrant DNA methylation of p57(KIP2) gene in the promoter region in lymphoid malignancies of B-cell phenotype. Blood 2002; 100:2572–2577. 82. Palmisano WA, Crume KP, Grimes MJ, et al. Aberrant promoter methylation of the transcription factor genes PAX5 alpha and beta in human cancers. Cancer Res 2003; 63:4620–4625. 83. Salvesen HB, MacDonald N, Ryan A, et al. PTEN methylation is associated with advanced stage and microsatellite instability in endometrial carcinoma. Int J Cancer 2001; 91:22–26. 84. Honorio S, Agathanggelou A, Wernert N, Rothe M, Maher ER, Latif F. Frequent epigenetic inactivation of the RASSF1A tumour suppressor gene in testicular tumours and distinct methylation profiles of seminoma and nonseminoma testicular germ cell tumours. Oncogene 2003; 22:461–466. 85. Umbricht CB, Evron E, Gabrielson E, Ferguson A, Marks J, Sukumar S. Hypermethylation of 14-3-3 sigma (stratifin) is an early event in breast cancer. Oncogene 2001; 20:3348–3353. 86. Strathdee G, Appleton K, Illand M, et al. Primary ovarian carcinomas display multiple methylator phenotypes involving known tumor suppressor genes. Am J Pathol 2001; 158:1121–1127. 87. Simpson DJ, Hibberts NA, McNicol AM, Clayton RN, Farrell WE. Loss of pRb expression in pituitary adenomas is associated with methylation of the RB1 CpG island. Cancer Res 2000; 60:1211–1216. 88. Yoshikawa H, Matsubara K, Qian GS, et al. SOCS-1, a negative regulator of the JAK/STAT pathway, is silenced by methylation in human hepatocellular carcinoma and shows growth-suppression activity. Nat Genet 2001; 28:29–35. 89. He B, You L, Uematsu K, et al. SOCS-3 is frequently silenced by hypermethylation and suppresses cell growth in human lung cancer. Proc Natl Acad Sci U S A 2003; 100:14,133–14,138. 90. Li Q, Ahuja N, Burger PC, Issa JP. Methylation and silencing of the thrombospondin-1 promoter in human cancer. Oncogene 1999; 18:3284–3289. 91. Whitcomb BP, Mutch DG, Herzog TJ, Rader JS, Gibb RK, Goodfellow PJ. Frequent HOXA11 and THBS2 promoter methylation, and a methylator phenotype in endometrial adenocarcinoma. Clin Cancer Res 2003; 9:2277–2287. 92. Chan TF, Su TH, Yeh KT, et al. Mutational, epigenetic and expressional analyses of caveolin-1 gene in cervical cancers. Int J Oncol 2003; 23:599–604. 93. Li X, Cowell JK, Sossey-Alaoui K. CLCA2 tumour suppressor gene in 1p31 is epigenetically regulated in breast cancer. Oncogene 2004; 23:1474–1480. 94. Kominsky SL, Argani P, Korz D, et al. Loss of the tight junction protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and invasive ductal carcinoma of the breast. Oncogene 2003; 22:2021–2033. 95. Sathyanarayana UG, Toyooka S, Padar A, et al. Epigenetic inactivation of laminin-5-encoding genes in lung cancers. Clin Cancer Res 2003; 9:2665–2672. 96. Dallol A, Krex D, Hesson L, Eng C, Maher ER, Latif F. Frequent epigenetic inactivation of the SLIT2 gene in gliomas. Oncogene 2003; 22:4611–4616. 97. Bachman KE, Herman JG, Corn PG, et al. Methylation-associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggest a suppressor role in kidney, brain, and other human cancers. Cancer Res 1999; 59:798–802. 98. Herman JG, Umar A, Polyak K, et al. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc Natl Acad Sci U S A 1998; 95:6870–6875. 99. Anttila S, Hakkola J, Tuominen P, et al. Methylation of cytochrome P4501A1 promoter in the lung is associated with tobacco smoking. Cancer Res 2003; 63:8623–8628. 100. Lee TL, Leung WK, Chan MW, et al. Detection of gene promoter hypermethylation in the tumor and serum of patients with gastric carcinoma. Clin Cancer Res 2002; 8:1761–1766. 101. Worm J, Kirkin AF, Dzhandzhugazyan KN, Guldberg P. Methylation-dependent silencing of the reduced folate carrier gene in inherently methotrexate-resistant human breast cancer cells. J Biol Chem 2001; 276:39,990–40,000.
