Download 1 Ratio of mutant JAK2-V617F to wild type Jak2 determines the MPD

From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Blood First Edition Paper, prepublished online December 26, 2007; DOI 10.1182/blood-2007-08-107748
1
Ratio of mutant JAK2-V617F to wild type Jak2 determines the MPD phenotypes in
transgenic mice
Ralph Tiedt1, Hui Hao-Shen1, Marta A. Sobas1,2, Renate Looser1, Stephan Dirnhofer3,
Jürg Schwaller4, and Radek C. Skoda1
1
Department of Research, Experimental Hematology, University Hospital Basel, 4031
Basel, Switzerland,
2
Servicio de Hematologia y Hemoterapia, Hospital Clinico
Universitario de Santiago de Compostela, Santiago de Compostela, Spain, 3Institute of
Pathology, University Hospital Basel, Basel, Switzerland, 4Department of Research,
Childhood Leukemia, University Hospital Basel, 4031 Basel, Switzerland
Keywords:
loxP, recombineering, myeloproliferative disease
Running title:
JAK2-V617F transgenic mice
Radek C. Skoda, MD, Department of Research, Experimental Hematology, University
Hospital Basel, Hebelstrasse 20, 4031 Basel, Switzerland, [email protected]
Copyright © 2007 American Society of Hematology
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
2
Abstract
An acquired somatic mutation in the JAK2 gene (JAK2-V617F) is present in the majority
of patients with myeloproliferative disorders (MPD). Several phenotypic manifestations,
i.e. polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis,
can be associated with the same mutation. We generated JAK2-V617F transgenic mice
using a human JAK2 gene with the sequences encoding the kinase domain placed in the
inverse orientation and flanked by antiparallel loxP sites. Crossing mice of one transgenic
line (FF1) with transgenic mice expressing Cre-recombinase under the control of the
hematopoiesis specific Vav promoter led to expression of JAK2-V617F that was lower
than the endogenous wild type Jak2. These mice developed a phenotype resembling ET
with strongly elevated platelet counts and moderate neutrophilia. Induction of the JAK2V617F transgene with the interferon-inducible MxCre resulted in expression of JAK2V617F approximately equal to wild type Jak2 and a PV-like phenotype with increased
hemoglobin, thrombocytosis and neutrophilia. Higher levels of JAK2-V617F in mouse
bone marrow by retroviral transduction caused a PV-like phenotype without
thrombocytosis. These data are consistent with the hypothesis that the ratio of mutant to
wild type JAK2 is critical for the phenotypic manifestation. A similar correlation was also
found in patients with MPD.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
3
Introduction
An acquired somatic mutation in the JAK2 gene resulting in a valine to phenylalanine
substitution at position 617 (JAK2-V617F) is present in the majority of patients with
myeloproliferative disorders (MPD).1-4 This discovery suggested that the presence of the
JAK2-V617F mutation could represent the primary causative lesion in MPD. While the
JAK2-V617F mutation is found in approximately 95% of patients with polycythemia vera
(PV), it is also detectable in about 50% of patient with primary myelofibrosis (PMF) and
essential thrombocythemia (ET).2,5 It remains unclear how the identical JAK2-V617F
mutation can cause three distinct clinical entities. In patients with PV and PMF, but only
rarely in ET, the JAK2-V617F mutation progresses from the heterozygous state to
homozygosity through mitotic recombination of the distal part of chromosome 9p.4,6
Retroviral transduction of mouse bone marrow cells followed by transplantation into
lethally irradiated mice demonstrated that the expression of Jak2-V617F is sufficient to
induce a phenotype resembling PV.1,7-10 These mice showed massive increase in
hematocrit and hemoglobin concentration and a variable degree of neutrophilia. In
contrast to patients with PV, the platelet numbers in these mice remained normal or were
even decreased. After several months some of the mice also developed myelofibrosis.
The phenotype was not affected when bone marrow from donor mice deficient for the Src
family kinases Lyn, Hck and Fgr were used, but was dependent on the presence of
Stat5.10,11
To establish a mouse model for MPD we generated bacterial artificial chromosome
(BAC) transgenic mice that express the human JAK2-V617F driven by the JAK2
promoter. A constitutively active version and an inducible version of the BAC-transgene
were constructed. Transgenic mice that display ET or PV phenotypes have been obtained
in the C57BL/6 background.
Materials and Methods
Transgenic mice
The human JAK2-V617F transgene was constructed using the BAC CTD2025A15
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
4
(CalTech D human BAC library; obtained from Open Biosystems, Huntsville, AL),
which is approximately 190 kb long and contains part of the JAK2 gene reaching from 96
kb upstream of exon 1 to the first 1 kb of intron 12. A construct was assembled from the
rest of intron 12 with 100 bp overlap, cDNA encoding JAK2 exons 13-25, a
polyadenylation signal from SV40,12 an ampicillin resistance cassette flanked by Frt sites
(from the plasmid phCre.myc.nuc.FRT.AMP.FRT, kindly provided by Dr. Günther
Schütz, DKFZ, Heidelberg) and 100 bp of sequence homologous to the BAC vector
pBeloBAC11. This construct was inserted into the BAC by homologous recombination in
the bacterial strain E350 (kindly provided by Dr. Neal Copeland, Institute of Molecular
and Cell Biology, Singapore) and the ampicillin cassette was subsequently removed by
induction of Flpe recombinase.13 For the inducible Flip-Flop transgene, the construct was
modified by inserting a lox66 site into intron 12 and a lox71 site after the polyadenylation
signal.14 The segment between the loxP sites was then inverted by restriction digest and
the new construct was inserted into the BAC as before.
For oocyte injection, BAC DNA was digested with NotI to remove the vector and
purified by over a Sepharose CL4b column (Amersham Biosciences, Piscataway, NJ).
Genotyping of transgenic Flip-Flop mice was performed using the human JAK2-specific
primers GAGCAAGCTTTCTCACAAGC and AATTCTGCCCACTTTGGTGC that
amplify a 530 bp fragment. The number of integrated transgene copies was determined
by
real-time
PCR
with
the
primers
GGAGCTTCAGCACCTCGAGAT
GTGGCAGCAACAGAGCCTATC
for
human
JAK2
and
and
TGGCAGCAGCAGAACCTACA and GGAGCTTCAGCCCCACG for mouse Jak2.
MxCre mice were genotyped using the primers AGGTGTAGAGAAGGCACTTAGC and
CTAATCGCCATCTTCCAGCAGG that amplify a 300 bp fragment. Cre expression was
induced in MxCre;FF1 double transgenic mice by intraperitoneal injection of 300µg
polyinosine-polycytosine (pIpC) 3 times every second day. VavCre mice were kindly
provided by Dr. Dimitris Kioussis (National Institute for Medical Research, London, UK)
and
genotyped
using
the
primers
CTCTGACAGATGCCAGGACA
and
TGATTTCAGGGATGGACACA (500 bp fragment). The integration site of the
transgene in the FF1 strain was localized by fluorescence in situ hybridization using the
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
5
BAC construct as a probe and by spectral karyotyping (Van Andel Institute, Grand
Rapids, MI). Whole genome SNP genotyping was performed by Drs. Jennifer Moran and
David Beier (Mutation Mapping and Developmental Analysis Project, and The Broad
Institute Center for Genotyping and Analysis, Boston, MA). All mice used in this study
were kept under specific pathogen-free conditions and in accordance to Swiss federal
regulations.
Retroviral transduction and bone marrow transplantation
Human JAK2 cDNA (kindly provided by Dr. Jan Cools, Flanders Interuniversity Institute
for Biotechnology, Leuven, Belgium) or human JAK2-V617F cDNA was cloned into the
retroviral vector pMSCV-IRES GFP. An equivalent plasmid containing mouse Jak2V617F was kindly provided by Dr. D. Gary Gilliland (Brigham and Women's Hospital,
Boston, MA). Bone marrow transplantation was performed as previously described.15
Blood and tissue analysis
Blood counts were determined on an Advia 120 Hematology Analyzer using the
“Multispecies Software” (Bayer, Leverkusen, Germany). Plasma erythropoietin and
thrombopoietin levels were measured with the Quantikine Mouse/Rat Epo or Tpo
Immunoassay kit (R&D Systems, Abingdon, UK). For histopathological analysis tissue
specimen were fixed in 10% neutral buffered formalin and embedded in paraffin. Paraffin
sections (4µm) were stained with hematoxylin and eosin (H&E) or Gömöri (reticulin
fibers). Images were taken using an Axio Imager A1 microscope equipped with a Plan
Apochromat objective (63x, numerical aperture 1.4, oil) and a mounted Axio Cam HR
digital camera (all Zeiss, Jena, Germany). The software for image acquisition was
AxioVision Rel. 4.6.
Hematopoietic progenitor assays and flow cytometry
Methylcellulose media were purchased from Stem-Alpha (St Genis L'Argentière, France)
and 2x104 bone marrow or spleen cells were plated in duplicates in STEMα-mIE with
cytokines, or for detection of endogenous colonies, 105 cells were plated in STEMα-mI
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
6
without cytokines. Colony forming unit-megakaryocyte (CFU-MK) cultures were grown
in chamber slides using MegaCult-C media (Stem Cell Technologies, Vancouver,
Canada). For flow cytometric analysis, bone marrow and spleen cells were stained with
fluoroisothiocyanate (FITC)-, phycoerythrine (PE)- or allophycocyanin (APC)conjugated monoclonal antibodies against TER119, CD71, Mac-1, GR-1, B220, CD3 or
isotype controls (Becton Dickinson, Franklin Lakes, NJ) and analyzed on a FACSCalibur
(Becton Dickinson).
Real-time PCR , allelic ratio and Southern blot analysis
Expression analysis in mice was performed with Power SYBR Green PCR Master mix on
a
7500
Fast
machine
(Applied
Biosystems)
using
the
following
primers:
TCACCAACATTACAGAGGCCTACTC and GCCAAGGCTTTCATTAAATATCAAA
(human JAK2), CCACGGCCCAATATCAATG and CCCGCCTTCTTTAGTTTGCTA
(mouse Jak2). Results were confirmed with the Taqman Gene Expression assays
Hs01078117_m1 for human JAK2 and Mm01208495_m1 for mouse Jak2 (Applied
Biosystems). Ratios of human and mouse Jak2 were assessed in the “Absolute
Quantification” setup with standard curves made from linearized pMSCV-IRES GFP
plasmids containing either human JAK2 or mouse Jak2. Total JAK2 expression in
patients was assessed using the Taqman Gene Expression assays Hs01078124_m1
(JAK2) and Hs02338565_gH (human RPL19). Primers and probes for the housekeeping
genes GUSB and B2M were described elsewhere.16 The primers for mouse Gusb were
ATAAGACGCATCAGAAGCCG and ACTCCTCACTGAACATGCGA. Expression of
mutant and wild type JAK2 and quantification of allelic ratios in granulocyte DNA from
patients was done as previously described.17,18 For Southern blot analysis, 5 µg genomic
DNA was digested with XbaI and fragments blotted onto a Hybond N+ membrane
(Amersham Biosciences) were hybridized with a radiolabeled probe generated by PCR
with the primers TTCTCGTCTCCACAGACACA and ATTCTGCCTCTGCAGACCAC.
Radioactive bands were quantified on a Molecular Imager FX (BioRad, Hercules, CA).
Transgene copy numbers were measured by real time PCR with the primers
GTGGCAGCAACAGAGCCTATC and GGAGCTTCAGCACCTCGAGAT for human
JAK2 and TGGCAGCAGCAGAACCTACA and GGAGCTTCAGCCCCACG for mouse
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
7
Jak2. To determine the number of transgene copies in the native orientation, the primers
GCTGCAGCACAGAGATTAAATAGC
and
TGGATCGACATAACTTCGTATAATGTATG were used, which are located 5’ and 3’
of the lox71 site (Figure 1). Real-time PCR efficiency with these primers was very
similar to the efficiency of copy number primers that were used to determine total human
JAK2. Therefore, the number of actively rearranged transgene copies could be calculated
and results were comparable to Southern blot analysis.
Patients
JAK2 expression was analyzed in 88 patients with JAK2-V617F positive MPDs (25 ET,
55 PV, 8 PMF; diagnosed according to WHO criteria) and in 17 healthy individuals.19
The study was approved by the ethics committee of Basel Ethikkommission Beider
Basel, Switzerland. Patients provided informed consent in accordance with the
Declaration of Helsinki.
Results
Generation of JAK2-V617 transgenic mice
To study the in vivo role of JAK2-V617F in the pathogenesis of MPD, we made BACtransgenic mice that express the human JAK2-V617F driven by the endogenous human
JAK2 promoter. The 190 kb BAC clone contained 96 kb of JAK2 5’-upstream region that
does not include other known genes, as well as exons 1-12 and a part of intron 12 of the
human JAK2 gene (Figure 1A). Using homologous recombination in bacteria we added
the missing part of intron 12 including the splice acceptor and a cDNA fragment
consisting of exons 13 to 25 followed by an SV40-derived polyadenylation signal.13 The
construct was prepared in two versions, one containing the V617F mutation (VF) and a
control construct with wild type sequence (WT). Microinjection was performed into
oocytes from inbred C57BL/6 mice. Three lines carrying the WT transgene were
established and found to have no alterations in blood counts (not shown). Two VF
founders with MPD phenotype died before transgenic lines could be established. We
therefore generated an inducible version of the transgenic construct. To this end, we
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
8
added antiparallel loxP sites to both ends of the intron12-cDNA-polyA fragment and
inserted this construct into the BAC clone in an inverted orientation (Figure 1B). In this
configuration, no full length Jak2 protein can be made, since the mRNA is truncated after
exon 12. The kinase domain of human Jak2 is encoded by exons 19-25. Recombination
of antiparallel loxP sites by Cre results in flipping the orientation of the cDNA segment,
restoring a functionally active transgene configuration (Figure 1B, lower part). To make
the recombination unidirectional and irreversible, we made use of previously described
mutant versions of the loxP site named lox66 and lox71.14 Recombination between
antiparallel lox66 and lox71 sites creates one wild type loxP site and one double mutant
site (lox66/71) with greatly reduced affinity for Cre (Figure 1B). Oocyte injection of this
modified BAC construct, named Flip-Flop (FF), yielded two transgenic lines in the
inbred C57BL/6 background, named FF1 and FF2. The FF1 strain carries 9 copies of the
transgene integrated in a single chromosomal locus, which was mapped by fluorescent in
situ hybridization and spectral karyotyping to mouse chromosome 8, band A1 (Figure
1C). We determined the integration site by restriction digest and circular ligation
followed by PCR and sequencing, and found that the integration occurred at a locus near
the centromere that does not contain any known genes (data not shown). A combination
of transgene activation and copy number reduction can result when Cre-recombinase is
expressed (Figure 1D). Ultimately, a single copy of the transgene in the active orientation
will result form this process, provided that all transgene copies were in the head to tail
orientation and that the Cre-recombinase reaction was allowed to proceed to completion.
Polycythemia vera- or essential thrombocythemia-like phenotype in JAK2-V617F
transgenic mice
To induce recombination and activation of the FF transgene we crossed the FF mice with
the VavCre and MxCre transgenic mice.20,21 The Vav promoter was previously shown to
direct constitutive Cre expression to all hematopoietic cells.20 In MxCre mice, the Cre
cDNA is under the control of the interferon inducible Mx1 promoter, which can be
activated by injection of polyinosine-polycytosine (pIpC). The MxCre inducible mouse
has been widely used in studies of hematopoiesis and showed high efficiency of
recombination in bone marrow.21,22 The genetic background of the Mx-Cre and VavCre
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
9
mice was determined by single nucleotide polymorphism (SNP) array analysis containing
748 informative SNPs and found to be >97% and >82% C57BL/6, respectively (data not
shown). Analysis of blood from double transgenic VavCre;FF1 and MxCre;FF1 mice is
shown in Figure 2 and Supplemental Table S1. At 10 weeks, VavCre;FF1 mice showed
normal hemoglobin, slight increase in neutrophils, and marked thrombocytosis,
resembling ET (Figure 2A). At 10 weeks after pIpC induction, MxCre;FF1 displayed a
PV-like phenotype with elevated hemoglobin, thrombocytosis and neutrophilia (Figure
2A). A considerable phenotypic variability, in particular in respect to platelets and
neutrophils, was observed. The increase in erythrocyte numbers was accompanied by a
slight decrease in mean corpuscular volume (Supplemental Table S1). In comparison,
C57BL/6 mice transplanted with bone marrow transduced with retrovirus carrying the
human or mouse JAK2-V617F cDNA showed increased hemoglobin, but normal platelets
and only mildly elevated neutrophils (Figure 2A). The time course of alteration in blood
parameters in transgenic mice is shown in Figure 2B. VavCre;FF1 mice (upper row)
continued to show a ET phenotype at 20 weeks with a massive increase in platelets in all
but one mouse. A slight decrease in hemoglobin, compatible with the presence of
myelofibrosis, and mild increase in neutrophils were also observed. MxCre;FF1 mice
(lower row) retained high hemoglobin in 3/4 cases and developed pronounced
neutrophilia at 20 weeks post pIpC injection. All showed marked thrombocytosis that
was also evident in blood smears (Figure 2C). Despite massive thrombocytosis, we did
not observe thrombotic events. The second Flip-Flop strain, FF2, was also crossed with
MxCre to obtain MxCre;FF2 mice. We did not observe any significant abnormalities in
blood counts after pIpC induction and found that the expression levels of the transgene
were low (data not shown). We therefore focused our analysis on the FF1 strain. Tpo
plasma concentrations at 20 weeks in both MxCre;FF1 and VavCre;FF1 mice showed no
significant differences from normal controls, although a trend to lower values was noted,
particularly in MxCre;FF1 mice (Figure 2D). Epo plasma levels were slightly suppressed
in MxCre;FF1 mice, as frequently observed in PV patients (Figure 2D).23,24 Double
transgenics of both genotypes showed splenomegaly, which was more pronounced in
MxCre;FF1 mice (Figure 2E). To test whether the phenotype of MxCre;FF1 mice is cell
autonomous, we transplanted bone marrow or spleen cells from an MxCre;FF1 mouse 20
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
10
weeks post pIpC injection into lethally irradiated C57BL/6 recipients. Elevated
hematocrit accompanied by neutrophilia and thrombocytosis was found in recipients 10
weeks after transplantation (Figure 2F). Thus, the phenotypes of MxCre;FF1 mice is not
dependent on expression of the transgene in non-hematopoietic cells. In summary,
VavCre;FF1 mice developed a phenotype that resembles ET while MxCre;FF1 displayed
a PV-like phenotype.
Megakaryocyte
hyperplasia
and
bone
marrow
fibrosis
accompanied
by
extramedullary hematopoiesis in JAK2-V617F transgenic mice
For more detailed analysis, we sacrificed VavCre;FF1 mice at 20 weeks and MxCre;FF1
mice 20 weeks after pIpC injection and performed histopathological analysis (Figure 3).
Bone marrow trephine sections of both strains showed hypercellularity with trilineage
hyperplasia (Figure 3A). Markedly increased numbers of megakaryocytes were present,
most of them with morphological abnormalities (hyperchromatic, hyperlobulated nuclei,
and bizarre nuclear configuration) and often forming clusters. A particular finding in
VavCre;FF1 mice, but not MxCre;FF1 mice, were dilated sinusoids with intrasinusoidal
hematopoiesis (Figure 3B) that are characteristic of PMF in humans. A reticulin stain
(Gömöri) highlights the fibrosis that was present in bone marrow and spleen of
VavCre;FF1 and MxCre;FF1 mice (Figure 3C and 3D). Sections of the spleen
demonstrate destruction of normal splenic architecture by atypical hematopoiesis (Figure
3E). Megakaryocytes were markedly increased in numbers and displayed the same
atypical morphology as in the bone marrow in both VavCre;FF1 and MxCre;FF1 mice.
The liver showed extramedullary hematopoiesis with highly atypical megakaryocytes, but
islands with myelopoiesis and erythropoiesis could also be found (Figure 3F).
Hematopoietic cells including megakaryocytes, were also found in the lung (Figure 3G).
The bones were pale upon gross examination, suggesting decreased erythropoiesis. Flow
cytometric analysis confirmed that erythroid Ter119-positive cells were reduced in bone
marrow, and a compensatory increase was detected in the spleen of both double
transgenic mice (Supplemental Figure S1). Myeloid cells (Gr1/Mac1-positive) were the
predominant cell population in bone marrow and also clearly increased in spleen. The
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
11
relative amount of B- and T-cells in the spleen and bone marrow of both MxCre;FF1 and
VavCre;FF1 mice was reduced, whereas the number of megakaryocytes was increased
(Supplemental Figure S1). Colony assays of progenitors in methylcellulose confirmed
extramedullary hematopoiesis with markedly increased erythroid and myeloid progenitor
numbers in spleen (Figure 4A). Megakaryopoiesis was assayed in collagen based cultures
and revealed a small increase in CFU-MK in bone marrow of VavCre;FF1 mice and a
massive expansion of CFU-MK in the spleens of both double transgenic mice (Figure
4B). No growth of CFU-E on day 2-3 or BFU-E on day 8-10 was observed in
methylcellulose media without cytokines, despite plating 5 times more cells (data not
shown).
The ratios between the expression levels of mutant JAK2-V617F and wild type Jak2
correlate with disease phenotype
To determine whether the phenotypic differences between VavCre;FF1 and MxCre;FF1
mice might be due to differences in the expression levels of the human JAK2-V617F, we
quantified the expression of the transgenic JAK2-V617F and endogenous Jak2 mRNA by
real-time PCR (Figure 5A). To detect solely transcripts of the flipped FF1 transgene,
oligonucleotides located in exons 12 and 13 human JAK2 were used that do not prime in
mouse Jak2. In addition, mouse specific primers were used to assess expression of
endogenous Jak2. The expression values were normalized to the mRNA for βglucuronidase (Gusb). VavCre;FF1 mice showed JAK2-V617F expression in
hematopoietic tissues (Figure 5A, upper panel). In addition, we also detected transgene
expression in lung and at low levels in liver and testis. The MxCre;FF1 mice showed a
wide distribution of transgene expression. The presence of hematopoietic cells might
contribute to the relatively high expression levels observed in the lung (Figure 3G). The
endogenous mouse Jak2 was expressed in all tissues examined and no major differences
were found between VavCre;FF1 and MxCre;FF1 mice (Figure 5A, lower panel). We
next compared the expression of human JAK2-V617F and mouse Jak2 in the bone
marrow of double transgenic mice to mice transplanted with bone marrow retrovirally
transduced with human JAK2-V617F (Figure 5B). VavCre;FF1 mice showed the lowest
expression of JAK2-V617F, followed by MxCre;FF1, and the highest expression levels
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
12
were found in retrovirally transduced bone marrow cells (Figure 5B, left). Endogenous
mouse Jak2 was slightly reduced in MxCre;FF1 mice compared to controls (Figure 5B,
middle). To determine the ratio of JAK2-V617F to wild type Jak2, we developed a
quantification assay that normalizes for differences in the amplification efficiencies
between the primers used for human and mouse JAK2 (Figure 5B, right). For this
purpose, standard curves were generated from plasmids that contained either human
JAK2 or mouse Jak2, but were otherwise identical. Transgene expression was less than
half of endogenous Jak2 in bone marrow of VavCre;FF1 mice. In MxCre;FF1 mice the
expression of mutant JAK2 was comparable to wild type Jak2, whereas in retrovirally
transduced bone marrow the mutant JAK2 was around 3-fold higher than wild type Jak2
(Figure 5B, right). A similar pattern, but slightly lower ratios were also seen in spleen and
in peripheral blood granulocytes (not shown). Since the expression levels of JAK2-V617F
could depend on the number of functionally rearranged copies of the FF1 transgene, we
performed Southern blot analysis to determine the ratio of flipped versus native form of
the transgene (Figure 5C). In the same samples we measured the transgene copy number
by real time PCR to determine the rate of excision by Cre-recombinase. Cre activity is
expected to generate both active rearrangement and copy number reduction by excision
(Figure 1D). In bone marrow of VavCre;FF1 mice we found more than 80% of the
transgene to be flipped into the active configuration, but at the same time the number of
transgene copies was reduced to an average of 2 (Figure 5C). In contrast, MxCre;FF1
displayed approximately 70% active configuration in bone marrow, and an average of 5.7
transgene copies (Figure 5C). The number of active transgene copies in bone marrow
cells was between 1 and 2 in VavCre;FF1 mice and between 3 and 4.5 in MxCre;FF1
mice. The higher rate of excision in VavCre;FF1 is not unexpected, since Cre expression
in the bone marrow of these mice is constitutive, whereas the induction of Cre expression
in MxCre;FF1 mice by pIpC is only transient. By altering the number of pIpC injections
in MxCre;FF1 mice we obtained mice with variable number of active transgene copies
(Supplemental Figure S2). We confirmed the correlation between flipped transgene
copies and ratio of human JAK2-V617F to mouse Jak2 (Figure 5D, left panel).
Furthermore, the hemoglobin concentration correlated with the ratio of human JAK2V617F to mouse Jak2 (Figure 5D, right panel). Two outliers showed unexpectedly low
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
13
hemoglobin. These two mice showed very high platelet counts (12’144 x109/L and
11’298 x109/L, respectively). In summary, FF1 transgene expression in bone marrow,
spleen and peripheral blood granulocytes was higher when induced with MxCre than
when induced with VavCre and correlated with the number of transgene copies in the
active configuration and with the observed differences in phenotype: low expression in
VavCre;FF1 appears to favor expansion of the megakaryocytic lineage, intermediate
expression in MxCre;FF1 mice was accompanied by increased erythropoiesis,
granulopoiesis, and thrombopoiesis, whereas high expression from a retroviral vector
resulted in erythroid expansion, but normal granulopoiesis and normal megakaryopoiesis.
PV patients show higher mutant to wild type JAK2 expression ratio than ET
patients
To determine whether a similar correlation between expression levels of JAK2-V617F
and the ET and PV phenotypes also exists in patients with MPD, we measured total
JAK2, JAK2-V617F and wild type JAK2 in granulocyte RNA from 82 patients with
JAK2-V617F positive MPDs (25 ET, 49 PV, 8 PMF) and in 11 healthy individuals
(Figure 6). Patients with PV and PMF showed slightly higher expression of total JAK2
(Figure 6A), and clearly higher expression of JAK2-V617F mRNA than ET patients
(Figure 6B, left). In PV patients we detected lower wild type JAK2 mRNA levels than in
ET patients or healthy controls (Figure 6B, right). The cause of the inter-individual
differences in total JAK2 expression levels (Figure 6A) is currently unknown. The
amplitudes of these differences, but not the overall conclusions, are influenced by the
choice of gene for normalization (Supplemental Figure S3). A strong linear correlation
between the percentage of JAK2-V617F mRNA and the allelic ratio of JAK2-V617F in
genomic DNA was noted (Figure 6C), similar to a previous study.17 Thus, despite the
inter-individual variations in the total expression levels, the relative expression of the
mutant versus wild type JAK2 mRNA in humans appears to depend primarily on the
percentage of chromosomes carrying the JAK2-V617F mutation (%T). Since the %T in
ET patients are on average lower that in PV and PMF, ET patients also displayed lower
ratios of mutant/wild type JAK2 mRNA than PV patients (Figure 6D), reminiscent of the
pattern found in our transgenic mice (Figure 5B).
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
14
Discussion
Retroviral mouse models have demonstrated that expression of Jak2-V617F in bone
marrow causes a PV-like phenotype, which can progress to myelofibrosis,1,7-10 but
thrombocytosis was absent in these mice. The megakaryocytes were markedly smaller
and displayed reduced ploidy, suggesting impaired megakaryocyte maturation.8,10 All
published retroviral reports used a mouse Jak2 cDNA, in which the G>T mutation in
codon 617 has been introduced. We show that the human JAK2-V617F can also cause an
MPD phenotype in mice. Our transgenic mice developed marked thrombocytosis that has
never been observed with the retroviral models. A variable phenotype ranging from
thrombocytosis only (in one of the VF founders and some VavCre;FF1 mice), bilineage
disease involving thrombopoiesis and granulopoiesis (in the majority of VavCre;FF1
mice), to full trilineage disease with increased erythropoiesis, thrombopoiesis and
granulopoiesis (in MxCre:FF1 mice) has been observed. These phenotypes correlated
with the number of actively rearranged transgene copies and the ratio of expression levels
of transgenic JAK2-V617F in respect to the endogenous mouse Jak2. The transgenic
mice displayed clearly lower expression levels than bone marrow cells retrovirally
transduced with JAK2-V617F. These results suggest that the hematopoietic lineages show
differences in responsiveness to the presence of the mutated JAK2-V617F, with
megakaryopoiesis being most sensitive, followed by granulopoiesis and erythropoiesis.
High levels of JAK2-V617F appear to be inhibitory to megakaryopoiesis, as illustrated by
normal or decreased platelet counts in the retroviral models. In this context it is
noteworthy that in PV patients a negative correlation of JAK2-V617F expression level
with platelet counts, but a positive correlation with hemoglobin and granulocyte counts
has been reported.17,25,26 In addition, ET patients on average display higher platelet levels
than PV patients,17 which is reflected in our VavCre;FF1 mice that show higher platelet
levels than MxCre;FF1 mice. Jak2 protein was found to function as a chaperone
promoting cell surface localization of the thrombopoietin receptor Mpl,27 and reduced
Mpl protein on platelets was observed in MPD patients.19,28-30 One study noted a
reciprocal relationship between JAK2-V617F alleles in granulocytes and Mpl protein on
platelets,31 suggesting that Mpl protein can be downregulated by Jak2-V617F. However,
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
15
we did not observe reduced Mpl protein levels on platelets of our VavCre;FF1 or
MxCre;FF1 transgenic mice (data not shown).
Ubiquitous high level of JAK2-V617F transgene expression might be lethal, as we were
unable to establish a VF transgenic line that exhibits a MPD phenotype. Two founder
mice died before giving rise to offspring, both with a clearly enlarged spleen. The only
transgenic line we obtained (VF1) showed low expression (ratio mutant/wild type JAK2
mRNA = 0.32±0.02 in bone marrow, n = 5) and appears to have been selected for
minimal phenotype (Supplemental Table S1). Consistently, no germ line mutations in
JAK2 have been reported to date in human familial MPD. The inducible BAC construct
allowed us to establish the transgenic line FF1 that exhibits either an ET or a PV
phenotype, depending on the mode of transgene activation. Because nine copies of the
transgene are present in FF1 mice, Cre mediated excision can result in activation and/or
excision of the transgene (Figure 1D). The numbers of actively rearranged copies of the
transgene correlated with JAK2-V617F expression levels. Dependence of expression on
transgene copy numbers has been found in many BAC transgenes and is considered an
advantage over the use of classical small transgenic constructs.32-34
The Vav promoter used in our VavCre mice has been shown to display variable
expression efficiency in erythroid cells.20 However, the absence of an erythroid
phenotype in VavCre;FF1 mice was not due to the absence of transgene
activation/excision in erythropoietic cells, as rearrangement of the transgene was found in
DNA from isolated erythroid colonies of VavCre;FF1 mice grown in methylcellulose
(data not shown). In contrast to other Vav transgenic mice, transgene expression in our
case depends on the activity of the JAK2 promoter. Active rearrangement of the transgene
in hematopoietic stem cells is theoretically sufficient to maintain expression in all
hematopoietic lineages that are derived from such a stem cell. The Vav promoter has been
shown to be active in hematopoietic stem cells,35,36 but it remains to be established how
efficient the excision occurs at the stem cell level in VavCre;FF1 mice. If excision in
stem cells is only partial, lineage-specific differences in Cre expression levels between
VavCre and MxCre cannot be excluded as the cause of phenotypic differences. However,
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
16
the ET-like phenotype was not unique to the VavCre;FF1 mice, as MxCre;FF1 mice with
a lower number of actively rearranged transgene copies (after receiving 6 doses of pIpC)
also displayed a trend towards lower hemoglobin (Figure 5D and Supplemental Table
S1). Conversely MxCre;FF1 mice that received a single dose of pIpC showed the highest
number of actively rearranged transgene copies and the highest hemoglobin levels.
Although this data is based on a relatively small number of mice, it suggests that
variations in phenotype primarily depend on the number of actively rearranged transgene
copies, rather than the lineage specificity of the promoter driving Cre expression. The
Vav promoter is already active in the fetal liver.35 VavCre;FF1 mice therefore could be
expected to show thrombocytosis at a young age. However, we found that platelet levels
at 5 weeks in these mice were only slightly elevated, and a marked increase was observed
only at later time points (Figure 2B). The reason for the slow disease progression is
currently unknown.
Quantification of JAK2-V617F expression using two different real time PCR approaches
showed a strong correlation with phenotype (Figure 5). The ∆∆CT method allows to
reliably determining the relative expression of the human and mouse JAK2, but the
absolute levels cannot be directly compared, because the amplification efficiency of the
human and mouse primer pairs is likely to vary. We therefore established standard curves
to derive the ratios of human/mouse JAK2 presented in Figure 5B, which confirmed the
differences between the two transgenic strains and the retroviral model. A dependence of
the platelet phenotype on Jak2-V617F expression levels was also noted in one of the
retroviral mouse models, in which a subgroup of secondary recipients of bone marrow
transplantation showed a 1.6-fold increase in platelet numbers 2 weeks after
transplantation.7 At 3 and 4 weeks the platelet levels were equal to the controls. This
subgroup of mice showed a lower ratio of mutant/wild type Jak2 mRNA (average 2.8fold) than other transplanted mice with normal platelet counts (average 8.2-fold). These
ratios are higher that those observed in our mice. Despite showing a ratio of mutant/wild
type mRNA of 3, our mice transplanted with retrovirally transduced bone marrow
expressing JAK2-V617F showed normal platelet numbers (Figure 2A). Since the
retroviral constructs as well as the methods used for quantification were different, we
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
17
cannot directly compare our results with the study by Lacout and colleagues.7
Nevertheless, the same trend was observed, although at different mutant/wild type ratios.
Thus, in mouse models the presence of the JAK2-V617F is sufficient to generate the full
range of MPD phenotypes. The phenotypic variation appears to depend on the ratio of
mutant/wild type JAK2 mRNA. A contribution of genetic background on the phenotypic
expression is unlikely, since our MxCre;FF1 mice were >98% C57BL/6 and showed ET
or PV phenotypes depending on the scheme of transgene activation, i.e. number of pIpC
injections (Figure 5D and Supplemental Table S1). Clearly, the ratio of mutant/wild type
JAK2 mRNA is only a surrogate parameter and the expression and phosphorylation status
of the mutant and wild type Jak2 proteins in hematopoietic progenitors need to be
monitored. Furthermore, in some mice the blood counts did not correlate with transgene
expression (Figure 5D), suggesting that additional unknown factors, possibly somatic
mutations, may modify the phenotype.
Increased bone marrow fiber content was more pronounced in VavCre;FF1 mice than in
MxCre;FF1 mice and appears to correlate better with the extent of thrombocytosis than
with the mutant/wild type mRNA ratio, i.e. VavCre;FF1 mice showed dilated sinusoids
and more pronounced fibrosis despite a low mutant/wild type mRNA ratio. In contrast, a
high mutant/wild type mRNA ratio was detected in PMF patients. In the retroviral
models, megakaryocyte maturation defects have been observed that are thought to be
responsible for the normal or low platelet counts possibly through an altered chaperone
function of Jak2-V617F protein. Fibrosis in these mice is likely related to the elevated
megakaryocyte mass in the bone marrow.
In ET patients we also observed lower expression levels of JAK2-V617F than in PV
(Figure 6). However, a logarithmic scale was used to show the differences in human
patients, whereas a linear scale was used for the differences in mice (Figure 5), reflecting
a much wider range of ratios present in the patients. In contrast to our transgenic mice
that display graded levels of JAK2-V617F with wild type JAK2 being present in every
cell, each individual blood cell from patients with MPD can only be homozygous or
heterozygous for the mutation, or normal. Thus, the resemblance of the plots is due to the
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
18
fact that a mixture of granulocytes with wild type JAK2 and granulocytes heterozygous
for JAK2-V617F are present in ET, whereas patients with PV and PMF frequently have
additional cells homozygous for JAK2-V617F.4,37,38 Therefore, the molecular mechanism
determining the phenotype in humans may be more complex than in our mouse model
and appears to be linked to the transition of the JAK2-V617F mutation to homozygosity.
A subset of PV patients that lack cells with homozygous JAK2-V617F was recently
described, suggesting that alternative mechanisms to cause expansion of the erythroid
lineage exist in PV patients.26 Similarly, patients with mutations in exon 12 of JAK2
generally do not progress to homozygosity.39,40
The FF1 transgenic mouse model offers several advantages over the previously reported
retroviral models using bone marrow transplantation: our transgenic mice exhibit bi- or
tri-lineage disease including thrombocytosis, as observed in human patients with ET and
PV. The expression levels of the JAK2-V617F transgene are comparable to the
endogenous Jak2, in contrast to the very high expression levels observed in most of the
retroviral models. In addition, we show that the human JAK2-V617F causes MPD in
mice, which will be important for testing Jak2 inhibitors as potential therapeutic agents.
Acknowledgements
We thank Daniela Nebenius-Oosthuizen for oocyte microinjections, David Beier and
Jennifer Moran for SNP-array analysis, Robert Kralovics and Nico Ghilardi for helpful
comments on the manuscript. This work was supported by grant 310000-108006/1 from
the Swiss National Science Foundation and grant OCS-01742-08-2005 from the Swiss
Cancer League/Oncosuisse.
Authorship Contribution Statement:
R. T. designed and performed research, analyzed data and wrote the paper, H. H. and R.
L. performed research, M.A.S., S. D. and J. S. performed research and analyzed data,
R.C. S. designed research, analyzed data and wrote the paper.
The authors declare no competing financial itnerests.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
19
References
1.
James C, Ugo V, Le Couedic JP, et al. A unique clonal JAK2 mutation leading to
constitutive signalling causes polycythaemia vera. Nature. 2005;434:1144-1148.
2.
Baxter EJ, Scott LM, Campbell PJ, et al. Acquired mutation of the tyrosine kinase
JAK2 in human myeloproliferative disorders. Lancet. 2005;365:1054-1061.
3.
Levine RL, Wadleigh M, Cools J, et al. Activating mutation in the tyrosine kinase
JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with
myelofibrosis. Cancer Cell. 2005;7:387-397.
4.
Kralovics R, Passamonti F, Buser AS, et al. A gain-of-function mutation of JAK2
in myeloproliferative disorders. N Engl J Med. 2005;352:1779-1790.
5.
Cazzola M, Skoda R. Gain of function, loss of control - a molecular basis for
chronic myeloproliferative disorders. Haematologica. 2005;90:871-874.
6.
Kralovics R, Guan Y, Prchal JT. Acquired uniparental disomy of chromosome 9p
is a frequent stem cell defect in polycythemia vera. Experimental Hematology.
2002;30:229-236.
7.
Lacout C, Pisani DF, Tulliez M, Gachelin FM, Vainchenker W, Villeval JL.
JAK2V617F expression in murine hematopoietic cells leads to MPD mimicking human
PV with secondary myelofibrosis. Blood. 2006;108:1652-1660.
8.
Wernig G, Mercher T, Okabe R, Levine RL, Lee BH, Gilliland DG. Expression of
Jak2V617F causes a polycythemia vera-like disease with associated myelofibrosis in a
murine bone marrow transplant model. Blood. 2006;107:4274-4281.
9.
Bumm TG, Elsea C, Corbin AS, et al. Characterization of murine JAK2V617Fpositive myeloproliferative disease. Cancer Res. 2006;66:11156-11165.
10.
Zaleskas VM, Krause DS, Lazarides K, et al. Molecular Pathogenesis and
Therapy of Polycythemia Induced in Mice by JAK2 V617F. PLoS ONE. 2006;1:e18.
11.
Zaleskas VM, Krause DS, Lazarides K, et al. Molecular Pathogenesis of
Polycythemia Induced in Mice by JAK2 V617F. Blood. 2005;106.
12.
Luoh SM, Stefanich E, Solar G, et al. Role of the distal half of the c-Mpl
intracellular domain in control of platelet production by thrombopoietin in vivo. Mol Cell
Biol. 2000;20:507-515.
13.
Lee EC, Yu D, Martinez de Velasco J, et al. A highly efficient Escherichia colibased chromosome engineering system adapted for recombinogenic targeting and
subcloning of BAC DNA. Genomics. 2001;73:56-65.
14.
Zhang Z, Lutz B. Cre recombinase-mediated inversion using lox66 and lox71:
method to introduce conditional point mutations into the CREB-binding protein. Nucleic
Acids Res. 2002;30:e90.
15.
Schwaller J, Frantsve J, Aster J, et al. Transformation of hematopoietic cell lines
to growth-factor independence and induction of a fatal myelo- and lymphoproliferative
disease in mice by retrovirally transduced TEL/JAK2 fusion genes. Embo J.
1998;17:5321-5333.
16.
Beillard E, Pallisgaard N, van der Velden VH, et al. Evaluation of candidate
control genes for diagnosis and residual disease detection in leukemic patients using 'realtime' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) - a Europe
against cancer program. Leukemia. 2003;17:2474-2486.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
20
17.
Lippert E, Boissinot M, Kralovics R, et al. The JAK2-V617F mutation is
frequently present at diagnosis in patients with essential thrombocythemia and
polycythemia vera. Blood. 2006;108:1865-1867.
18.
Kralovics R, Teo SS, Li S, et al. Acquisition of the V617F mutation of JAK2 is a
late genetic event in a subset of patients with myeloproliferative disorders. Blood.
2006;108:1377-1380.
19.
Kralovics R, Buser AS, Teo SS, et al. Comparison of molecular markers in a
cohort of patients with chronic myeloproliferative disorders. Blood. 2003;102:1869-1871.
20.
de Boer J, Williams A, Skavdis G, et al. Transgenic mice with hematopoietic and
lymphoid specific expression of Cre. Eur J Immunol. 2003;33:314-325.
21.
Kuhn R, Schwenk F, Aguet M, Rajewsky K. Inducible gene targeting in mice.
Science. 1995;269:1427-1429.
22.
Leveen P, Carlsen M, Makowska A, et al. TGF-beta type II receptor-deficient
thymocytes develop normally but demonstrate increased CD8+ proliferation in vivo.
Blood. 2005;106:4234-4240.
23.
Birgegard G, Wide L. Serum erythropoietin in the diagnosis of polycythaemia and
after phlebotomy treatment. Br J Haematol. 1992;81:603-606.
24.
Mossuz P, Girodon F, Donnard M, et al. Diagnostic value of serum erythropoietin
level in patients with absolute erythrocytosis. Haematologica. 2004;89:1194-1198.
25.
Vannucchi AM, Antonioli E, Guglielmelli P, et al. Clinical profile of homozygous
JAK2V617F mutation in patients with polycythemia vera or essential thrombocythemia.
Blood. 2007.
26.
Dupont S, Masse A, James C, et al. The JAK2 617V>F mutation triggers
erythropoietin hypersensitivity and terminal erythroid amplification in primary cells from
patients with polycythemia vera. Blood. 2007;110:1013-1021.
27.
Royer Y, Staerk J, Costuleanu M, Courtoy PJ, Constantinescu SN. Janus kinases
affect thrombopoietin receptor cell surface localization and stability. J Biol Chem.
2005;280:27251-27261.
28.
Horikawa Y, Matsumura I, Hashimoto K, et al. Markedly reduced expression of
platelet c-mpl receptor in essential thrombocythemia. Blood. 1997;90:4031-4038.
29.
Moliterno AR, Hankins WD, Spivak JL. Impaired expression of the
thrombopoietin receptor by platelets from patients with polycythemia vera. N Engl J
Med. 1998;338:572-580.
30.
Moliterno AR, Spivak JL. Posttranslational processing of the thrombopoietin
receptor is impaired in polycythemia vera. Blood. 1999;94:2555-2561.
31.
Moliterno AR, Williams DM, Rogers O, Spivak JL. Molecular mimicry in the
chronic myeloproliferative disorders: reciprocity between quantitative JAK2 V617F and
Mpl expression. Blood. 2006;108:3913-3915.
32.
Giraldo P, Montoliu L. Size matters: use of YACs, BACs and PACs in transgenic
animals. Transgenic Res. 2001;10:83-103.
33.
Casanova E, Fehsenfeld S, Mantamadiotis T, et al. A CamKIIalpha iCre BAC
allows brain-specific gene inactivation. Genesis. 2001;31:37-42.
34.
Zhang XM, Ng AH, Tanner JA, et al. Highly restricted expression of Cre
recombinase in cerebellar Purkinje cells. Genesis. 2004;40:45-51.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
21
35.
Ogilvy S, Metcalf D, Gibson L, Bath ML, Harris AW, Adams JM. Promoter
elements of vav drive transgene expression in vivo throughout the hematopoietic
compartment. Blood. 1999;94:1855-1863.
36.
Almarza E, Segovia JC, Guenechea G, Gomez SG, Ramirez A, Bueren JA.
Regulatory elements of the vav gene drive transgene expression in hematopoietic stem
cells from adult mice. Exp Hematol. 2004;32:360-364.
37.
Passamonti F, Rumi E, Pietra D, et al. Relation between JAK2 (V617F) mutation
status, granulocyte activation, and constitutive mobilization of CD34+ cells into
peripheral blood in myeloproliferative disorders. Blood. 2006;107:3676-3682.
38.
Scott LM, Scott MA, Campbell PJ, Green AR. Progenitors homozygous for the
V617F JAK2 mutation occur in most patients with polycythemia vera, but not essential
thrombocythemia. Blood. 2006.
39.
Scott LM, Tong W, Levine RL, et al. JAK2 exon 12 mutations in polycythemia
vera and idiopathic erythrocytosis. N Engl J Med. 2007;356:459-468.
40.
Pietra D, Li S, Brisci A, et al. Somatic mutations of JAK2 exon 12 in patients
with JAK2 (V617F)-negative myeloproliferative disorders. Blood. 2007.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
22
Figure legends
Figure 1. The human JAK2-V617F (Flip-Flop) transgene. (A) Transgenic construct. A
human BAC containing JAK2 exons 1-12 was combined with a partial cDNA encoding
JAK2 exons 13-25 (black box; not to scale) and a polyadenylation signal (white box). (B)
Inducible transgenic construct. The cDNA is placed in the inverse orientation (white
arrow) and is flanked with mutant loxP sites (magnified insert). Cre-mediated
recombination flips the orientation of the cDNA and places the intron 12 splice acceptor
(SA) into the correct position to allow proper splicing of the transgenic pre-mRNA.
Recombination generates one wild type loxP and one double mutant lox66/77 site, which
is no longer substrate for the Cre-recombinase. The position of the V617F mutation is
indicated by a red arrow. (C) Localization of the transgene in the transgenic strain FF1.
Fluorescent in situ hybridization (FISH) shows that the transgene integrated into a single
locus, which appears as two red signals in metaphase chromosomes (red arrow in left
panel). Spectral karyotyping (SKY) identified chromosome 8, band A1 as the transgene
integration site (red arrow in right panel). (D) Model of Cre-mediated rearrangements in
the transgenic integration site. A perfect head to tail orientation of all transgenic copies is
assumed. In the FF1 strain we found that 9 copies of the transgene have integrated, of
which only 3 are shown. The native configuration, in which all transgenic copies are in
the inactive orientation (red boxes), is shown on top. Cre-recombination between
adjacent loxP sites (green arrows) leads to reversal of the orientation and activation of the
transgene (green boxes). A maximum of 9 active transgene copies can be generated
(middle panel). Cre-recombination between distant loxP sites that are in a parallel
orientation (red arrows) results in the excision of one ore more copies of the transgene
(lower panel).
Figure 2. Peripheral blood parameters in transgenic mice and controls. (A) Hemoglobin,
platelets and neutrophils were determined in controls and double transgenic mice (left
half of diagrams) or in mice transplanted with retrovirally transduced bone marrow (right
half of diagrams). Controls, wild type or single transgenic mice (n = 19); VavCre;FF1
double transgenic mice (age 10-12 weeks, n = 6); MxCre;FF1 double transgenic mice
(10-12 weeks after 3x pIpC injection, n = 11); Tx controls, mice transplanted with bone
marrow cells transduced with empty vector or wild type Jak2 (8 weeks post
transplantation, n=12); pMSCV-hV617F, mice transplanted with bone marrow transduced
with human JAK2-V617F (8 weeks post transplantation, n = 9); pMSCV-mV617F, mice
transplanted with bone marrow transduced with mouse Jak2-V617F (8 weeks post
transplantation, n = 9). Boxes represent the interquartile range that contains 50% of the
values, the horizontal line in the box marks the median and bars indicate the range of
values. Asterisks indicate significant differences compared to controls (Mann-Whitney
test, P < 0.05). (B) Time course of blood parameters in VavCre;FF1, MxCre;FF1, and
control mice. Blood counts of individual mice at 5-6 weeks, 10-12 weeks and 20 weeks
of age (VavCre;FF1) or after 3x pIpC injection (MxCre;FF1) are shown. Each mouse is
represented by the same symbol in all three graphs and values of individual mice are
connected by solid lines. Black symbols, transgenic mice; gray symbols, control mice.
(C) Blood films of mice of the indicated genotypes stained with May-Grünwald-Giemsa.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
23
VavCre;FF1 mice (20 weeks) and MxCre;FF1 (20 weeks after 3x pIpC). Note massive
thrombocytosis in both mice and prominent neutrophilia in the MxCre;FF1 mouse. (D)
Plasma levels of thrombopoietin (Tpo) and erythropoietin (Epo) determined by ELISA.
Tpo levels were not significantly different between controls (n=5), VavCre;FF1 mice
(n=5) and MxCre;FF1 mice (n=3). Plasma from Mpl-deficient mice (Mpl-/-) served as a
control for elevated Tpo levels. Epo plasma concentrations were determined in controls
(n=4), VavCre;FF1 mice (n=7) and MxCre;FF1 mice (n=4). Epo was found to be
significantly lower in MxCre;FF1 mice than in VavCre;FF1 mice (Mann-Whitney test, P
= 0.012) (E) Spleen weight in VavCre;FF1 mice (20 weeks) and in MxCre;FF1 (20
weeks after 3x pIpC). (F) The MPD phenotype of MxCre;FF1 mice is transplantable.
Bone marrow (BM) or spleen cells (SPL) derived from an MxCre;FF1 mouse (20 weeks
after 3x pIpC) or bone marrow from a wild type (WT) mouse were transplanted into
lethally irradiated C57BL/6 recipients. Blood counts were performed 10 weeks after
transplantation. Dots represent the values of individual mice and horizontal lines the
mean.
Figure 3. Histopathological analysis of VavCre;FF1 and MxCre;FF1 mice (20 weeks).
H&E staining of bone marrow of both double transgenic mice (A) show trilineage
hyperplasia with markedly increased numbers of megakaryocytes, most of which are
morphologically abnormal (hyperchromatic, hyperlobulated nuclei, bizarre nuclear
configuration) and present in clusters. (B) Dilated sinusoids were observed in 3/3
VavCre;FF1 mice in the bone marrow, but were absent in the 3 examined MxCre;FF1
mice. (C) Reticulin staining (Gömöri) demonstrates fibrosis in bone marrow. (D) Fibrosis
was also seen in the spleen (only VavCre;FF1 is shown). (E) HE staining of spleens
demonstrate destruction of normal splenic architecture by atypical hematopoiesis in both
MxCre;FF1 and VavCre;FF1 mice. In particular megakaryocytes are markedly increased
in numbers and display the same atypical morphology as in the bone marrow. (F) The
liver shows extramedullary hematopoiesis indicated by the presence of megakaryocytes
and clusters of granulopoiesis or erythropoiesis. (G) Megakaryocytes (arrowhead) were
detected in the lung of MxCre;FF1 mice. VavCre;FF1 mice were not analyzed.
Figure 4. Colony assays for the quantification of hematopoietic progenitors. Bone
marrow and spleen cells of transgenic VavCre;FF1 (n = 4) and MxCre;FF1 mice (n = 4)
and controls (n = 6) were seeded in methylcellulose containing mouse IL-3, human IL-6
and IL-9, mouse stem cell factor and human erythropoietin (A), or in collagen media
containing thrombopoietin, mouse IL-3 and human IL-6 (B). Colonies were enumerated
at day 8. Prior to counting, collagen cultures were fixed and stained for acetyl
cholinesterase activity to visualize megakaryocytes. CFU-GEMM, colony forming unitgranulocyte, erythroid, macrophage, megakaryocyte; CFU-GM, sum of colony forming
unit-granulocyte, colony forming unit-macrophage and colony forming unit-granulocyte,
macrophage; BFU-E, burst forming unit-erythroid. Spleens of double transgenic mice
showed marked increase in hematopoietic progenitors. For statistical analysis, we
performed pairwise Mann-Whitney tests. Asterisks indicate statistically significant
differences (P < 0.05; in A for all colony types)
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
24
Figure 5. Transgene mRNA expression and Cre-loxP mediated DNA recombination. (A)
Expression of human JAK2-V617F mRNA and endogenous Jak2 in tissues of two
VavCre;FF1 and two MxCre;FF1 mice. BM, bone marrow; SPL, spleen; THY, thymus;
LIV, liver; KID, kidney; INT, intestine; LUN, lung; HEA, heart; BRA, brain; TES, testis;
OVA, ovary. Real-time PCR was performed with primers specific for the activated
configuration of the human JAK2 transgene (upper panel) or specific for mouse Jak2
(lower panel). The numbers represent relative expression values calculated by the ∆∆CT
method after normalization to the mRNA of mouse Rpl19 and arbitrarily choosing one
bone marrow sample from a VavCre;FF1 mouse as the calibrator. Separate calculations
were carried out for human and mouse Jak2. (B) Expression of human JAK2-V617F (left
panel), mouse Jak2 (middle panel) and ratio between human JAK2-V617F and mouse
Jak2 (right panel) in total bone marrow. Expression was measured in control mice (n =
7), VavCre;FF1 (n = 7, age 20-30 weeks), MxCre;FF1 (n = 8, 15-20 weeks after 3x pIpC
injection), or in mice transplanted with retrovirally transduced bone marrow expressing
JAK2-V617F (pMSCV-hV617F; n = 6, 20 weeks post transplantation; values corrected for
the percentage of transduced cells based on GFP expression are shown, GFP-positive
cells = 35±24%). Expression in MxCre;FF1 was significantly higher than in VavCre;FF1
samples (Mann-Whitney test, P = 0.0012). The highest levels of JAK2-V617F were
observed with retroviral transduction (P = 0.0016 vs. MxCre;FF1). A slight decrease in
expression of mouse Jak2 was noted in MxCre;FF1 compared to controls (middle panel,
P = 0.04), whereas no significant difference was found between VavCre;FF1 and
MxCre;FF1. The ratios between human JAK2-V617F and mouse Jak2 in bone marrow
were calculated from the absolute expression values of human JAK2 and mouse Jak2 that
were determined by comparison with standard curves set up from purified plasmids
containing human JAK2 or mouse Jak2. Significant differences between VavCre;FF1 and
MxCre;FF1 (P = 0.0003) and between MxCre;FF1 and pMSCV-hV617F (P = 0.0007)
were noted. All significant differences (P < 0.05) are marked by asterisks. (C)
Assessment of Cre-mediated recombination by Southern blot analysis and copy number
determination by real-time PCR. DNA from bone marrow and spleen cells was digested
with XbaI and the Southern blots of DNA fragments separated by electrophoresis were
visualized with a 32P-labeled human JAK2 cDNA probe (thick solid line). The scheme
below shows the position of XbaI restriction sites and of the probe. The expected
fragments sizes are 800 bp for the native configuration and 3’500 bp for the flipped
configuration. Vav, bone marrow or spleen from VavCre;FF1 mice; Mx, bone marrow or
spleen from MxCre;FF1 mice. The percentage of flipped transgenes (% flipped) was
determined by quantification of the flipped and native bands on a phosphorimager.
Transgene (Tg) copies were determined by real time PCR and the numbers of active
copies were calculated by multiplying with the percentage of flipped alleles. (D)
Correlation of human/mouse JAK2 mRNA ratio with the number of flipped alleles (left)
and correlation of hemoglobin with the human/mouse mRNA ratio (right). MxCre;FF1
mice received 1x, 3x or 6x injections of pIpC and were analyzed at 12 weeks. The
number of flipped alleles was determined by real-time PCR, which yielded similar results
as Southern blot analysis. VavCre;FF1 mice (age 12 weeks) were included for
comparison.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
25
Figure 6. Expression levels of JAK2-V617F in granulocytes from human patients with
MPD. (A) Expression of total JAK2 mRNA was determined by Taqman real time PCR in
purified granulocytes from healthy controls (n = 11) and patients with essential
thrombocythemia (ET; n = 25), polycythemia vera (PV; n = 49), and primary
myelofibrosis (PMF; n = 8). Values were normalized to the expression levels of βglucuronidase (GUSB) mRNA. One control was chosen as the calibrator and expression
of JAK2 set to the value of 1 to calculate the fold expression in all other samples (∆∆CT
method). Boxes represent the interquartile range that contains 50% of the values, the
horizontal line in the box marks the median and bars indicate the range of values. All
significant differences with P < 0.05 (pairwise Mann-Whitney tests) are marked with
asterisks (control vs. PV: P = 0.0084, control vs. PMF: P = 0.0003, ET vs. PV: P = 0.026,
ET vs. PMF: P = 0.0197). Note that the expression values are shown on a logarithmic
scale. (B) JAK2-V617F mRNA (left) and wild type JAK2 mRNA (right) were quantified
with allele-specific Taqman real time assays and the fold expression was calculated based
on the values shown in A. JAK2-V617F expression was significantly higher in PV and
PMF than in ET (ET vs. PV: P < 0.0001, ET vs. PMF: P = 0.0002, all other pairs: P >
0.05); n.d., not detectable. Wild type JAK2 mRNA was significantly lower in PV than in
ET or controls (control vs. PV: P = 0.0026, ET vs. PV: P = 0.0029). (C) Correlation
between JAK2-V617F mRNA and JAK2-V617F DNA in patients with ET (), PV ( )
and PMF ( ). The percentages of JAK2-V617F (%T = mutant JAK2 divided by total
JAK2) in granulocyte RNA were plotted against the percentages of JAK2-V617F alleles
in granulocyte genomic DNA for all patients studied. A strong linear correlation was
noted (linear regression, r2 = 0.97). (D) Ratios of mutant to wild type JAK2 expression in
granulocyte RNA calculated from the values shown in B (ET vs. PV: P < 0.0001, ET vs.
PMF: P = 0.001).
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Figure 1
Figure 2
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Figure 3
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Figure 4
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Figure 5
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Figure 6
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
Prepublished online December 26, 2007;
doi:10.1182/blood-2007-08-107748
Ratio of mutant JAK2-V617F to wild type JAK2 determines the MPD
phenotypes in transgenic mice
Ralph Tiedt, Hui Hao-Shen, Marta A. Sobas, Renate Looser, Stephan Dirnhofer, Jurg Schwaller and
Radek C Skoda
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Advance online articles have been peer reviewed and accepted for publication but have not yet
appeared in the paper journal (edited, typeset versions may be posted when available prior to
final publication). Advance online articles are citable and establish publication priority; they are
indexed by PubMed from initial publication. Citations to Advance online articles must include
digital object identifier (DOIs) and date of initial publication.
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.