Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Regulation of RNA and cDNA transcription from murine endogenous
Document related concepts
no text concepts found
Transcript
Regulation of RNA and cDNA transcription from murine endogenous retroviruses in immune cells Juliette ROELS Master’s dissertation submitted to obtain the degree of Master of Science in Biochemistry and Biotechnology Major Biomedical Biotechnology Academic year 2014-2015 Promoter Ghent University: Prof. Dr. Xavier Saelens Department of Biomedical Molecular Biology, Ghent University Medical Biotechnology Centre, VIB Erasmus Promoter: Prof. Dr. George Kassiotis Scientific Supervisor: Prof. Dr. George Kassiotis The Francis Crick Institute, United Kingdom Division of Immunoregulation Preface To obtain the degree of Master of Science in Biochemistry and Biotechnology, I wrote this dissertation about my research project in the lab of Prof. Dr. George Kassiotis. The content of this dissertation is of importance for further developments in the areas of immunology and (endogenous) retrovirology. It sheds more light on the cytoplasmic reverse transcription of endogenous retroviral RNA and its importance in T-cell independent B-cell activation. The bulk of this dissertation focuses on the verification of data and hypotheses from a recent publication. I am truly grateful for the knowledge I acquired and the skills and techniques I have learned while working on this project. I was able to develop scientific insights, improve my scientific thinking on the way. I value the healthy portion of criticism I adopted in approaching scientific publications. If there is one message I would like to convey; maintain a little caution when standing on the shoulders of giants. I Acknowledgements I would like to express my deepest gratitude to Prof. Dr. George Kassiotis, for giving me this project and helping me throughout with either lab work or scientific insights and ideas. I consider myself privileged having met and worked with such a brilliant scientist, his hypotheses almost always being right. I would like to thank Dr. Lucie Baudino for helping me with everything imaginable, she’s a star in the lab, can always come up with a solution, she’s always up for a brainstorm session or simply a good talk. I am indebted to the two technicians, Prisca Levy and Ula Eksmond, who taught me many of the techniques I needed and were always ready to help me out. I am indebted to them for managing the labs and keeping everything organised, even when that was not always that easy. I would further like to thank the FACS facility for their training and support, and Dunkin, the mouse facility, for taking care of our mice. I am grateful for the feedback on my presentations and this manuscript by both Prof. Dr. George Kassiotis and Dr. Lucie Baudino. I am grateful for the support I received from Prof. Dr. Saelens, encouraging me to take this opportunity. At last I would like to express my gratitude to the many people who have supported me during this time, everyone in Lab Kassiotis, my old and new friends and my family. I would like to thank my parents in particular for giving me the chance to take this amazing opportunity. Thanks to all of them this became an extraordinary experience. II Table of Contents Preface ........................................................................................................................................ I Acknowledgements.................................................................................................................... II List of Abbreviations ..................................................................................................................V Nederlandse Samenvatting.....................................................................................................VIII English summary ....................................................................................................................... IX Part 1: Introduction.................................................................................................................... 1 1.1. Introduction to endogenous retroviruses ...................................................................... 1 1.2. Retroviruses induce an innate immune response .......................................................... 3 1.3. ERV expression in physiological conditions .................................................................... 7 1.4. Role of ERVs in autoimmune diseases ............................................................................ 8 1.5. Role of ERVs in cancer ................................................................................................... 11 1.6. Research on ERVs: possibilities and limitations ............................................................ 12 Part 2: Aim of research project ................................................................................................ 14 2.1. Aim 1: The detection of cytoplasmic ERV cDNA ........................................................... 14 2.1.1. Subaim 1: The detection of spliced eMLV cDNA in the cytoplasm ........................ 14 2.1.2. Subaim 2: The detection of ERV RNA and cDNA upregulation in the cytoplasm of stimulated B-cells ............................................................................................................. 14 2.1.3. Subaim 3: high throughput analysis of cytoplasmic cDNA .................................... 15 2.2. Aim 2: The induction of MLVs in the EL4 cell line ......................................................... 15 Part 3: Results .......................................................................................................................... 16 3.1. The detection of cytoplasmic ERV cDNA ...................................................................... 16 3.1.1. Detecting spliced eMLV cDNA in the cytoplasm of B-cells .................................... 16 3.1.2. The virion hypothesis ............................................................................................. 21 3.1.3. Detecting ERV cDNA upregulation after B-cell stimulation ................................... 24 3.1.4. High throughput cytoplasmic cDNA detection ...................................................... 24 3.2. The induction of MLVs in the EL4 cell line .................................................................... 28 Part 4: Discussion ..................................................................................................................... 36 4.1. The detection of cytoplasmic ERV cDNA ...................................................................... 36 4.1.1. Spliced cDNA in the cytoplasm of B-cells............................................................... 36 4.1.2. The virion hypothesis ............................................................................................. 37 4.1.3. Detecting ERV cDNA upregulation after B-cell stimulation ................................... 38 4.2. The induction of MLVs in the EL4 cell line .................................................................... 42 4.3 Samenvatting van de discussie (Nederlands) ................................................................ 43 Part 5: Materials and Methods ................................................................................................ 47 III 5.1. Mice............................................................................................................................... 47 5.2. Cell culture .................................................................................................................... 47 5.3. q(RT-)PCR ...................................................................................................................... 47 5.4. B-cell purification and stimulation ................................................................................ 49 5.5. Flow cytometry ............................................................................................................. 49 5.6. Infectivity assay ............................................................................................................. 50 5.7. Statistical analyses ........................................................................................................ 50 References ............................................................................................................................... 51 Attachments............................................................................................................................. 59 Protocols .............................................................................................................................. 59 Statistical reports ................................................................................................................. 69 MAVS, cGAS, and endogenous retroviruses in T-independent B cell responses ................ 71 IV List of Abbreviations 18s rRNA AGS AMP anti-IgM/α-IgM APC B6 BCR BrdU BTK CARD cDNA cGAS CpG Ct DNA dNTP dsDNA dsRNA EDTA eMLV eMLV KO eMLV+ ER ERV FCS F1 FITC GAPDH GMP Gp70 HERV HIV HPRT HSV IAP IFN IFNAR1 IgG IgG2a IKK 18s ribosomal RNA Aicardi-Goutières syndrome Adenosine monophosphate Anti-immunoglobulin M Allophycocyanin C57BL/6J B-cell receptor Bromodeoxyuridine Bruton’s tyrosine kinase Caspase activation and recruitment domains Complementary DNA Cyclic GMP-AMP synthase C-Phosphate-G Critical threshold Deoxyribonucleic acid Deoxynucleoside triphosphate Double stranded DNA Double stranded RNA Ethylenediaminetetraacetic acid Ecotropic MLV eMLV knockout eMLV positive Endoplasmic reticulum Endogenous retrovirus Fetal calf serum First generation Fluorescein isothiocyanate Glyceraldehyde 3-phosphate dehydrogenase Guanosine monophosphate Glycoprotein 70 Human ERV Human immunodeficiency virus Hypoxanthine-guanine phosphoribosyltransferase Herpes simplex virus Intracisternal A-type particle Interferon Interferon-α/β subunit 1 Immunoglobulin G Immunoglobulin G2a IκB kinase V IL IMDM IRF IV LINE LPS LTR MaLR MAVS MDA-5 MHC MHCII MLV mMLV MMTV MOG MS MSRV MT-CO2 Mu-ERV-L Mus-D MyD-88 NaCl NFkB ORF PAMP PBS PCR PdbU PE pMLV Pol III Pro-IL PRR qPCR qRT-PCR RAG RAG-/RARV2 RE RIG-I RLR Interleukin Iscove's modified Dulbecco's Medium Interferon regulatory factor Intravenous Long interspersed nuclear element Lipopolysaccharide Long-terminal repeat Mammalian apparent LTR retrotransposons Mitochondrial antiviral signaling protein Melanoma differentiation-associated protein 5 Major histocompatibility complex Major histocompatibility complex class II Murine leukemia virus Modified polytropic MLV Mouse mammary tumor virus Myelin oligodendrocyte glycoprotein Multiple sclerosis MS associated retrovirus Mitochondrially encoded cytochrome C oxidase II Murine endogenous retrovirus-L Mouse Type D Myeloid differentiation factor 88 Sodium chloride Nuclear factor Kappa B Open reading frame Pathogen-associated molecular pattern Phosphate buffered saline Polymerase chain reaction Phorbol 12,13-dibutyrate Phycoerythrin Polytropic MLV DNA polymerase III Pro-interleukin Pattern recognition receptor Quantitative real-time PCR Quantitative real-time reverse transcription PCR Recombination Activating Gene RAG knockout RAG associated retrovirus 2 Retroelement Retinoic acid-inducible gene I RIG-I-like receptors VI RNA rRNA rpm RT SAHA SDS SINE SIV SLE ssDNA ssRNA STING T-ALL TI TI1 TI2 TIR TLR TRIF Tris WT xMLV Ribonucleic acid Ribosomal RNA Revolutions per minute Reverse transcriptase Suberoyl-anilide-hydroxamic acid Sodium dodecyl sulfate Short interspersed nuclear element Simian immunodeficiency virus Systemic lupus erythematosus Single stranded DNA Single stranded RNA Stimulator of interferon gene T-cell acute Lymphoblastic leukaemia T-cell independent, Thymus independent TI type 1 TI type 2 Toll-interleukin-1 receptor Toll-like receptor. TIR domain containing adaptor inducing interferon Tris(hydroxymethyl)aminomethane Wild type Xenotropic MLV VII Nederlandse Samenvatting Endogene retrovirusen (ERVs) zijn het resultaat van een occasionele retrovirale infectie van de kiembaan. Retrovirussen worden zo gefixeerd in het genoom en overgedragen naar volgende generaties. De rol ERVs spelen in zowel fysiologische als pathofysiologische condities blijft een veel besproken onderwerp. In de meeste gevallen vindt geen transcriptie van ERVs meer plaats, in sommige gevallen is het echter toch mogelijk dat ERVs opnieuw geactiveerd worden. Een recente publicatie suggereert dat ERVs zouden betrokken zijn bij de activatie van B-cellen als gevolg van stimulatie met een T-cel onafhankelijk type 2 antigeen. In B-cellen die aldus gestimuleerd worden, wordt de transcriptie van ERVs bevorderd. Zowel het volledig RNA transcript als het RNA transcript dat splicing onderging wordt dan in cDNA omgezet in het cytoplasma en daar gedetecteerd door nucleïnezuursensoren wanneer hun concentratie een bepaalde sensor specifieke drempelwaarde overschrijdt. Onder andere de factoren RIG-I-MAVS en cGAS-STING zijn betrokken bij deze signalisatie die uiteindelijk leidt tot de activatie van B-cellen. Deze studie opperde dat het mogelijk zou zijn RNA in het cytoplasma om te zetten in cDNA; dit cDNA zou de nucleïnezuursensoren dan activeren. Het blijft echter onduidelijk hoe dergelijk cDNA gegenereerd zou kunnen worden. Daarom werd hier geprobeerd de mechanismen te ontrafelen die aan de basis liggen van de cytoplasmatische reverse transcriptase activiteit. Aangezien het van cruciaal belang was voor de opheldering hiervan, was het wenselijk eerst het vermelde bestaan van cytoplasmatisch cDNA van de reverse transcriptie van spliced ecotropisch MLV (eMLV) RNA te verifiëren. Uit onze experimenten bleek het bestaan van spliced eMLV cDNA niet te kunnen worden bevestigd, ondanks het gebruik van methoden uit deze publicatie. Wat de oorzaak was van de schijnbare aanwezigheid van spliced eMLV cDNA in het cytoplasma, zoals gedocumenteerd werd in deze publicatie, is onduidelijk. Daarnaast werd bevestigd dat ERV cDNA overgeschreven van het volledige RNA transcript van strikt intracellulaire ERVs wel kon teruggevonden worden in het cytoplasma van B-cellen. Een verhoogde concentratie van dit cDNA na B-cel stimulatie kon echter niet bevestigd worden. Tot slot bleek het niveau van eMLV RNA transcriptie in onze experimenten niet overeen te stemmen met de gepubliceerde data. Verder onderzoek rond de activatie van B-cellen als gevolg van stimulatie met een T-cel onafhankelijk type 2 antigeen, en de rol die ERVs hierin spelen, is wenselijk. Een tweede focus van dit project was het onderzoeken of inductie van ERVs, met in het bijzonder MLVs, mogelijk zou zijn in de EL4 cellijn. De EL4 cellijn werd afgeleid van een muis T-cel lymfoom. Enkel de BrdU resistente EL4 cellijn bleek een hoge MLV expressie te hebben, zowel voor als na stimulatie van de cellen met BrdU. Tijdens het resistent maken van de EL4 cellijn werden deze MLVs geïnduceerd. Het bleek om een infectieus virus te gaan uit de familie van de ecotropische MLVs. Deze bevindingen zijn van belang voor verder onderzoek naar de rol die ERVs spelen bij kankerontwikkeling. VIII English summary Endogenous retroviruses (ERVs) are the remnants of sporadic ancestral germ line retroviral infections, fixated in the genome and further passed on to the next generations. Their potential role in (patho)physiological processes was investigated by many researchers. Most ERVs are silenced by the host cell, however, in some conditions these ERVs get activated again. A recent publication suggested the involvement of ERVs in the activation of B-cells in response to a T-cell independent type 2 antigen. ERVs are upregulated in B-cells that encounter such antigen. ERV RNA and both full-length and spliced ERV cDNA activate cytoplasmic nucleic acid sensors when a sensor specific threshold is exceeded. These sensors, RIG-I-MAVS and cGAS-STING, initiate a pathway that leads to B-cell activation and expansion. This study raised the intriguing possibility that cDNA can be generated from RNA in the cytoplasm. This cDNA is hypothesised to activate DNA sensors in B-cells. However, the way by which cytoplasmic cDNA can be generated remains unclear. Here, we attempted to elucidate the mechanisms that could potentially generate cDNA from cytosolic reverse transcription of RNA from ERVs. As it was critical for our approach, we first wished to confirm the reported existence of cytoplasmic cDNA from reverse transcription of spliced ecotropic MLV (eMLV) RNA in particular. We found no evidence for the existence of spliced eMLV cDNA, despite the use of methods as described in this paper. What caused this apparent existence as published in this paper remains enigmatic. Full-length ERV cDNA from ERVs with a strictly intracellular life cycle on the other hand was shown to be highly abundant in B-cells, both before and after stimulation. However, an increase in abundance of ERV cDNA after stimulation of B-cells could not be detected in our experiments. Finally, the levels of ERV RNA expression deviated significantly from the data in the paper. Further research on the activation of B-cells by T-cell independent type 2 antigens, and the role ERVs play herein, is desirable. A second focus of this project was to study whether induction of ERVs, and MLVs in particular, was possible in the EL4 cell line. The EL4 cell line is a murine T-cell lymphoma derived cell line. Only in the EL4 BrdU resistant cell line MLVs seemed highly abundant, both before and after BrdU stimulation. In the process of making the EL4 cells BrdU resistant, ERV expression was induced. The induced MLV in question was found to be part of the eMLV family and was shown to be infectious. These findings are important for the use of this cell line to study ERV induced cancer. IX Part 1: Introduction Part 1: Introduction 1.1. Introduction to endogenous retroviruses Not so long ago, scientists believed that the majority of the genomic code was made up of so called “junk DNA”, non-coding DNA without function. As research and scientific methods improved over the years, it became clear that most of this “junk DNA” is involved in important regulating processes. Short and long non-coding RNAs, transfer RNAs, ribosomal RNA, they all play a pivotal role in the determination of the expression pattern of cells. Endogenous retroviruses (ERVs) are well represented in the genome of most, if not all, vertebrate species (Herniou et al, 1998). They are the remnants of sporadic ancestral germ line retroviral infection; as such, they are fixated in the genome and are passed on to the next generations. The older the integration event, the more mutations these ERVs have gathered (figure 1.1). This led to the assumption that ERVs would be “junk DNA” as well; that is, they would have no function or consequence for the host. However, there is some evidence that ERVs are not merely functionless remnants but actually gathered or retained function over time, in both physiological and pathophysiological conditions. ERVs are member of a large family of retroelements (REs). REs are divided into two big subgroups; REs with long terminal repeats (LTRs) and REs without. REs without LTRs consist of short interspersed nuclear elements and long interspersed nuclear elements (SINEs and LINEs). A second group, characterised by the presence of LTRs, consists of three major classes of endogenous retroviruses. The subdivision is based on the exogenous retroviruses they were originally derived from (Jern et al, 2005; Wilkinson et al, 1994), which is assessed through homology with current retroviruses. Class I ERVs are most similar to gammaretroviruses (such as the Murine Leukaemia Virus, MLV) and epsilonretroviruses. Class II ERVs cluster with lentiviruses (e.g. HIV, SIV) and alpha-, beta- and deltaretroviruses. Class III ERVs mostly share similarity with spumaviruses. However, especially in class II ERVs, the similarity with the respective exogenous retrovirus is often reduced to a minimum. Retroviruses, from which ERVs are derived, are single-stranded RNA viruses. Upon infection of a host cell, the ribonucleoprotein complex containing two copies of the single-stranded viral RNA is released in the cytoplasm, the viral RNA is then reverse transcribed by reverse transcriptase. This reverse transcriptase was packed together with the RNA in the viral particle. Reverse transcription results in a single-stranded DNA. The same reverse transcriptase can turn this single-stranded DNA into double-stranded DNA. Double-stranded DNA can integrate into the host chromosome with the help of integrase, a viral enzyme, or stay episomal. When this integration occurs into the DNA of a germ cell, the virus can become fixated in the genome and is then called endogenous. Once dsDNA is formed and integrated, the virus relies on the host transcription machinery to have its genes transcribed. The full transcript contains a packaging signal ψ. Virally encoded proteins provide the building blocks of a viral particle, only transcripts that have a packaging signal will be packed inside this viral particle (Rein, 1994). All exogenous retroviruses have some well-defined genomic elements in common. These are genes necessary for viral replication: the gag, pro, pol and env genes. Gag is transcribed and 1 Part 1: Introduction Figure 1.1. Model of the endogenous retroviral life cycle. An exogenous retrovirus integrates in the genome of the host cell as part of its life cycle. From its integration site, the virus can be transcribed by the host machinery to create new viruses. New viral progeny can re-infect the same or other cells, with new integrations as a consequence. When this integration occurs in a germ cell, the virus can become fixated in the genome and be passed on to following generations (endogenisation). Recombination with another integrated retrovirus can result in a new chimeric retrovirus. Any endogenous retrovirus is subject to mutations as there is no selective pressure. The env gene is often lost over time while the pol gene remains the most conserved. An increase in copy number is observed together with the loss of the env gene. Without the env gene the endogenous retrovirus enters an internal life cycle; new integrations in the same cell still occur. The earlier the retrovirus was integrated, the more mutations it has gathered. Often the virus is not even recognisable anymore. Mutation and recombination events result in many solo-LTRs left in the genome. Figure adapted from Yongming Wang et al. Genome Res. 2010; 20:19-27 (Wang et al, 2010). translated into core proteins of the viral particle. Pro is responsible for the proteolytic processing of many viral proteins. Pol is the most important of retroviral genes; it codes for reverse transcriptase and integrase and is the most conserved (McClure et al, 1988). The envelope proteins of the viral capsid are coded by the env gene. The env gene is generally the only retroviral gene that contains introns in simple retroviruses, the open reading frames of gag and pol consist mostly out of exons. The retroviral genes are flanked by two LTRs, which can function as a promotor and enhancer for retroviral transcription. The LTR region also contains hormone responsive elements which can influence transcription. Recombination between two LTRs is a frequent phenomenon, often resulting in a so called solo LTR, where the insert is reduced to a single LTR. In many cases, the retroviral genes (gag, pro, pol and env) and their LTRs can still be recognised in ERVs. In general, the env gene is often most affected by mutations. This implies that most ERVs are not capable of forming infectious viral particles since they lack the viral envelope protein. The pol gene is often least affected, and is therefore used to compare the 2 Part 1: Introduction ERVs with their current exogenous retroviruses and to classify the ERVs accordingly (McClure et al, 1988; Xiong & Eickbush, 1990). It is often seen that some open reading frames (ORFs) of ERVs are still transcribed and sometimes even translated. When the env gene is affected, ERVs are not able to follow an extracellular life cycle as exogenous retroviruses. If all the other essential genes are still intact, an intracellular life cycle can occur. The transcription and translation of reverse transcriptase is crucial in this process. This enzyme is used to convert the viral RNA into cDNA. The cDNA can integrate in a new position in the genome of the same host cell. By recombination with similar ERVs (Young et al, 2012a) or exogenous retroviruses (Weiss et al, 1973), ERVs that have lost the capacity to infect cells can regain this function. Figure 1.1 gives an overview of the life cycle of endogenous retroviruses. Some murine ERVs have been found to be replication competent; examples are the Murine Leukaemia Virus (MLV) and the Mouse Mammary Tumour Virus (MMTV) (Stocking & Kozak, 2008). Replication competent ERVs have the potential to infect other cells, their env gene is still functional. These viruses are often subdivided by tropism, the ability to infect different cell types. Tropism is dependent on the surface glycoproteins expressed by the virus, encoded by the env gene. The glycoproteins expressed on the surface determine which cell receptors can be bound. In the case of MLVs, ecotropic MLVs (eMLVs) can infect only murine cells; xenotropic MLVs (xMLVs) can infect non-murine but not murine cells; polytropic and modified polytropic MLVs (pMLVs and mMLVs) can infect a broad range of murine and non-murine cell. (Goff & Lobel, 1987; Stoye & Coffin, 1987). Polymorphisms in the receptor of pMLV and mMLV are responsible for slight differences in host range between them (Stoye & Coffin, 1987). No replication competent ERVs have yet been found in the human genome (Belshaw et al, 2004; Hancks & Kazazian, 2012). Other murine ERVs, such as intracisternal A-type particle (IAP), Mouse Type D (Mus-D) or murine endogenous retrovirus-L (Mu-ERV-L) adapt a strictly intracellular life cycle (Dewannieux et al, 2004; Ribet et al, 2004; Ribet et al, 2007). They have lost the functionality of the env gene and with that also the potential to infect other cells. Reverse transcriptase typically becomes only activated upon entry of a new host cell. These strictly intracellular ERVs have found a way to circumvent this restriction and can fulfil the retroviral life cycle inside one host cell. Roughly 40 % of the human genome is made up of retroelements, 8 % of those are ERVs, called Human ERVs or HERVs, including the MaLR family (Lander et al, 2001; Smith, 1993). The integration of retroviruses in the human genome dates mostly from 40 million years ago (Medstrand & Mager, 1998). However, there are some examples of very recent and very old integrations (Bannert & Kurth, 2004; Hughes & Coffin, 2005; Lavie et al, 2004). New genomic integrations result in a higher genetic variability. Too much variability forms a risk; however when there isn’t enough variation in the genome this will counteract evolution. One can see that a proper regulation of ERVs is therefore pivotal to keep a cell viable. 1.2. Retroviruses induce an innate immune response Even if the retroviral life cycle cannot be completed by ERVs, there is often still some transcription and translation detected. Proteins, peptides and nucleic acids from ERVs share characteristics with exogenous retroviruses. Because of this homology, it is highly probable that the immune system gets involved and an immune response could be elicited. First, a 3 Part 1: Introduction detailed description of the detection and immune response to exogenous retroviruses is given. Upon infection with an exogenous retrovirus, several compounds of the immune system get activated in order to produce an adequate response. Pathogen Associated Molecular Patterns (PAMPs) of the virus activate pattern recognition receptors (PRRs) of the cell. Activated PRRs induce signalling pathways that ultimately give rise to an immune response. Toll like receptors (TLRs) are the first discovered and best known PRRs. TLRs all consist of three domains (O'Neill et al, 2013). The pathogen recognition domain is located extracellular or towards the endosomal lumen depending on their location on the membrane of the either the cell or the endosome. A transmembrane region connects the recognition domain with the intracellular signal transmitting domain, called toll-interleukin-1 receptor (TIR) (O'Neill & Bowie, 2007; O'Neill et al, 2013). Toll like receptors often form homo- or heterodimers upon activation. TLRs differ in terms of location (on the cell surface or in the endosome), the pattern for recognition and the way of signal transmission. TLR4, TLR2/1 and TLR2/6 are found on the cell membrane whereas TLR 3, 7, 8 and 9 are endosomal (Kawai & Akira, 2010). TLRs can either signal through a ‘myeloid differentiation primary response 88’ (Myd88) dependent pathway or via a ‘TIR domain containing adaptor inducing interferon’ (TRIF) dependent pathway (figure 1.2). These activate a signal transduction cascade which eventually leads to the expression of inflammatory cytokines and chemokines through transcription factors such as NFkB and interferon regulatory factor 3 and 7 (IRF3/7) (figure 1.2). TLRs are prominently, but not exclusively, found in immune cells. They can recognise viral invaders by dsRNA, ssRNA or unmethylated CpG DNA detection. The presence of dsRNA is a common feature to many viruses; dsRNA either constitutes the genome of dsRNA viruses or occurs as an intermediate in the life cycle of ssRNA or DNA viruses. Viral ssRNA can be detected by ssRNA detecting TLRs in the endosome. The recognition is based on high GU and AU content in the viral sequence (Diebold et al, 2004; Heil et al, 2004; Lund et al, 2004). Unmethylated CpG is another feature of bacterial and viral DNA which can distinguish them from host DNA (Hemmi et al, 2000; Lund et al, 2003). PRRs are not restricted to the cell or endosome membrane; retinoic acid-inducible gene I (RIGI)-like receptors (RLRs) are an example of PRRs active in the cytoplasm (Gurtler & Bowie, 2013). RIG-I and MDA-5 are examples of RLRs, these are cytosolic sentinels for viral dsRNA. Upon detection of dsRNA, mitochondrial antiviral-signalling protein (MAVS) is recruited to the CARD domain of RIG-I or MDA-5 (Loo & Gale Jr, 2011). In the end, this leads to type 1 interferon production, which elicits an immune response (figure 1.2). A PRR that senses cytosolic DNA is cyclic GMP-AMP synthase (cGAS). When double-stranded DNA is detected by cGAS, cyclic GMP-AMP is produced (Sun et al, 2013) and activates a sensor called stimulator of interferon gene (STING) (Burdette et al, 2011). Like TLR7, cGAS signals through IRF3 which results in type 1 interferon production and immune activation. 4 Part 1: Introduction Figure 1.2. Schematic representation of nucleic acid sensing PRRs. Nucleic acid sensing PRRs are either present in the cytosol or are endosomal. TLR3, 7, 8 and 9 are endosomal PRRs. All endosomal pathways converge into two, either signalling through TRIF or MyD88. In the cytosol, MDA5 and RIG-I are responsible for dsRNA detection. They both signal through MAVS. There are many cytosolic sensors recognising dsDNA. One sensor of importance for cytosolic ERV detection is cGAS. cGAS produces cGAMP that is recognised by STING. All nucleic acid sensing PRRs result in activation of transcription factors; predominantly IRF3, NFkB and IRF7. When a sufficient amount of these transcription factors is present, type 1 interferons, inflammatory cytokines and chemokines are produced by the cell as a defence mechanism to the increased amount of nucleic acids. Nucleic acids detected by PRRs can be both of exogenous and endogenous origin. Figure adapted from Gurtler et al., Trends in Microbiology, 2013, Vol. 21, No. 8. (Gurtler & Bowie, 2013). A major breakthrough in the unravelling of PRR involvement in ERV regulation in mice was reached simultaneously by Young et al. and Yu et al. in 2012. In the latter study, the expression pattern of mice with knockouts for TLR3, 7 and 9 was investigated (Yu et al, 2012). When a triple knockout of these TLRs is made, ERV viraemia is seen. At later stages, this results in Tcell acute Lymphoblastic leukaemia (T-ALL) due to the reintegration of ERVs in the neighbourhood of proto-oncogenes. Yu et al. made the hypothesis that fully infectious ERVs would be sporadically and spontaneously produced by recombination of its defective sites with a compatible exogenous retrovirus or by random mutations. TLR3, 7 and 9 would not only be responsible for detecting exogenous retroviruses, but would also be of importance to keep these spontaneously activated ERVs under control and prevent them from inducing 5 Part 1: Introduction tumours. The publication of Young et al. in 2012 complemented part of these findings; they found that TLR7 and MyD-88 knockout mice had a considerably higher expression of eMLV, supporting this hypothesis. Nucleic acid detection is however only a small component of the pathology detection system active in a cell. Antigens are detected by B-cells. B-cells can follow two pathways towards an efficient immune response, the T-cell dependent or the T-cell independent pathway. In the first case, the T-cell dependent pathway, a B-cell that has detected a protein antigen requires a T-helper cell stimulus in order to evolve into an antibody producing plasma cell or memory B-cell. After detection, the B-cell processes the antigen to present it on the surface. The major histocompatibility complex (MHC) on the B-cell presents the antigen to the outside of the cell and acts as a receptor for T-helper cells. Next to MHC is, among others, the CD40 receptor important for T-helper cell recognition. When a T-helper cell recognises an activated B-cell, it signals to the B-cell using interleukins (IL-2, IL-4 and IL-5). In response to this, B-cells will turn into IgG producing plasma B-cells or memory B-cells. B-cells can also be activated without the help of a T-cell. This pathway is called T-cell independent (also known as thymus independent, TI). Antigens able to induce a T-cell independent pathway are called TI antigens type 1 or 2 (TI1 or TI2). LPS and B-cell mitogens are examples of TI1 antigens. These are able to induce B-cells in an unspecific or polyclonal way. TI2 antigens on the other hand, are characterised by repetitive epitopes. Polysaccharides and other carbohydrate antigens are the most common TI2 antigens. TI2 antigens cause crosslinking of B-cell receptors on the surface of the cell. When B-cell receptors cluster upon TI2 antigen recognition, a signal is transmitted to Bruton’s tyrosine kinases (BTKs) (Moreno-Garcia et al, 2006). BTKs induce the transcription factor NFkB. What happens downstream of NFkB activation was recently studied by the research group of Beutler (Zeng et al, 2014). A large amount of mice with mutations in genes involved in immunity were screened for antibody production against a type II antigen. The knockouts for MAVS, cGAS and STING had significant lower amounts of antibody production. As mentioned earlier, these genes are involved in nucleic acid sensing pathways (figure 1.2). This was a peculiar finding; this suggests that the sensors involved in this pathway must be activated by nucleic acids in wild type conditions but are not able to be activated any longer in the knockouts. As the cells were not treated with any nucleic acids, the source of activation in wild type cells must be originating from within the cells. Co-immunoprecipitation experiments revealed that endogenous retroviral RNA binds to RIG-I which signals to MAVS. With regard to the detection of DNA, it is suspected that when ERV RNA is translated, among other proteins, reverse transcriptase is expressed. RT can reverse transcribe ERV RNA into cDNA. This ERV cDNA can then be detected by the cGAS cytosolic receptor, which signals to STING. Given this data, it seems highly probable that NFkB induces ERV expression (figure 1.3) which then acts as an innate adjuvant to the activation of B-cells to become antibody producing plasma cells. In this paper by Zeng et al., existence of spliced cDNA (i.e. processed and reverse transcribed RNA) of two ERVs, MLV and MMTV, is shown. It has never been shown before that spliced cDNA exists in the cytoplasm. It would be very interesting to investigate this further, as to date no mechanism is known that could specifically reverse transcribe certain ERVs. Our current knowledge directs that, for reverse transcriptase to be active, it should be packed 6 Part 1: Introduction Figure 1.3. B-cell receptor cross-linking upon activation with a TI2 antigen results in ERV transcription. Crosslinking of the B-cell receptors (BCR) upon activation with a TI2 antigen induces ERV transcription via the activation of the transcription factor NFkB. ERV RNA would be detected by a cytosolic RNA sensor, RIG-I, that activates MAVS. Reverse transcribed ERV RNA would also activate the cytosolic DNA sensor pathway via cGAS that activates STING. The signals from both sensors would act as an innate adjuvant, mediating the activation and expansion of B-cells for antibody secretion. Figure adapted from Emilie K. Grasset, and Andrea Cerutti, Science 2014; 346:1454-1455 (Grasset & Cerutti, 2014). inside a viral particle together with the RNA where it can be activated by proteolytic maturation from the gag polyprotein (reviewed in Konvalinka et al, 2015). Only upon infection of a new cell, RT becomes activated and can reverse transcribe RNA into cDNA. The discovery of spliced cDNA in the cytoplasm contradicts this assumption. Another recent publication (Shimizu et al, 2014) shows the existence of cDNA from non-retroviral virus infection in human cells. Although this is not (endogenous) retroviral cDNA, it supports the evidence for cDNA existence in a cell. 1.3. ERV expression in physiological conditions Endogenous retroviruses, although very similar to exogenous retroviruses, do not elicit an antiviral immune response in physiological conditions. This shows that PRRs are capable of making a distinction between exogenous DNA or RNA and endogenous retroviruses. One would expect that, since there is no immune response, ERVs are simply not expressed. For humans, this is true for some tissues or conditions; there is evidence however of significant ERV gene expression and translation in others. Mostly during development but also later on in life, expression of ERVs, however often low, is seen in several tissues (de Parseval & Heidmann, 2005). There is a significant difference for the expression of different ERVs, with some ERVs highly expressed and others barely detectable. The most pronounced expression is found in the placenta. It is hypothesised that the expression of ERV genes in the placenta has a specific role in the formation of the syncytiotrophoblast (Esnault et al, 2008; Venables et al, 1995). The env genes have next to their function to intrude a cell also the capacity to merge cells together; trophoblast cell merger is needed to create the syncytiotrophoblast layer of the placenta. In 7 Part 1: Introduction humans, the gene involved is an envelope gene called syncytin. It is more than likely that this gene with viral origin has gained an important function in the development of the placenta in humans and other mammals. Also in other organs or tissues expression of some ERV genes can be found. In most cells a baseline expression is seen (de Parseval & Heidmann, 2005). The fact that they remained active since their original integration millions of years ago means that they are probably giving a selective advantage to the host. There is a suspected role for them in several physiological processes. The enzyme amylase for example, was in humans only expressed in the pancreatic glands. Over time, the amylase gene has become activated in the salivary glands by the nearby insertion of an ERV that changed the tissue specificity (Meisler & Ting, 1993). The LTRs of ERVs have transcriptional regulation properties, making them competent to activate nearby genes. The first time the importance of ERV expression was acknowledged in a pathogenic defence process was with the discovery of the mechanisms of resistance against Friend Virus infection in mice (Best et al, 1996; Ikeda et al, 1985). This was the first time it was shown that expression of certain ERV genes can lead to a higher resistance against similar exogenous retroviruses (and ERVs which have become infectious again, as discussed later on). The suspected mechanism has since been described by several authors as “receptor interference” or “superinfection resistance” (Nethe et al, 2005; Rasmussen, 1997). The ERV env gene is of importance in receptor interference. The env protein is located on the surface of the viral particle, its function is to bind to a receptor on a target cell, which is the first step of any infection process. When an ERV env protein is expressed which binds to the same receptor as an exogenous virus, a competitive inhibition is established, resulting in a reduced infectivity of the exogenous retrovirus (Nethe et al, 2005). Even though some very important physiological mechanisms rely on ERVs, there is also a suspected role for ERVs in several pathological conditions. There are three ways in which ERVs could induce pathology: first, by the detection of ERV nucleic acids and a following immune response; second, by the expression of retroviral proteins and third by the random insertion of ERVs in the genome. The potential role for ERVs in autoimmunity and cancer is discussed below. 1.4. Role of ERVs in autoimmune diseases The immune system creates self-tolerance during its development. B-cell progenitors in the bone marrow are checked for antigen-binding with self-antigens; if the antibody expressed by the B-cell is binding too well to a self-antigen, two pathways can be followed. Either the self-reactive progenitor is destructed via apoptosis or recombination occurs. In the latter, enzymes of the recombination activating genes (RAGs) become active and induce doublestranded breaks. Mice lacking RAG-1 lack any mature B- or T-cells (Mombaerts et al, 1992). The double-stranded breaks are a prerequisite for V(D)J recombination. Once recombination has occurred, the progenitor cell is tested for self-reactivity again. When no self-reactivity is shown, the progenitor cell can develop further and enter the circulation to become a mature immune cell. A similar process is followed by T-cells during their maturation. T-cells mature in the thymus before they are released in the circulation. Failure of the immune system to discern self-antigens from nonself-antigens is known as autoimmunity. 8 Part 1: Introduction Systemic lupus erythematosus (SLE) is an autoimmune disease characterised by high levels of antibodies against a variety of self-antigens. This results in systemic inflammation which shows as a skin rash, arthritis, kidney problems, loss of blood cells and so forth. A genetic inheritance factor is significant but is not sufficient to cause SLE; there is a strong environmental factor playing as well. The involvement of ERVs in SLE (as in other autoimmune diseases) has long been debated. Lupus-prone mice spontaneously develop autoantibodies against serum retroviral envelope gp70 (Izui et al, 1979). gp70 immunocomplexes (gp70 IC) are found in the circulation close to the onset of renal disease and within diseased glomeruli of lupus mice. Several genetic studies have revealed a remarkable correlation of serum levels of gp70 IC with the development of severe lupus nephritis (Izui et al, 1981; Vyse et al, 1996), further supporting the pathogenic role of gp70 IC in murine SLE. Cross-activation of autoreactive B- or T-cells by exogenous (pathogenic) epitopes which are similar to endogenous epitopes is the cause of molecular mimicry. This situation can cause a systemic autoimmune reaction through epitope spreading. Viral infections, especially the Epstein Barr Virus, have been linked to SLE. ERV proteins share the same epitopes with many exogenous retroviruses. If exogenous viruses can cause autoimmunity through molecular mimicry, it seems likely that also endogenous retroviruses are capable of doing so. It was indeed found that some autoantigens that are involved in lupus are homologous to ERVs in part of their sequence and structure (Perl et al, 1995). Also for rheumatoid arthritis significant results have been obtained, supporting this molecular mimicry hypothesis for ERVs (Freimanis et al, 2010). Multiple sclerosis (MS) is another autoimmune disease long expected to be linked to ERVs. Many viral strains can be isolated from patients with MS. A remarkable discovery was the reemergence of a human endogenous retrovirus as a fully infectious virus. This virus, called MS associated retrovirus or MSRV, has been isolated from many patients with MS (Perron, 1998). To date however, it is not clear whether the re-emergence of endogenous retroviruses is a cause or a consequence of multiple sclerosis. In 2013, Perron et al. showed the involvement of TLR4 in the activation of the innate immune system in a study to find a better mouse model for multiple sclerosis (MS) (Perron et al, 2013). It was shown that the activation of MSRV envelope protein together with myelin oligodendrocyte glycoprotein (MOG) peptide can induce a pathology which is similar to the pathology of MS. This data suggests that the higher expression of HERVs in MS might be a cause rather than a consequence of the disease. The previous examples show how ERVs can be involved in an immune related pathology. In physiological conditions however, ERV expression is not (fully) ceased. It has to be unravelled how the immune system can handle this basal level of ERV expression without being activated. Dysregulation of this mechanism might well be at the root of a plethora of autoimmune diseases. PRRs probably operate with a threshold; they are activated the same by ERVs as by retroviruses, the only difference is the amount of nucleic acids. ERV nucleic acids are seen by the PRRs as “base line”; when a cell is infected with an exogenous retrovirus on the other hand, PRRs will sense a higher amount of these nucleic acids. When the amount is high 9 Part 1: Introduction enough to exceed the PRR specific threshold, the PRR will be activated and an immune response elicited (figure 1.4) (Volkman & Stetson, 2014). An example to back the threshold hypothesis of ERV tolerance and yet another example of ERV involvement in autoimmune diseases was found studying the molecular pathways behind the pathology of the Aicardi-Goutières syndrome (AGS). AGS is a rare autoimmune disease characterised by interferon type 1 dysregulation resulting in a skin inflammation combined with neurological dysfunction and psychomotor retardation (Aicardi & Goutieres, 1984; Lebon et al, 1988). Some genes were found to be strongly related to AGS pathology. Remarkably, the genes involved in nucleic acid sensing pathways are overrepresented among the involved genes. TREX1, RNase H2 and SAMHD1 were found most significant in their correlation with AGS (Crow & Rehwinkel, 2009; Rice et al, 2009; Rice et al, 2012). Mutations in TREX1, an enzyme responsible for breakdown of dsDNA in the cytosol, are strongly related to AGS (Crow & Rehwinkel, 2009). When accumulating DNA is purified from TREX1 deficient cells, one can see enrichment in endogenous DNA including a substantial part of ERVs (Stetson et al, 2008). This suggests a role for TREX1 in the breakdown of endogenous nucleic acids and ERVs. When TREX1 is defective, DNA that is not broken down can be detected by nucleic acid sensors signalling through STING (Gall et al, 2012; Stetson et al, 2008). STING activation results in the expression of type 1 interferons, which is causing the AGS pathology. When the cytoplasmic DNA sensor cGAS, that activates STING, is knocked out in TREX1 deficient cells, no increase in interferon type 1 induced genes can be detected (Ablasser et al, 2014). SAMHD1 on the other hand was found to deplete the dNTP source used by reverse transcriptase (Goldstone et al, 2011; Powell et al, 2011). This has an influence on the susceptibility for viral spread from exogenous origin, but certainly also for the replication of endogenous retroviruses. This mechanism has been thought to play a pivotal role in the host control of ERVs. Mutations in this gene lead to a higher amount of ERV sequences in the cell and ultimately result in an interferon response and AGS (Rice et al, 2009). A basal level of DNA does not activate the sensors. Only when a higher amount of DNA circulates in the cell, the DNA sensors send out a signal. RNA sensors however, are activated as soon as some RNA is detected (figure 1.4). This difference explains why retro- and DNA viruses are able to reside in a latent infection state in the cells while no RNA virus has been seen capable of doing so. DNA viruses could even have developed a system to raise the threshold of DNA sensors, which results in a higher amount of virus that can stay undetected and thus not evoke an immune response for clearance. DNA sensors don’t DNA is, unlike RNA, detected independent from its sequence (Civril et al, 2013). Sensors like RIG-I, detecting dsRNA are expectedly more specific and can distinguish exogenous viral RNA from endogenous RNA (Goubau et al, 2013). When sensors like cGAS would not tolerate small amounts of DNA, this would cause an unwanted inflammatory response, as is the case in AGS, where damage in different links in the DNA sensing pathway can cause pathology. 10 Part 1: Introduction Figure 1.4. Endogenous retroelements activate the DNA-sensing pathway in AGS. Enzymes related to the AGS pathology keep the amount of endogenous nucleic acids under control. DNA sensors detect these nucleic acids when they are above a certain threshold. If the concentration of nucleic acids exceeds this threshold, the DNA sensors will evoke an immune response. In the AGS pathology, endogenous retroelements are present in a concentration above the detection threshold, firing constant signal to the immune system. Latent infection with a DNA virus could be responsible for the lowering of sensitivity of the DNA sensors. This allows a higher amount of latent virus in without being detected and is thus beneficial for the virus. RNA sensors such as RIG-I on the other hand do not operate with a threshold. They are expectedly more specific and can distinguish exogenous viral RNA from endogenous RNA. HSV: herpes simplex virus. Figure adapted from Volkman et al 2014, Nature Immunology volume 15 number 5 (Volkman & Stetson, 2014). 1.5. Role of ERVs in cancer Whether ERVs are also involved in the process of cancer development has remained an unresolved but highly debated question. It has long been known that exogenous retroviruses are capable of initiating cancer. As stated before, in mice some ERVs are known to be replication competent; examples are MLV and MMTV (Stocking & Kozak, 2008). This raised the question if these viruses would also be able to induce cancer. Thanks to extensive mouse breeding, it became obvious that when these viruses are replication competent, they are capable of transforming cells, leading to leukaemia and mammary tumours respectively (Cardiff & Kenney, 2011; Weiss, 2006; Weiss, 2013). The most common mechanism of transformation is the same as with infectious exogenous retroviruses: via insertional mutagenesis. Insertional mutagenesis of retroviruses can induce the process of cancer development in two ways. One way is to disrupt a tumour suppressor gene; the other way is to induce an oncogene. For this mechanism to apply to endogenous retroviruses, replication competent virus needs to be made and new somatic integrations should be found. These polymorphic somatic integrations are indeed found to arise spontaneously in several mouse strains (Stocking & Kozak, 2008). In fact, replication competent ERVs are the cause of the high variability between these different mouse strains. Up to 1 in 10 of the phenotypes that arose spontaneously in mice are caused by insertional mutagenesis of an ERV (Maksakova et al, 2006; Stoye et al, 1988). In humans, to date, no replication competent endogenous retrovirus has been found (Belshaw et al, 2004; Hancks & Kazazian, 2012). However, that does not exclude the potential involvement of HERVs in cancer development. The upregulation of certain HERVs has been 11 Part 1: Introduction found in many cancer tissues (Wang-Johanning et al, 2001; Yi et al, 2004; Yi et al, 2006). A potential pathogenic mechanism of replication defective ERVs lies in its remaining intact ORFs. These are translated into proteins that are recognised as self by the immune system and there are many examples of expression in physiological conditions. However, some viral proteins (e.g. Rec and Np9) from ERVs were shown to be expressed solely in tumour tissue and seem to have tumour-promoting effects (Meisler & Ting, 1993). Also the syncytin genes were seen activated again in tumour tissues and could have an important role in metastasis (Bjerregaard et al, 2006; Duelli & Lazebnik, 2003). As described above, these genes are derived from retroviral env genes and are important for placental development, mediating cell fusion. To date, it remains unclear whether tumour specific ERV expression is a cause or a consequence of transformation and metastasis as the entire expression pattern of cancer cells is disturbed. However, these examples lean towards a causative role with a welldescribed potential mechanism of action, namely the induction of metastasis. Nevertheless, ERVs can play a role in oncogenesis without even producing intact RNA transcripts. The LTRs that are characteristic for ERVs can serve as the docking site for many transcription factors. If the ERV is inserted in the proximity of an oncogene, it can activate this oncogene with tumour formation as a result. This occurred, for example, in several cases of Hodgkins Lymphoma: the loss of epigenetic silencing of the ERV MaLR LTR resulted in activation of the CSF1R oncogene downstream of this LTR (Lamprecht et al, 2010). However, the LTR is also a good docking site for p53, one of the best known tumour suppressors (Wang et al, 2007). The role of ERVs in cancer therefore seems dual. A last mechanism through which ERVs could lead to malignant tissue formation is homologous recombination. ERVs have repetitive inserts in the genome which are prone to non-allelic homologous recombination and chromosomal translocations (Feschotte & Gilbert, 2012; Hughes & Coffin, 2005; Jern & Coffin, 2008). Genomic instability is one of the hallmarks of cancer, a prerequisite for tumour development. 1.6. Research on ERVs: possibilities and limitations The involvement of ERVs in many physiological and pathological conditions is often indicated but seldom proven. This is in part because the study of ERVs and their function is complicated by the inability to create proper knockout models. Firstly, the amount of inserted copies of an ERV makes it hard to make a full knockout. Secondly, also the redundancy between the different ERVs adds to the difficulty of creating a knockout model. In mice there is currently only one known MLV that is present in a single copy: ecotropic Murine Leukaemia Virus 2 (eMLV2) (Young et al, 2012b). This makes this ERV an interesting target for study as a knockout model can be created. However, the redundancy of other ERVs remains a caveat. For these reasons, reverse genetic techniques are rarely applied to study ERVs. Since overexpression approaches fail for the same reason, one tries to stimulate ERV expression by circumventing epigenetic silencing. The chemical bromodeoxyuridine (5-bromo-2′deoxyuridine, BrdU) has been used to release silencing by methylation in the study of endogenous retroviruses in mammalian cells (Aaronson et al, 1971; Lowy et al, 1971). This thymidine analogue cannot be silenced by methylation when incorporated in the cells as the bromo group interferes with the methylation site. As such, it is possible to observe the consequences of ERV expression in cell culture. In vivo models for study of ERVs can be made by injecting an ERV inducing agent in mice (Ayukawa et al, 1979). Another interesting mouse 12 Part 1: Introduction model for the study of ERVs is the RAG-/- mouse (Mombaerts et al, 1992). This model lacks any mature T- or B-cells. It was shown that the ERV eMLV becomes fully infectious in these mice (Young et al, 2012a). This virus was used to make a murine cell line with infectious eMLV (Young et al, 2012a). These cell lines and animal models make it possible to study the expression profile of ERVs and the potential consequences of its dysregulation. These models will help elucidate the involvement of ERVs in several physiological and pathological conditions. 13 Part 2: Aim of Research Project Part 2: Aim of research project 2.1. Aim 1: The detection of cytoplasmic ERV cDNA The research group of Beutler recently demonstrated that activation of B-cells in response to a T-cell independent type 2 antigen leads to increased transcription of ERVs; the higher abundance of ERV RNA and cDNA is detected by cytoplasmic nucleic acid sensors RIG-I-MAVS and cGAS-STING (Zeng et al, 2014; in attachment). These sensors start a pathway that results in B-cell expansion and antibody production. The aim of this project is to elucidate the mechanisms that could potentially generate cDNA from cytosolic reverse transcription of RNA from ERVs. As it was critical for our approach, we first wished to confirm the reported existence of cytoplasmic cDNA from reverse transcription of ecotropic MLV (eMLV) RNA in particular. 2.1.1. Subaim 1: The detection of spliced eMLV cDNA in the cytoplasm Data from the paper by Zeng et al. documented the existence of cDNA of the spliced envelope gene of eMLV and MMTV in the cytoplasm. This finding suggests that reverse transcriptase is active in the cytoplasm and is reverse transcribing spliced RNA into cDNA. We would like to unravel the mechanisms involved in such cytoplasmic reverse transcription. There are several questions to be answered: Can the detection of spliced eMLV cDNA in the cytoplasm be confirmed? If spliced eMLV cDNA is found: is this reverse transcribed in the cytoplasm or is this a result of the mispackaging of spliced mRNA into a viral particle? Reverse transcriptase is only known to be active when packed into virions, it could be that the found spliced cDNA was not reverse transcribed in the cytoplasm but in the nucleoprotein complex of virions, if they are produced. Murine cells are known to produce a small amount of eMLV virions packed with two full-length (i.e. unprocessed and not spliced) copies of ERV RNA. Spliced ERV RNA does not contain a packaging signal for packaging in the virion. It could however be that spliced RNA of the env gene of eMLV or MMTV was mistakenly packed into virions and as such reverse transcribed. When found that spliced RNA is indeed reverse transcribed in the cytoplasm, one can asks if reverse transcriptase specifically reverse transcribes this RNA or if any RNA present in the cytoplasm would be reverse transcribed. These questions will be answered one by one, depending on the results of the previous question. 2.1.2. Subaim 2: The detection of ERV RNA and cDNA upregulation in the cytoplasm of stimulated B-cells The publication by Zeng et al. states that upregulation of ERVs initiates B-cell activation in response to a T-cell independent type 2 antigen. The aim is to confirm this hypothesis by looking for an evidential increase in ERV expression after B-cell activation. Previous obtained data on ERV expression contradict the figures in the paper by Zeng et al., therefore, validation is required. 14 Part 2: Aim of Research Project 2.1.3. Subaim 3: high throughput analysis of cytoplasmic cDNA If cytoplasmic ERV cDNA is upregulated after B-cell stimulation this could be of functional importance. The aim is to record the presence of all existing cytoplasmic cDNA to further study which ERVs might play a role and why. At the same time the aim is to confirm the existence of spliced cytoplasmic cDNA irrefutably. 2.2. Aim 2: The induction of MLVs in the EL4 cell line A second aim in this project is to establish the induction of ERVs, with MLVs in particular, in the EL4 cell line. The EL4 cell line is a murine lymphoblast derived cell line; induction of MLVs in this cell line can help in the elucidation of ERV induced cancer. If the induction of MLVs proved successful, the characteristics and transcriptional regulation of the induced MLV will be studied. 15 Part 3: Results Part 3: Results 3.1. The detection of cytoplasmic ERV cDNA 3.1.1. Detecting spliced eMLV cDNA in the cytoplasm of B-cells As the existence of spliced cDNA of the eMLV env gene in the cytoplasm has only once been described, by Beutler’s group in 2014 (Zeng et al, 2014; in attachment), we wanted to confirm these findings. This paper by Zeng et al. describes the presence of this particular spliced cDNA of eMLV in the cytoplasm of B-cells. An increase in amount of ERV spliced cDNA was recorded when B-cells were treated with a TI2 antigen for about five days. The presence of enzymes specifically reverse transcribing some RNA strands in the cytoplasm might have major consequences for our textbook knowledge of the retroviral life cycle. To study the presence of spliced eMLV cDNA, at first the spleen from a B6 mouse was harvested and cells were cultured with either αIgM or LPS for activation of B-cells. DNA was prepared from these cells at three time points: before stimulation and after one and two days of stimulation. As a positive control, in vitro prepared cDNA from RNA from RAG -/- mouse spleen cells was used. These mice produce infectious eMLV and therefore have high eMLV envelope expression (Young et al, 2012a). A qPCR was done with primers for spliced eMLV; the interferon-α/β subunit 1 gene (IFNAR1) was used as a reference to standardise the abundance. The results of the qPCR did not show any evidence of the existence of spliced eMLV cDNA; there was no significant difference between stimulated and non-stimulated cells and the Ct values for the samples indicated an abundance close to negative (figure 3.1). The in vitro made cDNA from RAG-/- spleen cells was highly abundant (figure 3.1). As no spliced envelope cDNA was found in DNA preparations from the whole spleen, one could hypothesise that the concentration of cDNA was too diluted to be detected. Therefore, this experiment was repeated with purified B-cells from spleen. B-cells were purified from B6 mice spleens using positive immunomagnetic selection. This protocol results in a 95 to 97% purity of B-cells as estimated by flow cytometry (data not shown). These primary B-cells were again cultured with αIgM or LPS for two days; DNA was prepared for qPCR at day 0, 1 and 2. In this experiment an extra negative control, a mouse knockout for eMLV, was included. Spliced envelope cDNA expression remained slightly above detection limit in all tested conditions (figure 3.2). The first generation (F1) of a RAG-/- female and a B6 male have a high titer of the eMLV virus (referred to as eMLV positive, eMLV+), but have, unlike RAG-/- mice, mature B- and T-cells. If spliced cDNA of eMLV would exist, we should be able to detect it in B-cells derived from these mice. Following this reasoning, B-cells were purified from the spleen of an eMLV positive mouse, a B6 mouse was used as control. No stimulation of B-cells with LPS or αIGM was needed as endogenous retroviruses are already highly expressed in eMLV+ mice. A qPCR was done for the detection of spliced envelope cDNA. Figure 3.3A shows the expression of spliced envelope eMLV cDNA relative to IFNAR1. To confirm that these cells are indeed expressing eMLV envelope RNA, a qRT-PCR was done on RNA from these cells. Spliced envelope RNA was present in high amounts in the cells from the eMLV positive mouse (figure 3.3B). 16 Part 3: Results Spliced eMLV DNA in spleen post stimulation (in vitro) Log FC spliced eMLV, relative to IFNAR1 106 105 104 103 102 101 No stimulation LPS d1 LPS d2 aIgM d1 aIgM d2 B6 (NEG) RAG-/- (POS) Figure 3.1. Abundance of spliced eMLV cDNA in spleen cells post stimulation. Spleen cells from a single B6 mouse spleen were stimulated with LPS or anti-mouse IgM for one or two days. As a control, spleen cells without stimulus were included. The in vitro reverse transcribed cDNA from spleen cells obtained from a B6 and RAG-/- mouse were used respectively as negative and positive control for eMLV expression. A two fold change of the qPCR Ct values relative to IFNAR1 was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 10 4. LPS: Lipopolysaccharide; aIgM: goat antimouse immunoglobuline M; d1: one day of stimulation; d2: two days of stimulation. The ERV cDNA was found in the cytosolic part of B-cells by Zeng et al., one could argue that the concentration of cDNA in total B-cells is masked by the high background of genomic DNA. Consequently a new experiment was set up to detect spliced eMLV cDNA solely in the cytoplasmic extract of B-cells. For this experiment, the spleen from a B6 mouse, an eMLV knockout mouse and an eMLV positive mouse were harvested. B-cells were purified and divided into three aliquots: one for DNA preparation from whole cells; one for cytoplasmic DNA extraction and one for RNA preparation from whole cells. These preparation were used as template for q(RT-)PCR. The purity of the cytoplasmic fraction was assessed by looking at the abundance of IFNAR1 in the cytoplasmic fraction relative to the abundance in whole cells (Figure 3.4A). As positive control for the cytoplasmic fraction, mitochondrial DNA primers were used. As shown in figure 3.4A, there is a clear enrichment in cytoplasmic DNA; however, some nuclear contamination remains. To gain more statistical power, this experiment was repeated once more in the same way. The pooled results are shown in Figure 3.4B. None of the samples were positive for spliced eMLV envelope cDNA when compared to the values of the eMLV knockout (Figure 3.4B). QRT-PCR on RNA showed that eMLV virus producing mice indeed had a high viral load (data not shown). 17 Part 3: Results Spliced eMLV DNA in B-cells post stimulation (in vitro) Log FC spliced eMLV, relative to IFNAR1 106 105 104 103 102 101 100 No stimulation LPS d1 LPS d2 aIgM d1 aIgM d2 B6 (NEG) RAG-/- (POS) WT B6 eMLV KO Figure 3.2. Abundance of spliced eMLV cDNA in purified B-cells post stimulation. B-cells were purified from the spleen of a B6 or eMLV knockout mouse by positive immunomagnetic selection. Purified B-cells were stimulated with LPS or anti-mouse IgM for one or two days. As a control, spleen cells without stimulus were included. The in vitro reverse transcribed cDNA from spleen cells from a B6 and RAG-/- mouse were used respectively as negative and positive control for eMLV expression. A two fold change of the qPCR Ct values relative to IFNAR1 was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 104. LPS: Lipopolysaccharide; aIgM: goat anti mouse immunoglobuline M; d1: one day of stimulation; d2: two days of stimulation; arrow: below qPCR detection limits. Finally we assessed the presence of spliced eMLV cDNA in vivo, two B6 mice and two eMLV positive mice were injected with αIgM and culled after 4.5 days. Injection with αIgM has been used by Zeng et al. to activate B-cells in vivo. A B6 mouse without injection was taken as control for B-cell activation. As in previous experiments, B-cells were purified and used for DNA preparation from whole cells and cytoplasm and RNA preparation from whole cells. The qPCR readout did not show any presence of spliced eMLV cDNA (Figure 3.5). The eMLV positive mice were confirmed to be positive by qRT-PCR (data not shown). To obtain statistical power, the results of all previously mentioned experiments were taken together and plotted in figure 3.6. 18 Part 3: Results A) Spliced eMLV DNA in B-cells Log FC spliced eMLV, relative to IFNAR1 106 105 103 102 101 100 WT eMLV+ B6 (NEG) RAG-/- (POS) B) Spliced eMLV RNA in B-cells Log FC spliced eMLV RNA, relative to HPRT 107 106 105 104 103 102 101 WT eMLV+ B6 (NEG) RAG-/- (POS) Figure 3.3 Abundance of spliced eMLV DNA in purified B-cells. B-cells were purified from mouse spleens by positive immunomagnetic selection. The in vitro reverse transcribed cDNA from spleen cells from a B6 and RAG-/- mouse were used respectively as negative and positive control for eMLV expression. Figure A: A two fold change of the qPCR Ct values relative to IFNAR1 was plotted on logarithmic scale. Figure B: A two fold change of the qRT-PCR Ct values relative to HPRT was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 10 4. WT: B6 mouse; eMLV+: Mouse with infectious eMLV, expressing eMLV virus in high amounts. 19 Part 3: Results A) MT-CO2/IFNAR1 as a measure of cytoplasmic purity Log FC MT-CO2 DNA, relative to IFNAR1 3000 2500 2000 1500 1000 500 0 WT eMLV KO eMLV+ Cell Cytoplasm Log FC spliced eMLV DNA, relative to MT-CO2 B) Spliced eMLV DNA in B-cells and their cytoplasmic fraction 106 105 102 101 100 10-1 WT eMLV KO eMLV+ B6 (NEG) RAG-/- (POS) Cell Cytoplasm Figure 3.4. Cytoplasmic purity and spliced eMLV cDNA abundance. B-cells were purified from mouse spleens by positive immunomagnetic selection. Figure A: Cytoplasmic purity. For both the whole cell and the cytoplasmic fraction, the log two fold change of the abundance of a mitochondrial gene, MT-CO2, is plotted relative to IFNAR1 abundance as determined by qPCR. The enrichment in MT-CO2 relative to IFNAR1 in the cytoplasm is a measure for the spill-over of nuclear material. Figure B: Abundance of spliced eMLV DNA in purified B-cells and their cytoplasmic extract. The in vitro reverse transcribed cDNA from spleen cells from a B6 and RAG-/- mouse were used respectively as negative and positive control for eMLV expression. A two fold change of the qPCR Ct values relative to MT-CO2 was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 106. Arrows: below detection limit of qPCR; WT: B-cells from B6 mice; eMLV KO: from B6 mice lacking eMLV; eMLV+: from mice with infectious eMLV; error bars: standard error based on data from two mice each. 20 Part 3: Results Log FC spliced eMLV DNA, relative to MT-CO2 Spliced eMLV DNA in B-cell/cytoplasm post aIgM injection 106 105 104 101 100 10-1 W T no ct je in n io W T gM aI + LV eM gM aI B6 ) EG N ( -/ G RA S) O P -( Cell Cytoplasm Figure 3.5. Abundance of spliced eMLV DNA after αIgM injection in mice. Mice were injected IV with αIgM. Five days post injection B-cells were purified from mouse spleens by positive immunomagnetic selection and the cytoplasm was extracted. The in vitro reverse transcribed cDNA from spleen cells from a B6 and RAG-/mouse were used respectively as negative and positive control for eMLV expression. A two fold change of the qPCR Ct values relative to MT-CO2 was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 106. Arrow: below detection limit of qPCR; WT: B-cells from B6 mice; eMLV KO: from B6 mice lacking eMLV; eMLV+: mouse with infectious eMLV, producing eMLV virus in high amounts; error bars: standard error based on data from two mice each. 3.1.2. The virion hypothesis In theory, viral reverse transcriptases could only become functional when packed inside a virion. If spliced RNA of the eMLV env gene would be packed inside the virion by mistake, it could be reverse transcribed upon infection of a new cell. To verify this hypothesis and to check if this might be why cytoplasmic spliced cDNA was detected by Beutler’s group, some experiments were set up. A Mus dunni derived cell line called M. dunni RARV2 (short for RAG associated retrovirus 2) was used, that is known to produce infectious eMLV (Young et al, 2012a). The supernatant of M. dunni RARV2 cells was taken after a three hour incubation with fresh medium. The supernatant was used for DNA and RNA preparation for qPCR and qRT-PCR respectively. The qRT-PCR with HPRT as reference expression showed that the supernatant seemed very clear of cellular contamination (i.e. no HPRT detectable, table 3.1); there was 21 Part 3: Results Abundance of spliced eMLV DNA relative to IFNAR1 (cells) or MT-CO2 (cytoplasm) Abundance of spliced eMLV cDNA 107 106 105 104 103 102 101 100 WT eMLV KO eMLV+ B6 (NEG) RAG-/- (POS) Cell Cytoplasm Figure 3.6. Abundance of spliced eMLV DNA (summary). Results of all previously mentioned experiments (figures 3.1-3.5) were pooled to evaluate the statistical relevance. 8, 3 and 5 mice were used for the data on total cells and 5, 2 and 4 mice for data on the cytoplasm, for WT, eMLV KO and eMLV+ respectively. As negative and positive control the in vitro reverse transcribed cDNA from spleen cells from a B6 and RAG-/mouse were used that were previously verified to express eMLV in a very low amount (NEG), or very high amount (POS). A two fold change of the qPCR Ct values relative to IFNAR1 (total cells) or MT-CO2 (cytoplasm) was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 104 (cells) or 106 (cytoplasm). WT: B-cells from B6 mice; KO: B-cells from B6 mice lacking eMLV; eMLV+: from mice with infectious eMLV, producing eMLV virus in high amounts; error bars: standard error. however some spliced eMLV RNA found outside the cells. In the frame of the virion hypothesis, this is an indication that envelope RNA could be mispacked into virions and as such reverse transcribed, giving rise to this spliced envelope cDNA found by Zeng et al. HPRT, although constitutively expressed by every cell, is not very abundant. eMLV RNA on the contrary is present in high concentrations in M. dunni RARV2 cells, as this RNA is needed to complete the viral life cycle. Therefore, the results with HPRT as a reference for the clearness of the supernatant might not be trustworthy. This experiment was repeated with both HPRT and 18s ribosomal RNA (18s rRNA) as a reference and as an indication for the clearness of the supernatant. rRNA is one of the most abundant RNA species in the cell and its concentration is more comparable to the concentration of eMLV RNA (table 3.1). The results of the qRT-PCR show that the supernatant was not entirely clean from cellular material, as some rRNA remained detectable (table 3.1). No enrichment of eMLV RNA is seen in respect to ribosomal RNA in the supernatant in comparison to the cells (table 3.1). 22 Part 3: Results Table 3.1. Abundance of spliced eMLV RNA in the supernatant of M. dunni RARV2 cells. HPRT was undetectable in the supernatant and therefore given the artificial Ct value of 40. Two fold change was determined with the formula 2(Ct value rRNA-Ct value eMLV RNA) and represents the relative expression of spliced eMLV RNA to ribosomal RNA (rRNA). To investigate the virion hypothesis further, a qPCR was done to look for in vivo reverse transcribed spliced eMLV cDNA. This spliced cDNA was undetectable in the supernatant (figure 3.7). This experiment concludes a series of experiments trying to confirm the existence of spliced envelope cDNA in the cytoplasm of B-cells. Log FC spliced eMLV DNA, relative to IFNAR1 Spliced eMLV DNA in supernatant 107 106 105 102 101 (P O S) (N EG ) R AR V2 cD NA B6 V2 AR R Su p Su p M du nn i 100 Figure 3.7. Abundance of spliced eMLV DNA in the supernatant of M. dunni and M. dunni RARV2 cells. The supernatant of M. dunni cells (that have a low amount of eMLV RNA) and M. dunni RARV2 cells (that have a high abundance of eMLV RNA) was taken for analysis of eMLV DNA with qPCR. As a negative control, in vitro reverse transcribed RNA from the spleen of a B6 mice was used (NEG); as positive control the in vitro reverse transcribed cDNA of M. dunni RARV2 RNA was used, known to express eMLV in a high amount (POS). A two fold change of the qPCR Ct values relative to IFNAR1 was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 10 4. Sup: supernatant; RARV2: Cell line derived from M. dunni transfected with RAG-/- mouse-associated retrovirus. 23 Part 3: Results 3.1.3. Detecting ERV cDNA upregulation after B-cell stimulation In the paper of Zeng et al., full length cDNA of several ERVs is also found to be increased upon B-cell activation. This experiment was repeated in our laboratory for the ERVs IAP, Mus-D and Mu-ERV-L. Cells were incubated for 18 hours with αIgM; DNA was extracted from total cells or cytoplasm only, before and after stimulation; qPCR was done to estimate the difference in abundance. For the ERV IAP, also the stimulated and unstimulated samples of previous experiments were tested for cytoplasmic IAP cDNA. Important for the interpretation of the results is that primers for the amplification of these ERVs could not distinguish between genomic DNA and cDNA. Firstly, the pureness of the cytoplasmic extract was assessed by comparing the abundance of ERV DNA (i.e. Mus-D, Mu-ERV-L or IAP) to genomic DNA (i.e. IFNAR1) in cells and cytoplasm. The enrichment of cytoplasmic ERV DNA was found significant in the unstimulated cells (figure 3.8). However, in cytoplasmic extracts from B-cells stimulated with αIgM no enrichment could be detected (figure 3.8). The previously obtained samples indicated the same trend. As demonstrated for the ERV IAP, it can be shown that relative to MT-CO2 roughly a tenfold increase is seen between stimulated and unstimulated cells (figure 3.9). However, when the abundance of IFNAR1 was compared to MT-CO2, an equally large increase could be found (figure 3.9). When the ratio of fold changes between stimulated and unstimulated cells is made of IAP to MT-CO2 and IFNAR1 to MT-CO2, a value close to 1 is seen (figure 3.9), indicating no real increase in ERV cDNA in stimulated cells. Furthermore, the cDNA in both the cytoplasm of stimulated and unstimulated cells was shown to be highly abundant. 3.1.4. High throughput cytoplasmic cDNA detection In extension to the detection of spliced eMLV cDNA, it was desirable to set up an experiment for the detection of all possible cytoplasmic ERV cDNA. Purified B-cells of five B6 mice and five eMLV+ mice were pooled. Part of the purified B-cells were stimulated for 18 hours with αIgM for B-cell activation before cytoplasmic DNA was extracted. The rermaining B-cells were immediately subjected to cytosplasmic extraction. Deep sequencing was requested for the DNA extracted from these samples. Samples were analysed with flow cytometry for B-cell activation before and after stimulation. Figure 3.10 shows the activation of B-cells after 18 hours of stimulation with αIgM. 24 Part 3: Results Ratio ERV DNA to IFNAR1 in cell and cytoplasm Log FC ERV cDNA, relative to IFNAR1 109 ** 108 ** ** 107 106 Mus-D Mu-ERV-L IAP Cell Cytoplasm Ratio ERV DNA to IFNAR1 in cell and cytoplasm post stimulation Log FC ERV cDNA, relative to IFNAR1 3x107 3x107 2x107 2x107 107 5x106 0 Mus-D Mu-ERV-L IAP Cell Cytoplasm Figure 3.8. Enrichment of DNA of Mus-D, Mu-ERV-L and IAP in the cytoplasm with regard to purified Bcells. B-cells were purified from mouse spleens by positive immunomagnetic selection. B-cells were stimulated for 18 hours with αIgM; DNA was extracted from cells and cytoplasm before (upper figure) and after (lower figure) stimulation. A two fold change of the qPCR Ct values relative to IFNAR1 was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 104. Error bars: standard errors, based on data from four mice. Asterisks: indicating significance of the enrichment of cDNA in the cytoplasm, ** P-value lower than 0,01 as determined with a t-test or Mann Whitney Rank Sum Test (statistical reports in attachment) . 25 Part 3: Results Ratio IFNAR1 to MT-CO2 in the cytoplasm Ratio of IAP to MT-CO2 in the cytoplasm Ratio of IAP to MT-CO2 in the cytoplasm 20 80 20 to MT-CO2 IAP, relative FCFC IFNAR1, relative to MT-CO2 FC IAP, relative to MT-CO2 18 16 14 12 10 8 6 4 2 18 16 60 14 12 40 10 8 6 20 4 2 0 0 IAP/MT-CO2 IAP/MT-CO2 IFNAR1/MT-CO2 Unstimulated Unstimulated aIgM aIgM Unstimulated aIgM Ratio of Stimulated/unstimulated (IAP/MT-CO2) to Stimulated/unstimulated (IFNAR1/MT-CO2) in the cytoplasm Ratio of FC (stimulated/unstimulated) 2,0 1,5 1,0 0,5 0,0 Figure 3.9. Abundance of IAP and IFNAR1 DNA in the cytoplasm before and after stimulation. Same samples as in figure 3.10. A two fold change of the IAP (upper left figure) or IFNAR1 (upper right figure) qPCR Ct values relative to MT-CO2 was plotted on linear scale. Lower figure: the ratio of fold changes between stimulated and unstimulated cells of IAP to MT-CO2 and IFNAR1 to MT-CO2 as shown in the upper figures. Reference line is drawn at a ratio of 1 to 1. 26 Part 3: Results B-cell activation post aIgM stimulation (in vitro) Log FC ERV cDNA, relative to IFNAR1 1e+9 1e+8 1e+7 1e+6 Mus-D Mu-ERV-L IAP Cell Cytoplasm Figure 3.10. Activation of B-cells after in vitro αIgM stimulation. Five B6 (upper figures) and five eMLV+ mice (lower figures, with infectious eMLV) were culled for B-cell extraction via positive immunomagnetic selection on spleen cells. B-cells were incubated for 18 hours with αIgM. Cells before and after stimulation were stained for B-cell activation with MHCII-FITC (left) or CD86-pacific blue (right) and analysed by flow cytometry. X axis: MHCII (left) or CD86 (right); Y axis: cell count. 27 Part 3: Results 3.2. The induction of MLVs in the EL4 cell line The EL4 cell line is a T-cell lymphoma derived cell line with variable results considering ERV expression. To study the transcriptional regulation of ERVs in this cell line, we looked for a way to induce MLVs. BrdU is a reagent known to induce ERVs in B-cells (Lowy et al, 1971; Reome et al, 2000) and in vivo (Brashishkite et al, 1988). BrdU is a thymidine analog that can be incorporated in the DNA. BrdU substituted base pairs are unable to be methylated, DNA silenced by methylation therefore becomes active again. BrdU is however also toxic for the cells. To initiate this study, EL4 cells were cultured for two days with 20 µg/ml BrdU. A substantial level of cell death was observed by microscopy for the BrdU treated cells in comparison to the untreated cells. Nevertheless, cells were subjected to a two-step staining. First, cells were stained with rat anti-mouse antibody 83A25, which binds to an envelope epitope common to all murine leukemia viruses. Second, the anti-rat antibody IgG2a-FITC was applied to the cells. Cells were analysed with flow cytometry to determine the level of cell death and MLV expression. Both the unstimulated and the BrdU treated cells were shown to express the MLV envelope protein at a low level (figure 3.11). However, there was no significant increase in expression in the BrdU treated cells compared to the baseline envelope expression in unstimulated cells (figure 3.11). All BrdU treated cell cultures were shown to suffer from cell death. To extend these initial studies, EL4 cells were cultured with a tenfold lower concentration of BrdU for two days. A lower concentration of BrdU might be less toxic for the cells while remaining the potential to induce ERVs. Flow cytometry analysis showed that this was not the case; cell death still occurred among the BrdU treated cells and no induction of ERVs was seen (figure 3.12). The baseline ERV expression as observed in the initial experiment did not appear in this second experiment (figure 3.12). Another approach to induce ERV expression in the EL4 cell line was adopted. Cells were treated with SAHA or PdbU/ionomycin, histone deacetylase inhibitors that would relief the transcriptional silencing by deacetylation of histones. Cells were cultured for one or two days; afterwards, MLV expression was assessed by qRT-PCR with primers for various MLVs, relative to HPRT expression. None of the stimuli or conditions indicated a significant increase in MLV expression relative to unstimulated cells (figure 3.13). As examined by microscopy, the cells did not suffer from either SAHA or PdbU/ionomycin treatment. As it did not seem feasible at the moment to induce MLVs in the EL4 cell line without conferring toxicity to the cells, a BrdU resistant EL4 cell line was used in a next experiment in order to induce ERVs. As in the first experiment, cells were cultured for two days with or without 20 µg/ml BrdU. Estimated by microscopy, the cells withstood the BrdU treatment without the occurrence of cell death. Flow cytometry confirmed these findings (figure 3.14); analysis of the MLV envelope expression by flow cytometry showed that both untreated and BrdU treated cells are highly positive (figure 3.14). As the untreated cells were already positive, no induction of the expression by BrdU could be detected (figure 3.14). With regard to the MLV expression of the BrdU resistant EL4 cell line, two questions remained unanswered: which are the upregulated MLVs and are they infectious to other cells. To answer the first question, a qPCR with primers for the different MLVs was done. Compared to the original EL4 cell line, the ecotropic MLV was the highest expressed, with an expression 28 Part 3: Results MLV expression in EL4 cells post BrdU stimulation (20 µg/ml) 1e+9 Log FC ERV cDNA, relative to IFNAR1 No stimulation IgG2a-FITC No stimulation 83A25 + IgG2a-FITC 1e+8 1e+7 1e+6 Mus-D Mu-ERV-L IAP BrdU Unstimulated 20 µg/ml BrdU IgG2a-FITC 20 µg/ml BrdU 83A25 + IgG2a-FITC Figure 3.11. MLV expression in EL4 cells after stimulation with BrdU (20 µg/ml). EL4 cells were incubated for 2 days with 20 µg/ml BrdU. Cells before and after stimulation were stained for an MLV envelope epitope with 83A25 and IGg2a-FITC and analysed with flow cytometry. Left: density plots of cell counts. X axis: 83A25FITC, Y axis: side scatter height. Cells stained with IgG2a-FITC alone were used to correct for background. Right: comparative histogram of unstimulated and BrdU stimulated cells, gated on 83A25 positive cells as displayed in density plots. several times higher than the other MLVs (figure 3.15). The second question was answered by qRT-PCR of the supernatant and an infectivity assay of these cells. The abundance of MLVs in the supernatant was comparable to expression levels in the cells, with the abundance of eMLV the highest compared to MLVs in the supernatant of the original EL4 cell line (figure 3.16). Most fully infectious MLVs can infect M. dunni cells, therefore these cells were used as host for the infectivity assay. The supernatant of EL4 BrdU resistant cells was taken when the cell culture was close to 100% confluence and added to an M. dunni cell culture. After five days, M. dunni cells were checked for EL4 cell contamination and stained for the envelope protein to analyse the MLV envelope expression with flow cytometry. As a positive control, the supernatant of M. dunni RARV2 cells, known to produce infectious virus, was applied. As negative control, M. dunni cells were incubated without supernatant. Figure 3.17 shows that the MLV expressed by this EL4 cell line is indeed infectious; the M. dunni cells became positive for the MLV epitope after incubation with supernatant of this cell line. 29 Part 3: Results MLV expression in EL4 cells post BrdU stimulation (2 µg/ml) Log FC MLVs, relative to HPRT 106 No stimulation IgG2a-FITC No stimulation 83A25 + IgG2a-FITC 105 104 103 102 eMLV xMLV pMLV mMLV EL4 EL4 BrdU resistant 2 µg/ml BrdU IgG2a-FITC 2 µg/ml BrdU 83A25 + IgG2a-FITC Figure 3.12. MLV expression in EL4 cells after stimulation with BrdU (2 µg/ml). EL4 cells were incubated for 2 days with 2 µg/ml BrdU. Cells before and after stimulation were stained for an MLV envelope epitope with 83A25 and IGg2a-FITC and analysed with flow cytometry. Left: density plots of cell counts. X axis: 83A25FITC, Y axis: forward scatter area. Cells stained with IgG2a-FITC alone were used to correct for background. Right: comparative histogram of unstimulated and BrdU stimulated cells, gated on 83A25 positive cells as displayed in density plots. 30 Part 3: Results MLV expression in EL4 cells 1 day post stimulation Log FC MLVs relative to HPRT 1e+5 1e+4 1e+3 1e+2 n io at ul 4 EL No st im 4 EL + 2 0. µM SA HA 4 EL + 2 µM SA HA 4 EL + no io u/ b pd MLVeMLV expression in EL4 cells 2 days post stimulation xMLV pMLV mMLV Log FC MLVs relative to HPRT 105 104 103 102 4 EL No s n io at ul m ti 4 EL + 2 0. µM SA HA 4 EL + 2 µM SA HA 4 EL + no /io bu d p eMLV xMLV pMLV mMLV Figure 3.13. MLV expression in EL4 cells after stimulation with SAHA or PdbU/ionomycin. Cells were incubated for one (upper figure) or two (lower figure) days with 0.2 µM or 2 µM SAHA or 500 ng/ml PdbUionomycin. DNA from cells before and after stimulation were used as template for qRT-PCR. A two fold change of the qRT-PCR Ct values relative to HPRT was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 10 4. SAHA: suberoyl-anilide-hydroxamic acid; PdbU: phorbol 12,13-dibutyrate; ‘iono’: ionomycin; eMLV, xMLV, pMLV and mMLV: ecotropic, xenotropic, polytropic and modified polytropic MLV respectively . 31 Part 3: Results MLV expression in EL4 BrdU resistant cells post BrdU stimulation (20 µg/ml) Log FC MLVs, relative to HPRT No stimulation 106 83A25 + IgG2a-FITC No stimulation IgG2a-FITC 105 104 103 102 eMLV xMLV pMLV mMLV EL4 EL4 BrdU resistant 20 µg/ml BrdU IgG2a-FITC 20 µg/ml BrdU 83A25 + IgG2a-FITC Figure 3.14. MLV expression in BrdU resistant EL4 cells after stimulation with BrdU (20 µg/ml). EL4 cells were incubated for 2 days with 20 µg/ml BrdU. Cells before and after stimulation were stained for an MLV envelope epitope with 83A25 and IGg2a-FITC and analysed with flow cytometry. Left: density plots of cell counts. X axis: 83A25-FITC, Y axis: forward scatter area. Cells stained with IgG2a-FITC alone were used to correct for background. Right: comparative histogram of unstimulated and BrdU stimulated cells, gated on 83A25 positive cells as displayed in density plots. 32 Part 3: Results MLV expression in EL4 BrdU resistant cells Log FC MLVs, relative to HPRT 106 105 104 103 102 eMLV xMLV pMLV mMLV EL4 EL4 BrdU resistant Figure 3.15. Expression of different MLV families in BrdU resistant EL4 cell line. EL4 BrdU resistant cells were cultured for two days. A qRT-PCR was done with primers for several MLVs. A two fold change of the qRT-PCR Ct values relative to HPRT was plotted on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 104. Error bars: standard error based on data from two (EL4) or four (EL4 Brdu resistant) cell cultures; eMLV, xMLV, pMLV and mMLV: ecotropic, xenotropic, polytropic and modified polytropic MLV respectively. 33 Part 3: Results MLV expression in supernatant of EL4 BrdU resistant cells MLV copies per ml supernatant 108 107 105 104 103 102 101 100 eMLV xMLV pMLV mMLV EL4 EL4 BrdU resistant Figure 3.16. Expression of different MLV families in the supernatant of the BrdU resistant EL4 cell line. EL4 BrdU resistant cells were cultured for two days. A qRT-PCR was done on the supernatant with primers for several MLVs. A two fold change of the qRT-PCR Ct values relative to the MLV expression in DNA samples of B6 mice with a correction for copy and cell number was plotted per ml supernatant on logarithmic scale. For better readability of the plot, the fold change values were multiplied by a factor of 104. eMLV, xMLV, pMLV and mMLV: ecotropic, xenotropic, polytropic and modified polytropic MLV respectively. 34 Part 3: Results Infectivity assay EL4 BrdU resistent cells 106 Log FC MLVs, relative to HPRT A) 105 104 103 102 eMLV xMLV pMLV mMLV EL4 EL4 BrdU resistant B) Figure 3.17. Infectivity assay of EL4 BrdU resistant cells. Expression of MLV envelope protein in M. dunni cells transfected with supernatant of EL4 BrdU resistant cells. A two-step staining of M. dunni cells was done with 83a25-FITC and IgG2a-FITC antibodies. Figure A: Supernatant was added to M. dunni cells in a one in three dilution series; each figure shows the MLV expression in M. dunni cells with a dilution of supernatant of one in three compared to the previous one. Figure B: As negative control M. dunni cells were incubated without added supernatant (left figure). As positive control, M. dunni cells were transfected with the supernatant of M. dunni RARV2 cells, known to produce infectious MLV (right figure). 35 Part 4: Discussion Part 4: Discussion 4.1. The detection of cytoplasmic ERV cDNA 4.1.1. Spliced cDNA in the cytoplasm of B-cells The research group of Beutler demonstrated recently that ERV proviruses are transcribed in B-cells after TI2 immunization (Zeng et al, 2014; in attachment). Full-length and spliced proviral mRNA is then transported to the cytoplasm; translation of this mRNA delivers proteins, among which reverse transcriptase (RT). RT reverse transcribes both full-length and spliced cytoplasmic proviral mRNA. RIG-I and cGAS are activated by ERV mRNA and cDNA respectively in the cytoplasm and their signalling results in B-cell activation and expansion. A first step in this model that remains unexplained is the cytosolic reverse transcription of spliced mRNA. To date, reverse transcription of spliced mRNA in vivo has not been demonstrated. For reverse transcriptase to be active, it requires packaging into a viral particle together with the viral RNA (Ansari-Lari & Gibbs, 1996; Goff, 1990; Konvalinka et al, 2015). Only the full-length viral RNA has the necessary packaging sequence Ψ and will thus be packed into the viral particle. Upon infection of a new cell, reverse transcriptase becomes activated and can reverse transcribe viral RNA. Therefore, spliced cDNA should not be present in the cytoplasm. However, data on the presence of spliced cDNA of eMLVs and MMTVs and an increase of this spliced cDNA after TI2 immunization was used in the paper of Zeng et al. to back their hypothesis. To shed light on the mechanisms involved in cytoplasmic reverse transcriptase activity, it was desirable to first confirm the existence of spliced eMLV cDNA, as it was critical for our further approach. In vitro stimulation of spleen cells of B6 mice with LPS or αIgM did not result in any increase in abundance of spliced eMLV as measured by qPCR. The Ct values for spliced eMLV were close to the lower detection limit of the qPCR, indicating that spliced eMLV cDNA is certainly not present in high amounts. It could however be that the concentration of spliced eMLV is not sufficiently high to be captured in a mixture of cells. Nevertheless, also in purified B-cells the Ct values remained close to the detection limit, no change could be observed before or after stimulation. Remarkable is that the Ct values for samples from mice lacking eMLV, included as a negative control in this experiment, were higher than the Ct values of wild type B6 mice. From this we can deduce that the very low amplification signal is produced by background noise of the qPCR and not by the actual presence of spliced eMLV cDNA. Our results demonstrate that spliced eMLV cDNA cannot be detected in B-cells, either before or after in vitro B-cell stimulation. This experiment was extended to include purified B-cells from mice that have infectious eMLV. This mouse breed is the first generation of a cross between a B6 male and a RAG-/(Mombaerts et al, 1992) female. In these mice, eMLV RNA is highly abundant. However, unlike the RAG-/- mice, these mice have mature B- and T-cells, a prerequisite for this research. If any spliced cDNA is made, expectedly, the high abundance of eMLV RNA should equally result in a higher amount of spliced eMLV cDNA. QRT-PCR showed a significant increase in eMLV RNA in respect to wild type mice. Nevertheless, spliced eMLV cDNA could not convincingly be detected in either WT or eMLV positive mice. 36 Part 4: Discussion The results by Zeng et al. are obtained by detecting DNA in the cytosolic fraction of B-cells. The reason why we could not find spliced eMLV cDNA in purified B-cells might be because a high level of genomic DNA is masking the low abundance of spliced eMLV cDNA. However, also when DNA was isolated from cytoplasmic extracts, spliced eMLV cDNA could not be proven to exist in any of our mouse models or wild type B6 mice. In vivo injection of B6 and eMLV positive mice with αIgM to activate the B-cells did not change this result. Taking all these experiments together, it was concluded that the experiment as performed by Zeng et al. is not reproducible as for the existence of spliced eMLV cDNA. If any spliced eMLV cDNA is present in the cytoplasm, it is not present in concentrations detectable by qPCR. Expected is that similarly, spliced MMTV would not be detectable. Hence, our expectations are that spliced ERV cDNA is not or only sporadically produced by RT in the cytoplasm. 4.1.2. The virion hypothesis Retroviruses with an extracellular life cycle will only activate their RT upon infection of a new cell (Telesnitsky & Goff, 1997). Most ERVs, like MLVs and MMTVs, still follow this rule; only RNA that was packaged into a virion will be reverse transcribed upon infection of a new cell (Fassati & Goff, 1999). Only full-length RNA contains the packaging sequence required for packing into the virion. Following this reasoning, spliced cDNA of these ERVs should not be present in cells. Even though some RTs, such as LINE-1s or RTs from strictly intracellular ERVs, are active in the cell, none of them have been shown to be able to reverse transcribe eMLV RNA in the cytoplasm. Therefore it is thought that if spliced eMLV is reverse transcribed, it should probably happen inside a viral nucleoprotein complex upon infection of a new cell. The data on spliced eMLV from Zeng et al. could in theory be explained by stochastic packaging of spliced ERV RNA into viral particles. It has been shown that when a viral particle is formed, some of the cell’s cytoplasm is taken up in the particle, including cellular RNAs (Adkins & Hunter, 1981; Aronoff & Linial, 1991; Gallis et al, 1979; Ikawa et al, 1974; Muriaux et al, 2001). For MLV in particular, the analysis of the RNA content of viral particles revealed that almost all free cytoplasmic RNA is packed in a concentration correlated to its abundance in the cell (Rulli et al, 2007). It happens that this mistakenly packed spliced RNA is reverse transcribed upon infection of a new cell, together with the full length viral RNA. Evidence for such events can be found in the integration of pseudogenes from mispackaged spliced RNA in the genome (Giles et al, 2004; Zhang et al, 2004). If no specificity is involved for the packaging of spliced eMLV RNA in the viral particles, not only spliced eMLV RNA but spliced RNA of all sorts should be found inside viral particles. Some specificity towards certain cellular RNA species for the packaging into MLV virions has been found, however, among the spliced RNAs that have been shown to be enriched in the packaging of viral particles of MLV, eMLV was not found (Rulli et al, 2007). Therefore, it seems unlikely that the mispackaging of spliced ERV RNA would be involved in B-cell activation, since this event would need to take place at a high frequency in every B-cell. Nevertheless, it could be that this event has some specificity, unique for B-cells or B-cell activation; thus this hypothesis was worth investigating. The M. dunni RARV2 cell line, an M. dunni derived cell line with high amounts of infectious eMLV (Young et al, 2012a), was used to proof or disproof the latter hypothesis. Supernatant of this cell line contains viral particles of eMLV. Surprisingly, moderately high amounts of spliced eMLV RNA were found in the supernatant by qRT-PCR. HPRT, used as reference for 37 Part 4: Discussion contamination of cellular RNA, was undetectable in the supernatant. This finding encouraged us to believe that spliced RNA was plentiful in the viral particles. However, in a next experiment the highly abundant ribosomal RNA (rRNA) was used as a control for the purity of the supernatant. This revealed that the supernatant was not as clear of cellular material as first thought, as still plenty of rRNA was detected. When the abundance of eMLV RNA was compared to ribosomal RNA in cells and supernatant, no enrichment could be found in the supernatant (two fold change of 9 in cells and 6 in the supernatant, table 3.1). The abundance of spliced eMLV RNA and rRNA is probably spill-over of cellular material in the supernatant, but can also reflect the unspecific packaging of RNA into viral particles. If eMLV RNA would be packed more often than other RNA into viral particles, an enrichment would be seen in its abundance in the supernatant. This indicates that if RNA is mistakenly packed into virions, it happens at the same rate for all RNA; no evidence for specificity towards eMLV was found. Spliced eMLV cDNA was undetectable by qPCR in these experiments in the supernatant. These data tend to exclude the existence of spliced ERV cDNA in cells and viral particles in amounts that could play a significant role in B-cell activation. What did cause the apparent existence of these spliced cDNA species as found by Zeng et al. remains enigmatic. The same primers were used for amplification of spliced eMLV cDNA in our laboratory as described in this publication. A potential explanation might be the contamination of PCR reagents with reverse transcriptase. It could be possible that unknowingly RNA was in vitro reverse transcribed into cDNA, resulting in false results considering the abundance of spliced eMLV cDNA. 4.1.3. Detecting ERV cDNA upregulation after B-cell stimulation Some ERVs have adapted a strictly intracellular life cycle. They found a way to overcome the restriction of protein activation and can reverse transcribe RNA without reinfection. The resulting full-length cDNA is the only type of cDNA that should be present in the cytoplasm of uninfected cells. In the paper of Zeng et al., also this ERV cDNA is shown to increase with Bcell stimulation with a TI2 antigen, contributing to the hypothesis that ERV cDNA is involved as innate adjuvant, activating antibody production and B-cell expansion through cGAS and STING. This hypothesis is of major importance for the understanding of T-cell independent immune responses. To verify this hypothesis further, qPCR was done on the cytoplasmic part of purified B-cells before and after stimulation with αIgM, with primers for the intracellular ERVs IAP, Mus-D and Mu-ERV-L. Unlike eMLV, these ERVs lack a functional env gene, the only gene that contains splicing sites. Primers for IAP, Mus-D or Mu-ERV-L are thus unable to distinguish between genomic DNA and cytoplasmic cDNA. The only way to identify cDNA is by looking at its enrichment in the cytoplasm, relative to total cell DNA. The researchers of Beutler’s group measured the abundance of ERV cDNA relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), genomic DNA that should not be present in the cytoplasm. As such, they used the nuclear contamination of the cytoplasm as a measure to normalise the abundance of ERV cDNAs. It is important to note that the ratio between cytoplasmic DNA and genomic DNA is for a major part reflecting the degree of nuclear contamination of the cytoplasmic extract, which can influence the results (figure 4.1). A very good separation of the cytoplasm from the nucleus will result in low amounts of genomic DNA. For two samples with the same level of cDNA in the cytoplasm, one with high 38 Part 4: Discussion Figure 4.1. The Schematic representation of good and bad cytoplasmic extractions. Two scenarios are represented for the extraction of cytoplasm from the whole cell. In cytoplasmic extracts, DNA that is normally present in the cytoplasm is to be found; of importance are mitochondrial DNA and ERV cDNA. However, a cytoplasmic extract is never completely free of nuclear material. If the nuclear membrane is not intact, it is impossible to separate the nucleic content from the cytoplasm. When the separation did not succeed very well, high levels of genomic DNA are to be found in the cytoplasmic extract (left); when a good separation is obtained a low level of genomic contamination is to be found (right). Neither genomic DNA nor mitochondrial DNA forms a good measure to standardise ERV cDNA abundance with. The ratio of genomic DNA of a housekeeping gene (e.g. IFNAR1) to mitochondrial DNA can be used to assess the relative enrichment of mitochondrial DNA in the cytoplasm relative to the total cell, which is a measure for the purity of the cytoplasmic extract. Figure adapted from Daniel P. Kelly, Nature 470, 342–343, 2011 (Kelly, 2011). and one with low amounts of nuclear DNA contamination, the one with low nuclear DNA will seem to have a higher abundance of cDNA than the one with high genomic DNA content (figure 4.1). Therefore, the use of genomic DNA as a control for the abundance of cytoplasmic cDNA is not reliable. Increases in abundance of cytoplasmic cDNA as seen relative to genomic DNA should be treated with caution; they are no good measure of the increase in abundance after stimulation. To obtain trustworthy results, it is of major importance to check the purity of the cytoplasmic preparations made, to assess the amount of nuclear material left in the cytoplasm. Two cytoplasmic extracts can only be compared when the purity is good enough and is comparable 39 Part 4: Discussion between the two samples. Therefore, mitochondrial DNA was included as a measure to control for the purity of the cytoplasmic extracts in our experiments. Mitochondrial DNA should only be present in the cytoplasm, the ratio of mitochondrial DNA to genomic DNA, for example the housekeeping gene IFNAR1, makes a good estimation of the cytoplasmic contamination with nuclear material. As expected, mitochondrial DNA was enriched in the cytoplasm relative to the total cells in unstimulated cells. As also a significant enrichment in ERV DNA could be found in the cytoplasm, this cytoplasmic extract was classified pure enough. Surprisingly, no significant enrichment could be detected when looking at stimulated cells and cytoplasm. This is likely due to the ongoing proliferation of activated B-cells. When cells proliferate, the nuclear membrane breaks down; an intact nuclear membrane is a prerequisite for a successful separation of cytoplasm and nucleus. The consequence is that normalisation to IFNAR1 would reflect the difference in cytoplasmic purity between stimulated and unstimulated cells. The use of mitochondrial DNA to normalise ERV cDNA is equally not advisable since the primers are not able to distinguish between genomic ERV DNA and cytoplasmic cDNA. Figure 3.9 in the results section demonstrates this for IAPs: the abundance of IAP relative to MT-CO2 shows a tenfold increase in the cytoplasm of stimulated cells relative to unstimulated cells. However, when the abundance of IFNAR1 is compared to MT-CO2 in the cytoplasm, the same increase is found. We can conclude that the apparent increase is a mere result of differences in amount of genomic DNA found in the cytoplasm; the ratio of stimulated and unstimulated cells for the fold change of IAP to MT-CO2 and IFNAR1 to MT-CO2 is close to 1 to 1, which shows that a significant increase in IAPs in stimulated cells could not be found compared to unstimulated cells. Unless the cytoplasmic purity can be proven to be similar and good enough, no conclusions can be drawn from differential expression studies as performed by Zeng et al. and repeated in our laboratory. Why Beutler’s group saw this increase in ERV cDNA abundance in the cytoplasm might thus be a matter of misinterpretation of the data. We can however draw some conclusions from the results obtained by us. Firstly, the detection of ERV cDNA that should exist can count as a positive control for the spliced eMLV cDNA that should not exist and we were not able to detect. Secondly, we can conclude that ERV cDNA was highly abundant in both test settings. Since this ERV cDNA is already present in high amounts in unstimulated conditions, it seems rather unlikely that its upregulation would be detectable or cause any phenotype based on the exceeding of a threshold of nucleic acid sensors. This is in opposition to the stated hypothesis. It appears unlikely that B-cell stimulation causes upregulation of ERVs as there is a high abundance of ERVs even in unstimulated cells. However, that does not imply that ERVs could not act as an innate adjuvant for immune responses. Our hypothesis to counter the one from Zeng et al. says that the presence of ERVs is constitutive but might be required for the B-cell activation and expansion in T-cell independent immune responses. What changes upon B-cell activation is however not the amount of ERV expression but might be an unresolved link in this pathway. Following this reasoning, we can state that B-cell stimulation might result in a change in factors as STING or cGAS which would make them responsive to ERVs. The DNA sensors then activate a pathway with B-cell expansion and antibody production as a consequence. Furthermore, RNA-DNA hybrids made during the life cycle of some endogenous retroviruses are likely to play a role in the detection by sensors as RIG-I. 40 Part 4: Discussion The experiments for the detection of cDNA of intracellular ERVs revealed another inconsistency in the published data of Zeng et al.; Mu-ERV-L cDNA, that remained undetectable in Zeng et al.’s experiments was shown to be vastly abundant when the experiment was repeated in our laboratory. Equally, our experiments have shown that some of the expression levels of ERV RNA do not match the results found by Beutler’s group. The expression of eMLV was been found very high in this paper, it is known however that eMLV is only expressed at a very low level in B6 mice. Figure 3.3 in the results section shows again the low expression of eMLV. This raises questions about the mice used for this research by Beutler’s group. It could be that the mice were infected with eMLV and therefore showed these inconsistent results. To obtain a conclusive answer about the existence of spliced cDNA of ERVs in the cytoplasm, the deep sequencing of a pool of cytoplasmic extracts of wild type mice will be ordered. This sequencing data will equally give answers on which species of cDNA are present in the cytoplasm by looking for the enrichment of DNA reads starting at the transcription start site. Another planned experiment is the overexpression of the reverse transcriptase of retrotransposon LINE-1. As determined by bio-informatics analyses, it was found that of all RT integrates in the mouse genome only a minor fraction has the potential of forming active RT, of them, LINE-1 RT is one of the few that is still expressed. It has been shown that LINE-1 could mediate the reverse transcription of several RNA species (Esnault et al, 2000; Kazazian & Goodier, 2002), among others ssRNA viruses (Horie et al, 2010; Morrish et al, 2002), on rare occasions. Overexpression of LINE-1 will allow us to detect all the cDNA that could be made by this RT, and might reveal the reverse transcription of spliced eMLV. In the future, one hopes to elucidate the T-cell independent B-cell activation pathway and unravel the potential role ERV RNA and cDNA play therein. ERV cDNA accumulation has shown to be linked to several autoimmune diseases in mice (Beck-Engeser et al, 2011; Stetson et al, 2008). STING, cGAS and MAVS are factors thought to recognise ERV accumulation in homeostatic conditions and cause immunopathology when dysfunctional. It is likely that the dysregulation of TI2 B-cell activation is at the root of this problem and a role for ERVs is clearly indicated. It would be interesting to investigate further what is triggering TI2 B-cell responses if it is not the ERV overexpression. 41 Part 4: Discussion 4.2. The induction of MLVs in the EL4 cell line The aim of this experiment is to study the induction of ERVs, with the focus on MLVs, in the murine lymphoblastic cell line EL4. ERVs are often silenced by genomic methylation or histone deacetylation. The relief of this silencing should result in the induced expression of ERVs in the cell. As a first attempt, EL4 cells were stimulated with BrdU, a thymidine analogue that prevents methylation. Unsurprisingly, this concentration of BrdU seemed to be toxic for the cells. Presumably, cells undergo cell death before ERVs could be induced. Remarkable is that EL4 cells without stimulation of BrdU already had a moderate expression of MLVs. This experiment was repeated with BrdU in a concentration of 2 µg/ml to reduce toxicity. This remained unsuccessful; even in a concentration ten times lower, BrdU still appeared toxic for the cells. In contrast to the cell culture of the first experiment, ERV expression seemed very low without stimulation in this cell culture. The variance in ERV expression in EL4 cells without stimulation is noteworthy; it dictates caution when using this cell line for research purposes, the presence or absence of ERV expression could influence the results. Since induction with BrdU did not succeed, a different approach was taken: the induction of ERVs with the histone deacetylase inhibitors SAHA or PdbU/ionomycin. However, even though no toxicity was seen, no induction of ERVs could be detected. Ultimately, to induce ERVs in EL4, an EL4 BrdU resistant cell line was employed. MLV expression, even without induction, was found very high. As MLVs are already highly expressed, no significant induction using BrdU could be found. In the process of creating a BrdU resistant cell line, ERVs were probably activated, which explains the high MLV expression in these cells. The already high expression of MLVs in unstimulated cells made it impossible to study the transcriptional regulation of MLVs in this cell line. This cell line, with high MLV expression, could be used in research on the role of ERVs in cancer. Therefore it was of interest to know whether the expressed MLVs were infectious or not. The infectivity assay on M. dunni cells, cells that can be generally infected by a very broad range of (endogenous) MLVs (Lander & Chattopadhyay, 1984), was positive; infectious virus is produced by the BrdU resistant EL4 cell line. To find out which family of MLVs is induced in this EL4 derived cell line, a qRT-PCR was done with primers for a broad range of MLVs. Expression of ecotropic MLV stood out compared to the expression levels found in the original EL4 cell line. Likewise, a qRT-PCR of the supernatant of these cells showed an increased abundance of eMLV in the supernatant compared to the supernatant of the original EL4 cell line, suggesting that the infectious MLV in question is eMLV. The EL4 and EL4 BrdU resistant cell lines can be used in future research around the carcinogenic properties of the dysregulation of murine ERVs. 42 Part 4: Discussion 4.3 Samenvatting van de discussie (Nederlands) Een recente publicatie uit 2014, uitgebracht door de onderzoeksgroep van Beutler, stelt dat de transcriptie van ERV provirussen wordt opgereguleerd wanneer B-cellen gestimuleerd worden met een T-cel onafhankelijk type II (TI2) antigeen (Zeng et al, 2014; in bijlage). Zowel het volledige RNA transcript als het verwerkte spliced RNA wordt vervolgens in het cytoplasma omgezet in cDNA door reverse transcriptase. Dit cDNA wordt gedetecteerd door de nucleïnezuursensoren, RIG-I en cGAS, die ultiem leiden tot de activatie van B-cellen. Hoe cDNA in het cytoplasma overgeschreven wordt blijft echter onbeantwoord. Tot op heden is reverse transcriptase activiteit in vivo enkel aangetoond bij de infectie van een nieuwe cel, wanneer de virale enzymen worden geactiveerd. Enkel RNA dat zich binnenin het virusdeeltje bevindt kan door RT in cDNA omgezet worden. Het volledige RNA transcript bevat een sequentie die leidt tot het pakken van het RNA in het virusdeeltje, spliced RNA ontbreekt deze signaalsequentie. Om deze reden zou spliced cDNA niet voorkomen in het cytoplasma van de cel. De publicatie van Beutlers onderzoeksgroep vermeldt niet enkel het bestaan van dit spliced cDNA voor de endogene retrovirusen (ERVs) ecotropisch ‘murine leukaemia virus’ (eMLV) en ‘mouse mammary tumour virus’ (MMTV), maar ook een verhoogde abundantie van dit spliced cDNA na stimulatie van B-cellen met een TI2 antigeen. Om de mechanismen van deze reverse transcriptase activiteit in het cytoplasma op te helderen was het wenselijk eerst en vooral deze vaststellingen te bevestigen. Een reeks qPCR experimenten werd ingezet met als doel spliced eMLV cDNA te detecteren, zowel voor als na stimulatie. In cellen van de milt van wild-type muizen was geen verschil te zien tussen de abundantie van gestimuleerde en niet gestimuleerde cellen. De Ct waarden voor qPCR lagen voor beiden net boven de detectielimiet. Omdat deze resultaten niet sluitend waren verrijkt voor B-cellen in de milt. Als negatieve controle werd ditmaal een eMLV-/- muis toegevoegd, die emlv2, het enige eMLV in het genoom, ontbreekt. Opnieuw kon geen verschil in abundantie gevonden worden tussen gestimuleerde en niet gestimuleerde cellen. Opmerkelijk was dat de qPCR waarden voor de eMLV-/- cellen een hogere abundantie weergaven dan de wild-type cellen. Dit betekent dat het geamplificeerde signaal niet meer is dan achtergrondsignaal van de qPCR en dus geen biologische betekenis heeft. Om spliced eMLV cDNA te detecteren werd nadien een muis gebruikt die eMLV in hoge mate expresseert (eMLV+). Als spliced eMLV cDNA in het cytoplasma aanwezig is, zou het in deze muizen zeker gedetecteerd moeten kunnen worden. Deze muizen zijn de eerste generatie van een kruising tussen een vrouwelijke RAG-/- en een mannelijke B6 muis en hebben volledig ontwikkelde Ben T-cellen. Hoewel de hoge eMLV RNA expressie kon worden aangetoond in deze muizen, kon ook hier geen bewijs gevonden worden voor het bestaan van spliced eMLV cDNA. Omdat de detectie van spliced eMLV cDNA niet slaagde in B-cellen in de verschillende condities, werd het cytoplasma geëxtraheerd. Als genomisch DNA voor een te hoge achtergrond zorgde voor de detectie van spliced eMLV cDNA dan zou de detectie hiervan nu mogelijk moeten zijn. Verrassend was dat het achtergrondsignaal van de qPCR helemaal verdween in het cytoplasma van wild-type, eMLV+ en eMLV-/- cellen. Een laatste experiment bestond erin wild-type en eMLV+ muizen te injecteren met αIgM en vijf dagen later naar de abundantie van spliced eMLV te kijken. Ook ditmaal kon spliced eMLV niet gedetecteerd worden. Uit deze resultaten moesten we besluiten dat spliced eMLV door ons niet kon 43 Part 4: Discussion gedetecteerd worden, vermoedelijk levert onderzoek naar het bestaan van spliced MMTV dezelfde resultaten op. Wanneer virusdeeltjes gevormd worden nemen ze altijd een stukje cytoplasma mee op, dus ook RNA dat zich in het cytoplasma bevindt. Het kan het gebeuren dat dit RNA dat verkeerdelijk in het virusdeeltje gepakt werd, in cDNA wordt omgezet samen met het volledige virale transcript bij de infectie van een nieuwe cel. Dit zou even vaak moeten voorkomen voor alle spliced RNA species in de cel. Om te onderzoeken of dit mechanisme van actie zou kunnen zijn voor spliced eMLV cDNA werd onderzocht of spliced eMLV RNA zich in de virusdeeltjes bevindt. Het supernatans van M. dunni RARV2 cellen bevat eMLV virusdeeltjes. Er werd spliced eMLV RNA in het supernatans teruggevonden, maar vergeleken met ribosomaal RNA bleek dit niet verrijkt te zijn, waaruit we kunnen concluderen dat spliced eMLV RNA niet meer abundant is in het supernatans dan enig ander RNA. De qPCR voor spliced eMLV DNA bleek onder de detectielimiet te liggen, wat erop wijst dat dit mechanisme waarschijnlijk niet betrokken is bij het maken van spliced eMLV cDNA. Wat dan wel de oorzaak is van het krachtige qPCR signaal, dat waargenomen werd door de onderzoeksgroep van Beutler, blijft ons een raadsel. Aangezien we dezelfde primersequenties hanteerden voor de amplificatie van spliced eMLV, kan dit niet aan de basis van deze discrepantie liggen. Een mogelijke verklaring is de contaminatie van PCR reagentia met reverse transcriptase. Zo zou spliced eMLV RNA ongewild in vitro in cDNA kunnen omgezet worden en dit resultaat verklaren. Niet enkel een verhoogde abundantie aan spliced cDNA maar ook een verhoogde abundantie aan volledig ERV cDNA werd gedetecteerd in bovengenoemd artikel. Sommige strikt intracellulaire ERVs zijn in staat de volledige virale levenscyclus te vervullen binnen een zelfde cel. Deze ERVs hebben de functie van het env gen verloren dat nodig is voor de vorming van het virusdeeltje. Dit betekent dat deze ERVs een manier hebben gevonden om de nodige activatie van enzymen bij infectie van een nieuwe cel te omzeilen. Om de T-cel onafhankelijke B-cel activatie verder te onderzoeken was het nodig ook deze data eerst te bevestigen. De focus werd gelegd op de strikt intracellulaire ERVs IAP, Mus-D en MuERV-L. Bij qPCR kan hierbij kan geen onderscheid gemaakt worden tussen verwerkt en onverwerkt DNA of cDNA, aangezien er geen introns aanwezig zijn. De enige mogelijkheid om cDNA te detecteren is aldus de verrijking van de hoeveelheid ERV DNA in het cytoplasma te schatten ten opzichte van de volledige cel. Deze methode wordt in de voorgenoemde publicatie van Beutlers onderzoeksgroep toegepast. Om te normaliseren voor de hoeveelheid DNA werd genomisch DNA gebruikt, meer bepaald het huishoudgen GAPDH. Dit betekent dat de contaminatie van het cytoplasmatisch extract met materiaal uit de nucleus wordt gebruikt voor normalisatie. Deze verhouding geeft echter in belangrijke mate het succes in scheiding van cytoplasma en nucleus weer. Een erg goede scheiding zal leiden tot een schijnbaar hoge abundantie van ERV cDNA aangezien er weinig genomisch DNA in het cytoplasma teruggevonden kan worden. Een minder goede scheiding leidt dan weer tot de assumptie dat ERV cDNA weinig abundant is aangezien er veel meer genomisch DNA aanwezig is. Daarom is het gebruik van resterend genomisch DNA in het cytoplasma niet betrouwbaar, tenzij de scheiding tussen nuclei en cytoplasma gelijkwaardig en goed genoeg was. Een verhoging in abundantie in cDNA geschat 44 Part 4: Discussion ten opzichte van genomisch DNA zoals in de publicatie van Beutler moet dus steeds met grote voorzichtigheid geïnterpreteerd worden. Om deze reden werd in onze experimenten mitochondriaal DNA opgenomen om het niveau van genomisch materiaal in het cytoplasma te kunnen schatten. De verhouding van mitochondriaal DNA ten opzichte van genomisch DNA in het cytoplasma ten opzichte van de volledige cel geeft een beeld van het succes in scheiding. Men verwacht ruwweg een twintigvoudige aanrijking van mitcohondriaal DNA te zien in het cytoplasma voor een goede scheiding waarin men ook de verrijking van ERV DNA kan waarnemen. B-cellen werden gestimuleerd met αIgM en vervolgens werd het cytoplasma geëxtraheerd van gestimuleerde en niet-gestimuleerde cellen. Er werd een qPCR analyse gedaan voor de ERVs IAP, Mus-D en Mu-ERV-L. Wanneer de zuiverheid van het cytoplasma bekeken werd bleek dat het cytoplasma van niet-gestimuleerde cellen erg verrijkt was voor mitochondriaal en ERV DNA ten opzichte van de volledige cel. Wanneer echter de zuiverheid van het cytoplasma van gestimuleerde cellen werd geschat, kon helemaal geen aanrijking in mitochondriaal DNA waargenomen worden. Dit is waarschijnlijk te wijten aan de proliferatie van gestimuleerde cellen. Wanneer celdeling plaatsvindt, verdwijnt het nucleaire membraan tijdelijk, een vereiste voor een succesvolle scheiding van cytoplasma en nucleus. Uit deze experimenten kon dus geen conclusie getrokken worden over een potentiele verhoging in ERV cDNA na stimulatie van B-cellen. De conclusies getrokken uit de resultaten van de experimenten in Beutlers onderzoeksgroep zijn dus wellicht ten prooi gevallen aan misinterpretatie. Toch kunnen enkele conclusies getrokken worden uit onze resultaten. Het opmerkelijkst is dat ERV cDNA reeds in hoge concentraties aanwezig is in B-cellen voor stimulatie. Een hypothese waarbij de grenswaarde voor detectie door nucleïnezuursensoren wordt overschreden na B-cel stimulatie en verhoogde expressie van ERV RNA lijkt eerder onwaarschijnlijk en zal zeker verder onderzocht moeten worden. Het zou bijvoorbeeld ook kunnen zijn dat B-cel stimulatie met een TI2 antigeen een verandering in de nucleïnezuursensoren teweegbrengt, waardoor ze gevoeliger worden voor ERVs. Om een sluitend antwoord te geven op de vraag welke cDNA species aanwezig zijn in het cytoplasma zal het cytoplasma van B-cellen met ‘deep sequencing’ geanalyseerd worden. De verrijking van reads die allen beginnen aan de transcriptiestartsite van ERVs ten opzichte van andere reads zal een aanwijzing zijn voor cDNA in het cytoplasma. Ook de overexpressie van het meest actieve endogene reverse transcriptase, LINE-1, zal enige antwoorden brengen. Op deze manier kan nagegaan worden welke RNA species in theorie in het cytoplasma kunnen voorkomen. Beide experimenten zullen meer licht schijnen op het bedenkelijke bestaan van spliced eMLV cDNA. Een tweede luik in dit project bestond erin ERVs, en in het bijzonder MLVs, te induceren in de EL4 cellijn. Deze cellijn is afgeleid van een muis T-cel lymfoom. De inductie van ERVs met BrdU bleek toxisch voor de cellen. Vermoedelijk ondergingen de cellen celdood voor ERVs konden geïnduceerd worden. Er was dus geen verschil te zien in MLV expressie voor en na stimulatie met BrdU. De histon deacetylase inhibitors SAHA en PdbU/ionomycine bleken ook niet in staat te zijn MLVs te induceren, hoewel deze niet toxisch bleken voor de cellen. In EL4 BrdU resistente cellen bleek het eveneens niet mogelijk om MLVs te induceren met BrdU, maar wel om een andere reden: de expressie van MLVs was reeds heel hoog in niet gestimuleerde 45 Part 4: Discussion cellen. Waarschijnlijk werden ERVs geïnduceerd tijdens het resistent maken van de EL4 cellen voor BrdU. Een qPCR werd gelopen om te bepalen welke groep MLVs een hogere expressie vertoonde ten opzichte van de originele EL4 cellijn. Ecotropisch MLV bleek de enige MLV familie die een significant hogere expressie vertoonde. Tot slot bevestigde een infectiviteitstest van het supernatans van deze cellijn op M. dunni cellen dat het geëxpresseerde MLV infectieus is. Het supernatans van deze cellen bleek ook enkel een verhoogde expressie in ecotropisch MLV te hebben, wat erop wijst dat het eMLV is die zorgde voor de infectie van M. dunni cellen in de infectiviteitstest. De EL4 en EL4 BrdU resistente cellijn kunnen gebruikt worden in verder onderzoek naar de rol van ERVs in kankerontwikkeling. 46 Part 5: Materials and Methods Part 5: Materials and Methods 5.1. Mice Inbred C57BL/6J (B6) mice were originally obtained from The Jackson Laboratory (Bar Harbor, Maine, USA) and were subsequently maintained at NIMR animal facilities. Mice are kept on an autoclaved diet and water at a neutral pH for B6/WT mice or at pH 2.5 for congenic, transgenic or mutant mice. Mice with wild type ERV expression are C57BL6/J (B6). Mice lacking RAG-1 have previously been described (Mombaerts et al, 1992). These mice lack the recombination activating gene 1, that plays a role in V(D)J recombination. As a consequence, these mice fail to develop mature B and T lymphocytes. These mice have been shown to have a high abundance of infectious eMLV (Young et al, 2012a). Mice lacking eMLV have been described (Young et al, 2012c). These mice are a cross between an EF4.1 mouse strain (Antunes et al, 2008) and an emv2-/- mouse strain (Young et al, 2012c). The eMLV KO mice are lacking the only known eMLV in the B6 genome: emv2. Mice with infectious eMLV are the result of a cross between male B6 and female RAG-/- mice. RAG-/- have infectious eMLV (Young et al, 2012a) that is transmitted to the F1 of RAG-/females with WT males (unpublished data and results section). Unlike the RAG-/- mice, these mice have mature B- and T-cells. 5.2. Cell culture All cell cultures were incubated in IMDM supplemented with 5% heat inactivated FCS (Biosera), 2 mM L-glutamine, 100U/ml penicillin, 100 µg/ml streptomycin and 10 µM βmercaptoethanol (all Sigma-Aldrich) at 37°C and 5% CO2. EL4 and EL4 BrdU resistant cells (both Sigma-Aldrich) were incubated for two days with BrdU (Sigma-Aldrich) at a concentration of 2 or 20 µg/ml. In a separate experiment, EL4 cells were incubated for one or two days with 0.2 or 2 µM SAHA (also known as Vorinostat, Sigma-Aldrich) or with PdbU and ionomycin (both Sigma-Aldrich, both at 500 ng/ml). Cells were passed upon 50-100% confluence. Adherent cells (M. dunni, Sigma-Aldrich, and M. dunni RARV2, Young et al, 2012a) were trypsinised with homemade trypsin-EDTA. 5.3. q(RT-)PCR For DNA isolation cells were lysed in tail buffer (50 mM Tris (pH 8.0), 100 mM EDTA, 100 mM NaCl, 1% SDS) with proteinase K (Roche, 50 µg/ml). Samples were treated with RNAseA (Invitrogen) before DNA was isolated using isopropanol and 70% and 100 % ethanol. Supernatant, cytoplasmic fraction and nuclear fraction were handled in the same way. The supernatant of M. dunni RARV2 cells was taken after a three hour incubation period in fresh medium after extensive washing of the cells. For RNA preparation cells were lysed with RLT buffer complemented with β-mercaptoethanol (10 µl/ml, Qiagen). RNA was isolated using the RNeasy Mini Qiacube kit (Qiagen). Samples were treated with DNAseI (Qiagen) before a Qiacube RNeasy mini cleanup was done. 47 Part 5: Materials and Methods Target 5`3` forward primer 5`3` reverse primer HPRT TTGTATACCTAATCATTATGCCGAG CATCTCGAGCAAGTCTTTCA IFNAR1 AAGATGTGCTGTTCCCTTCCTCTGCTCTGA ATTATTAAAAGAAAAGACGAGGCGAAGTGG MT-CO2 GAGCAGTCCCCTCCCTAGGA GGTTTGATGTTACTGTTGCTTGATTT 18s rRNA CTTAGAGGGACAAGTGGCG ACGCTGAGCCAGTCAGTGTA eMLV AGGCTGTTCCAGAGATTGTG TTCTGGACCACCACACGAC xMLV TCTATGGTACCTGGGGCTC GGCAGAGGTATGGTTGGAGTAG pMLV CCGCCAGGTCCTCAATATAG AGAAGGTGGGGCAGTCT mMLV CCGCCAGGTCCTCAATATAG CGTCCCAGGTTGTATAGAGG spliced eMLV CCAGGGACCACCGACCCACCGT TAGTCGGTCCCGGTAGGCCTCG CD86 GCCACCCACAGGATCAATTA GTTTCGGGTGACCTTGCTTA Mus-D GTGCTAACCCAACGCTGGTTC CTCTGGCCTGAAACAACTCCTG Mu-ERV-L ATCTCCTGGCACCTGGTATG AGAAGAAGGCATTTGCCAGA IAP AAGCAGCAATCACCCACTTTGG CAATCATTAGATGTGGCTGCCAAG CAATCATTAGATGCGGCTGCCAAG Table 5.1. Primers Complementary DNA synthesis was done by use of the High Capacity cDNA Reverse Transcription Kit (Life Technologies) with RNase-inhibitor (Promega) and cleaned using Qiacube Quiaquick PCR cleanup. Purified DNA or cDNA was used as template for q(RT-)PCR with use of the Fast SYBR Green Master Mix (Life Technologies) on a 7900HT cycler (Applied Biosystems). Fast q(RT-)PCR was run with a 20-95 °C holding stage and 40 cycles of 60 to 95 °C. All primers were obtained from Eurofins MWG Operon (Ebersberg, Germany). The sequences of all used primers are listed in table 5.1. For the expression analysis of MLVs, primers amplifying the respective env gene were used for qRT-PCR: eMLV, xMLV, pMLV and mMLV (Yoshinobu et al, 2009). Note that, as the envelope does not contain any splice sites, these primers are not able to distinguish between genomic DNA and cDNA (in vitro or in vivo reverse transcribed). Primers for spliced CD86 cDNA were used to assess the expression of CD86, indicating B-cell activation. Primers for the housekeeping gene HPRT were made to amplify only spliced cDNA to exclude genomic DNA. The qRT-PCR Ct values are plotted relative to the expression of HPRT as: 2(Ct value HPRT – Ct value of target)x10^4, an adapted form of the Delta-Ct method (Livak & Schmittgen, 2001). The abundance of spliced eMLV cDNA was assessed by qPCR with primers for the spliced env gene of eMLV (Young et al, 2012c). As reference gene, IFNAR1 was used to standardise abundance. The forward primer for IFNAR1 targets an exon-intron boundary, the reverse 48 Part 5: Materials and Methods primer an exonic region. As a consequence, both genomic DNA and spliced cDNA can be amplified by primers for IFNAR1. The qPCR Ct values are plotted relative to IFNAR1 following the equation 2(Ct value IFNAR1 – Ct value of target)x10^4. The primers for spliced eMLV are equally capable of amplifying in vitro reverse transcribed RNA. When primers for spliced eMLV were used in qRT-PCR to assess eMLV expression, data was normalized to HPRT as mentioned above or in the same manner to 18s rRNA for RNA in the supernatant of M. dunni RARV2 cells. The abundance of RNA in the supernatant of EL4 BrdU resistant cells on the other hand, was measured relative to the RNA expression of murine B6 RNA in the same qRT-PCR and corrected for cell count and copy number using the formula 2(Ct value MLV in B6 - Ct value MLV in supernatant)x10^4 x copy number and recalculated to represent the RNA abundance per ml supernatant. The abundance of Mus-D (Karimi et al, 2011), Mu-ERV-L (Macfarlan et al, 2011) and IAP (Karimi et al, 2011) was estimated using exonic primers for the respective ERVs. As no spliced RNA product is made, these primers are not able to distinguish gDNA from cDNA. The abundance was plotted relative to IFNAR1 using the adapted Delta-Ct method. In cytoplasmic extracts, next to IFNAR1, MT-CO2 was used to standardise the data. Primers for MT-CO2 (Rodriguez-Cuenca et al, 2010) amplify mitochondrial DNA. 5.4. B-cell purification and stimulation Spleen single-cell suspensions were made from mice spleens. Ammonium-chloride-potassium lysis buffer (ACK lysis buffer, 150 mM ammonium chloride, 1 mM potassium bicarbonate and 0.1 mM EDTA at a pH of 7.2-7.4) was used to lyse erythrocytes. B-cells were purified using immunomagnetic positive selection (StemCell Technologies) according to the manufacturer's instructions. In early experiments, B-cells were stimulated in vitro with goat anti mouse IgM (Jackson ImmunoResearch) at 10 µg/ml or LPS (from Salmonella minnesota R595, Axxora) at 10 µg/ml during one or two days in IMDM supplemented with 5% FCS (Sigma-Aldrich) at 37°C and 5% CO2. In later experiments, B-cells were activated in vivo by the IV injection of 100 µl 1.3 mg/ml αIgM. Cells were used for DNA preparation as described in the method section for q(RT-)PCR. The cytoplasmic and nuclear fractions were extracted using the NE-PER™ Nuclear and Cytoplasmic Extraction Reagents Kit (Life Technologies) according to the manufacturer’s instructions. DNA was isolated from these samples with use of tail buffer with proteinase K as previously described. The purity of cytoplasmic extracts was measured by qPCR by the enrichment for MT-CO2 relative to IFNAR1 in the cytoplasm relative to the whole cells. 5.5. Flow cytometry To stain for the envelop protein for MLV, homemade 83A25 rat monoclonal antibody (Evans et al, 1990) was used as primary antibody. IgG2a mouse anti-rat FITC antibody (BD Biosciences) was used as secondary antibody. CD3-APC or CD19-APC (Biolegend) was used to stain for T-cells. B220-PE (e-bioscience) was used for B-cell staining. CD86-pacific blue and MHCII-PE (biolegend) were used to stain for B-cell activation. During all washing steps and to retain stained cells, homemade PBS-azide with 2% FCS was used. When required, FcBlock (antibody clone 2.4G2, homemade) was added to stains. Flow cytometry was performed on a BD FACSCanto or BD FACS LSRFortessa device (Both BD Biosciences) with BD FACSDiva software. Compensation was done manually with use of this software. Results were analysed with FlowJo Version 10 (Tree Star Inc., Ashland, OR, USA). 49 Part 5: Materials and Methods 5.6. Infectivity assay Supernatant from EL4 BrdU resistant cells was harvested when approaching 100% confluence. The supernatant was added in an eight step dilution series of 1 to 3 to M. dunni cells, at 20000 cells/ml with 8 µg/ml polybrene (Sigma-Aldrich). Cells with supernatant were incubated for three days at 37°C and 5% CO2 in IMDM medium supplemented with 5 % FCS. The infection rate was assessed by flow cytometry after cellular EL4 contamination was checked by microscopy. As positive control, supernatant of M. dunni RARV2 cells was taken; these cells have been proven to produce infectious ERVs (Young et al, 2012a). As negative control EL4 BrdU resistant cells were incubated without added supernatant. 5.7. Statistical analyses Sigmaplot version 13.0 (Systat Software Inc.) was used to calculate standard errors and make statistical comparisons. If the data was distributed normally, the unpaired Student’s t-test was run; otherwise the non-parametric two-tailed Mann–Whitney Rank Sum test was used to determine p-values. 50 References References Aaronson SA, Todaro GJ, Scolnick EM (1971) Induction of murine C-type viruses from clonal lines of virus-free BALB-3T3 cells. Science 174: 157-159 Ablasser A, Hemmerling I, Schmid-Burgk JL, Behrendt R, Roers A, Hornung V (2014) TREX1 deficiency triggers cell-autonomous immunity in a cGAS-dependent manner. J Immunol 192: 5993-5997 Adkins B, Hunter T (1981) Identification of a packaged cellular mRNA in virions of rous sarcoma virus. J Virol 39: 471-480 Aicardi J, Goutieres F (1984) A progressive familial encephalopathy in infancy with calcifications of the basal ganglia and chronic cerebrospinal fluid lymphocytosis. Annals of neurology 15: 49-54 Ansari-Lari MA, Gibbs RA (1996) Expression of human immunodeficiency virus type 1 reverse transcriptase in trans during virion release and after infection. J Virol 70: 3870-3875 Antunes I, Tolaini M, Kissenpfennig A, Iwashiro M, Kuribayashi K, Malissen B, Hasenkrug K, Kassiotis G (2008) Retrovirus-specificity of regulatory T cells is neither present nor required in preventing retrovirus-induced bone marrow immune pathology. Immunity 29: 782-794 Aronoff R, Linial M (1991) Specificity of retroviral RNA packaging. J Virol 65: 71-80 Ayukawa HM, Saltzburg D, Mukherjee BB (1979) In vivo induction of endogenous retroviruses in BALB/c mouse hepatocytes by successive treatments with carbon tetrachloride and bromodeoxyuridine. Int J Cancer 24: 498503 Bannert N, Kurth R (2004) Retroelements and the human genome: New perspectives on an old relation. Proceedings of the National Academy of Sciences 101: 14572-14579 Beck-Engeser GB, Eilat D, Wabl M (2011) An autoimmune disease prevented by anti-retroviral drugs. Retrovirology 8: 91 Belshaw R, Pereira V, Katzourakis A, Talbot G, Paces J, Burt A, Tristem M (2004) Long-term reinfection of the human genome by endogenous retroviruses. P Natl Acad Sci USA 101: 4894-4899 Best S, Le Tissier P, Towers G, Stoye JP (1996) Positional cloning of the mouse retrovirus restriction gene Fv1. Nature 382: 826-829 Bjerregaard B, Holck S, Christensen IJ, Larsson LI (2006) Syncytin is involved in breast cancer-endothelial cell fusions. Cell Mol Life Sci 63: 1906-1911 Brashishkite DA, Galetsky SA, Kuliffay P, Lizonova A, Tatosyan AG, Urbancikova M, Kisselyov FL, Grofova M (1988) BrdU-induced changes in the provirus of PR-RSV in mammalian cells. Neoplasma 35: 643-650 Burdette DL, Monroe KM, Sotelo-Troha K, Iwig JS, Eckert B, Hyodo M, Hayakawa Y, Vance RE (2011) STING is a direct innate immune sensor of cyclic di-GMP. Nature 478: 515-518 Cardiff RD, Kenney N (2011) A compendium of the mouse mammary tumor biologist: from the initial observations in the house mouse to the development of genetically engineered mice. Cold Spring Harbor perspectives in biology 3 Civril F, Deimling T, de Oliveira Mann CC, Ablasser A, Moldt M, Witte G, Hornung V, Hopfner KP (2013) Structural mechanism of cytosolic DNA sensing by cGAS. Nature 498: 332-337 51 References Crow YJ, Rehwinkel J (2009) Aicardi-Goutieres syndrome and related phenotypes: linking nucleic acid metabolism with autoimmunity. Human molecular genetics 18: R130-136 de Parseval N, Heidmann T (2005) Human endogenous retroviruses: from infectious elements to human genes. Cytogenet Genome Res 110: 318-332 Dewannieux M, Dupressoir A, Harper F, Pierron G, Heidmann T (2004) Identification of autonomous IAP LTR retrotransposons mobile in mammalian cells. Nat Genet 36: 534-539 Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C (2004) Innate antiviral responses by means of TLR7mediated recognition of single-stranded RNA. Science 303: 1529-1531 Duelli D, Lazebnik Y (2003) Cell fusion: a hidden enemy? Cancer cell 3: 445-448 Esnault C, Maestre J, Heidmann T (2000) Human LINE retrotransposons generate processed pseudogenes. Nat Genet 24: 363-367 Esnault C, Priet S, Ribet D, Vernochet C, Bruls T, Lavialle C, Weissenbach J, Heidmann T (2008) A placentaspecific receptor for the fusogenic, endogenous retrovirus-derived, human syncytin-2. P Natl Acad Sci USA 105: 17532-17537 Evans LH, Morrison RP, Malik FG, Portis J, Britt WJ (1990) A neutralizable epitope common to the envelope glycoproteins of ecotropic, polytropic, xenotropic, and amphotropic murine leukemia viruses. Journal of Virology 64: 6176-6183 Fassati A, Goff SP (1999) Characterization of intracellular reverse transcription complexes of Moloney murine leukemia virus. J Virol 73: 8919-8925 Feschotte C, Gilbert C (2012) Endogenous viruses: insights into viral evolution and impact on host biology. Nature reviews Genetics 13: 283-296 Freimanis G, Hooley P, Ejtehadi HD, Ali HA, Veitch A, Rylance PB, Alawi A, Axford J, Nevill A, Murray PG, Nelson PN (2010) A role for human endogenous retrovirus-K (HML-2) in rheumatoid arthritis: investigating mechanisms of pathogenesis. Clinical and experimental immunology 160: 340-347 Gall A, Treuting P, Elkon KB, Loo YM, Gale M, Jr., Barber GN, Stetson DB (2012) Autoimmunity initiates in nonhematopoietic cells and progresses via lymphocytes in an interferon-dependent autoimmune disease. Immunity 36: 120-131 Gallis B, Linial M, Eisenman R (1979) An avian oncovirus mutant deficient in genomic RNA: characterization of the packaged RNA as cellular messenger RNA. Virology 94: 146-161 Giles KE, Caputi M, Beemon KL (2004) Packaging and reverse transcription of snRNAs by retroviruses may generate pseudogenes. RNA (New York, NY) 10: 299-307 Goff SP (1990) Retroviral Reverse Transcriptase: Synthesis, Structure, and Function. JAIDS Journal of Acquired Immune Deficiency Syndromes 3: 817-831 Goff SP, Lobel LI (1987) Mutants of murine leukemia viruses and retroviral replication. Biochim Biophys Acta 907: 93-123 Goldstone DC, Ennis-Adeniran V, Hedden JJ, Groom HCT, Rice GI, Christodoulou E, Walker PA, Kelly G, Haire LF, Yap MW, de Carvalho LPS, Stoye JP, Crow YJ, Taylor IA, Webb M (2011) HIV-1 restriction factor SAMHD1 is a deoxynucleoside triphosphate triphosphohydrolase. Nature 480: 379-U134 Goubau D, Deddouche S, Reis e Sousa C (2013) Cytosolic Sensing of Viruses. Immunity 38: 855-869 52 References Grasset EK, Cerutti A (2014) Immunology. Retroviral help for B cells. Science 346: 1454-1455 Gurtler C, Bowie AG (2013) Innate immune detection of microbial nucleic acids. Trends Microbiol 21: 413-420 Hancks DC, Kazazian HH, Jr. (2012) Active human retrotransposons: variation and disease. Curr Opin Genet Dev 22: 191-203 Heil F, Hemmi H, Hochrein H, Ampenberger F, Kirschning C, Akira S, Lipford G, Wagner H, Bauer S (2004) Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303: 1526-1529 Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S (2000) A Toll-like receptor recognizes bacterial DNA. Nature 408: 740-745 Herniou E, Martin J, Miller K, Cook J, Wilkinson M, Tristem M (1998) Retroviral diversity and distribution in vertebrates. J Virol 72: 5955-5966 Horie M, Honda T, Suzuki Y, Kobayashi Y, Daito T, Oshida T, Ikuta K, Jern P, Gojobori T, Coffin JM, Tomonaga K (2010) Endogenous non-retroviral RNA virus elements in mammalian genomes. Nature 463: 84-87 Hughes JF, Coffin JM (2005) Human endogenous retroviral elements as indicators of ectopic recombination events in the primate genome. Genetics 171: 1183-1194 Ikawa Y, Ross J, Leder P (1974) An Association Between Globin Messenger RNA and 60S RNA Derived from Friend Leukemia Virus. Proceedings of the National Academy of Sciences 71: 1154-1158 Ikeda H, Laigret F, Martin MA, Repaske R (1985) Characterization of a molecularly cloned retroviral sequence associated with Fv-4 resistance. Journal of virology 55: 768-777 Izui S, McConahey PJ, Clark JP, Hang LM, Hara I, Dixon FJ (1981) Retroviral gp70 immune complexes in NZB x NZW F2 mice with murine lupus nephritis. The Journal of experimental medicine 154: 517-528 Izui S, McConahey PJ, Theofilopoulos AN, Dixon FJ (1979) Association of circulating retroviral gp70-anti-gp70 immune complexes with murine systemic lupus erythematosus. The Journal of experimental medicine 149: 1099-1116 Jern P, Coffin JM (2008) Effects of retroviruses on host genome function. Annual review of genetics 42: 709732 Jern P, Sperber GO, Blomberg J (2005) Use of endogenous retroviral sequences (ERVs) and structural markers for retroviral phylogenetic inference and taxonomy. Retrovirology 2: 50 Karimi MM, Goyal P, Maksakova IA, Bilenky M, Leung D, Tang JX, Shinkai Y, Mager DL, Jones S, Hirst M, Lorincz MC (2011) DNA methylation and SETDB1/H3K9me3 regulate predominantly distinct sets of genes, retroelements, and chimeric transcripts in mESCs. Cell Stem Cell 8: 676-687 Kawai T, Akira S (2010) The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11: 373-384 Kazazian HH, Jr., Goodier JL (2002) LINE drive. retrotransposition and genome instability. Cell 110: 277-280 Kelly DP (2011) Cell biology: Ageing theories unified. Nature 470: 342-343 Konvalinka J, Krausslich HG, Muller B (2015) Retroviral proteases and their roles in virion maturation: Virology. 2015 May;479-480C:403-417. doi: 10.1016/j.virol.2015.03.021. Epub 2015 Mar 26. Lamprecht B, Walter K, Kreher S, Kumar R, Hummel M, Lenze D, Kochert K, Bouhlel MA, Richter J, Soler E, Stadhouders R, Johrens K, Wurster KD, Callen DF, Harte MF, Giefing M, Barlow R, Stein H, Anagnostopoulos I, 53 References Janz M, Cockerill PN, Siebert R, Dorken B, Bonifer C, Mathas S (2010) Derepression of an endogenous long terminal repeat activates the CSF1R proto-oncogene in human lymphoma. Nat Med 16: 571-579, 571p following 579 Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehoczky J, LeVine R, McEwan P, McKernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C, Rosetti M, Santos R, Sheridan A, Sougnez C, Stange-Thomann N, Stojanovic N, Subramanian A, Wyman D, Rogers J, Sulston J, Ainscough R, Beck S, Bentley D, Burton J, Clee C, Carter N, Coulson A, Deadman R, Deloukas P, Dunham A, Dunham I, Durbin R, French L, Grafham D, Gregory S, Hubbard T, Humphray S, Hunt A, Jones M, Lloyd C, McMurray A, Matthews L, Mercer S, Milne S, Mullikin JC, Mungall A, Plumb R, Ross M, Shownkeen R, Sims S, Waterston RH, Wilson RK, Hillier LW, McPherson JD, Marra MA, Mardis ER, Fulton LA, Chinwalla AT, Pepin KH, Gish WR, Chissoe SL, Wendl MC, Delehaunty KD, Miner TL, Delehaunty A, Kramer JB, Cook LL, Fulton RS, Johnson DL, Minx PJ, Clifton SW, Hawkins T, Branscomb E, Predki P, Richardson P, Wenning S, Slezak T, Doggett N, Cheng JF, Olsen A, Lucas S, Elkin C, Uberbacher E, Frazier M, Gibbs RA, Muzny DM, Scherer SE, Bouck JB, Sodergren EJ, Worley KC, Rives CM, Gorrell JH, Metzker ML, Naylor SL, Kucherlapati RS, Nelson DL, Weinstock GM, Sakaki Y, Fujiyama A, Hattori M, Yada T, Toyoda A, Itoh T, Kawagoe C, Watanabe H, Totoki Y, Taylor T, Weissenbach J, Heilig R, Saurin W, Artiguenave F, Brottier P, Bruls T, Pelletier E, Robert C, Wincker P, Smith DR, Doucette-Stamm L, Rubenfield M, Weinstock K, Lee HM, Dubois J, Rosenthal A, Platzer M, Nyakatura G, Taudien S, Rump A, Yang H, Yu J, Wang J, Huang G, Gu J, Hood L, Rowen L, Madan A, Qin S, Davis RW, Federspiel NA, Abola AP, Proctor MJ, Myers RM, Schmutz J, Dickson M, Grimwood J, Cox DR, Olson MV, Kaul R, Raymond C, Shimizu N, Kawasaki K, Minoshima S, Evans GA, Athanasiou M, Schultz R, Roe BA, Chen F, Pan H, Ramser J, Lehrach H, Reinhardt R, McCombie WR, de la Bastide M, Dedhia N, Blocker H, Hornischer K, Nordsiek G, Agarwala R, Aravind L, Bailey JA, Bateman A, Batzoglou S, Birney E, Bork P, Brown DG, Burge CB, Cerutti L, Chen HC, Church D, Clamp M, Copley RR, Doerks T, Eddy SR, Eichler EE, Furey TS, Galagan J, Gilbert JG, Harmon C, Hayashizaki Y, Haussler D, Hermjakob H, Hokamp K, Jang W, Johnson LS, Jones TA, Kasif S, Kaspryzk A, Kennedy S, Kent WJ, Kitts P, Koonin EV, Korf I, Kulp D, Lancet D, Lowe TM, McLysaght A, Mikkelsen T, Moran JV, Mulder N, Pollara VJ, Ponting CP, Schuler G, Schultz J, Slater G, Smit AF, Stupka E, Szustakowski J, Thierry-Mieg D, Thierry-Mieg J, Wagner L, Wallis J, Wheeler R, Williams A, Wolf YI, Wolfe KH, Yang SP, Yeh RF, Collins F, Guyer MS, Peterson J, Felsenfeld A, Wetterstrand KA, Patrinos A, Morgan MJ, de Jong P, Catanese JJ, Osoegawa K, Shizuya H, Choi S, Chen YJ (2001) Initial sequencing and analysis of the human genome. Nature 409: 860-921 Lander MR, Chattopadhyay SK (1984) A Mus dunni cell line that lacks sequences closely related to endogenous murine leukemia viruses and can be infected by ectropic, amphotropic, xenotropic, and mink cell focusforming viruses. Journal of virology 52: 695-698 Lavie L, Medstrand P, Schempp W, Meese E, Mayer J (2004) Human endogenous retrovirus family HERVK(HML-5): status, evolution, and reconstruction of an ancient betaretrovirus in the human genome. J Virol 78: 8788-8798 Lebon P, Badoual J, Ponsot G, Goutieres F, Hemeury-Cukier F, Aicardi J (1988) Intrathecal synthesis of interferon-alpha in infants with progressive familial encephalopathy. J Neurol Sci 84: 201-208 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408 Loo Y-M, Gale Jr M (2011) Immune Signaling by RIG-I-like Receptors. Immunity 34: 680-692 Lowy DR, Rowe WP, Teich N, Hartley JW (1971) Murine leukemia virus: high-frequency activation in vitro by 5iododeoxyuridine and 5-bromodeoxyuridine. Science 174: 155-156 Lund J, Sato A, Akira S, Medzhitov R, Iwasaki A (2003) Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. The Journal of experimental medicine 198: 513-520 Lund JM, Alexopoulou L, Sato A, Karow M, Adams NC, Gale NW, Iwasaki A, Flavell RA (2004) Recognition of single-stranded RNA viruses by Toll-like receptor 7. P Natl Acad Sci USA 101: 5598-5603 54 References Macfarlan TS, Gifford WD, Agarwal S, Driscoll S, Lettieri K, Wang J, Andrews SE, Franco L, Rosenfeld MG, Ren B, Pfaff SL (2011) Endogenous retroviruses and neighboring genes are coordinately repressed by LSD1/KDM1A. Genes Dev 25: 594-607 Maksakova IA, Romanish MT, Gagnier L, Dunn CA, de Lagemaat LNV, Mager DL (2006) Retroviral elements and their hosts: Insertional mutagenesis in the mouse germ line. PLoS Genet 2: 1-10 McClure MA, Johnson MS, Feng DF, Doolittle RF (1988) Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny. Proc Natl Acad Sci U S A 85: 2469-2473 Medstrand P, Mager DL (1998) Human-specific integrations of the HERV-K endogenous retrovirus family. Journal of Virology 72: 9782-9787 Meisler MH, Ting CN (1993) The remarkable evolutionary history of the human amylase genes. Crit Rev Oral Biol Med 4: 503-509 Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE (1992) RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68: 869-877 Moreno-Garcia ME, Sommer KM, Bandaranayake AD, Rawlings DJ (2006) Proximal signals controlling B-cell antigen receptor (BCR) mediated NF-kappaB activation. Advances in experimental medicine and biology 584: 89-106 Morrish TA, Gilbert N, Myers JS, Vincent BJ, Stamato TD, Taccioli GE, Batzer MA, Moran JV (2002) DNA repair mediated by endonuclease-independent LINE-1 retrotransposition. Nat Genet 31: 159-165 Muriaux D, Mirro J, Harvin D, Rein A (2001) RNA is a structural element in retrovirus particles. Proceedings of the National Academy of Sciences 98: 5246-5251 Nethe M, Berkhout B, van der Kuyl AC (2005) Retroviral superinfection resistance. Retrovirology 2: 52 O'Neill LA, Bowie AG (2007) The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling. Nat Rev Immunol 7: 353-364 O'Neill LA, Golenbock D, Bowie AG (2013) The history of Toll-like receptors - redefining innate immunity. Nat Rev Immunol 13: 453-460 Perl A, Colombo E, Dai H, Agarwal R, Mark KA, Banki K, Poiesz BJ, Phillips PE, Hoch SO, Reveille JD, et al. (1995) Antibody reactivity to the HRES-1 endogenous retroviral element identifies a subset of patients with systemic lupus erythematosus and overlap syndromes. Correlation with antinuclear antibodies and HLA class II alleles. Arthritis Rheum 38: 1660-1671 Perron H (1998) [MSRV retrovirus and gliotoxin protein: potential biological markers in multiple sclerosis?]. Annales de biologie clinique 56: 427-438 Perron H, Dougier-Reynaud HL, Lomparski C, Popa I, Firouzi R, Bertrand JB, Marusic S, Portoukalian J, JouvinMarche E, Villiers CL, Touraine JL, Marche PN (2013) Human endogenous retrovirus protein activates innate immunity and promotes experimental allergic encephalomyelitis in mice. PLoS One 8: e80128 Powell RD, Holland PJ, Hollis T, Perrino FW (2011) Aicardi-Goutieres Syndrome Gene and HIV-1 Restriction Factor SAMHD1 Is a dGTP-regulated Deoxynucleotide Triphosphohydrolas. Journal of Biological Chemistry 286: 43596-43600 Rasmussen HB (1997) Interactions between Exogenous and Endogenous Retroviruses. J Biomed Sci 4: 1-8 Rein A (1994) Retroviral RNA packaging: a review. Arch Virol Suppl 9: 513-522 55 References Reome JB, Johnston DS, Helmich BK, Morgan TM, Dutton-Swain N, Dutton RW (2000) The effects of prolonged administration of 5-bromodeoxyuridine on cells of the immune system. J Immunol 165: 4226-4230 Ribet D, Dewannieux M, Heidmann T (2004) An active murine transposon family pair: Retrotransposition of “master” MusD copies and ETn trans-mobilization. Genome Res 14: 2261-2267 Ribet D, Harper F, Dewannieux M, Pierron G, Heidmann T (2007) Murine MusD Retrotransposon: Structure and Molecular Evolution of an “Intracellularized” Retrovirus. Journal of Virology 81: 1888-1898 Rice GI, Bond J, Asipu A, Brunette RL, Manfield IW, Carr IM, Fuller JC, Jackson RM, Lamb T, Briggs TA, Ali M, Gornall H, Couthard LR, Aeby A, Attard-Montalto SP, Bertini E, Bodemer C, Brockmann K, Brueton LA, Corry PC, Desguerre I, Fazzi E, Cazorla AG, Gener B, Hamel BCJ, Heiberg A, Hunter M, van der Knaap MS, Kumar R, Lagae L, Landrieu PG, Lourenco CM, Marom D, McDermott MF, van der Merwe W, Orcesi S, Prendiville JS, Rasmussen M, Shalev SA, Soler DM, Shinawi M, Spiegel R, Tan TY, Vanderver A, Wakeling EL, Wassmer E, Whittaker E, Lebon P, Stetson DB, Bonthron DT, Crow YJ (2009) Mutations involved in Aicardi-Goutieres syndrome implicate SAMHD1 as regulator of the innate immune response. Nature Genetics 41: 829-U889 Rice GI, Kasher PR, Forte GMA, Mannion NM, Greenwood SM, Szynkiewicz M, Dickerson JE, Bhaskar SS, Zampini M, Briggs TA, Jenkinson EM, Bacino CA, Battini R, Bertini E, Brogan PA, Brueton LA, Carpanelli M, De Laet C, de Lonlay P, del Toro M, Desguerre I, Fazzi E, Garcia-Cazorla A, Heiberg A, Kawaguchi M, Kumar R, Lin JPSM, Lourenco CM, Male AM, Marques W, Mignot C, Olivieri I, Orcesi S, Prabhakar P, Rasmussen M, Robinson RA, Rozenberg F, Schmidt JL, Steindl K, Tan TY, van der Merwe WG, Vanderver A, Vassallo G, Wakeling EL, Wassmer E, Whittaker E, Livingston JH, Lebon P, Suzuki T, McLaughlin PJ, Keegan LP, O'Connell MA, Lovell SC, Crow YJ (2012) Mutations in ADAR1 cause Aicardi-Goutieres syndrome associated with a type I interferon signature. Nature Genetics 44: 1243-1248 Rodriguez-Cuenca S, Cocheme HM, Logan A, Abakumova I, Prime TA, Rose C, Vidal-Puig A, Smith AC, Rubinsztein DC, Fearnley IM, Jones BA, Pope S, Heales SJ, Lam BY, Neogi SG, McFarlane I, James AM, Smith RA, Murphy MP (2010) Consequences of long-term oral administration of the mitochondria-targeted antioxidant MitoQ to wild-type mice. Free radical biology & medicine 48: 161-172 Rulli SJ, Jr., Hibbert CS, Mirro J, Pederson T, Biswal S, Rein A (2007) Selective and nonselective packaging of cellular RNAs in retrovirus particles. J Virol 81: 6623-6631 Shimizu A, Nakatani Y, Nakamura T, Jinno-Oue A, Ishikawa O, Boeke JD, Takeuchi Y, Hoshino H (2014) Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells. Sci Rep 4: 5074 Smith DM (1993) Endogenous retroviruses in xenografts. N Engl J Med 328: 142-143 Stetson DB, Ko JS, Heidmann T, Medzhitov R (2008) Trex1 prevents cell-intrinsic initiation of autoimmunity. Cell 134: 587-598 Stocking C, Kozak CA (2008) Murine endogenous retroviruses. Cellular and molecular life sciences : CMLS 65: 3383-3398 Stoye JP, Coffin JM (1987) The four classes of endogenous murine leukemia virus: structural relationships and potential for recombination. Journal of Virology 61: 2659-2669 Stoye JP, Fenner S, Greenoak GE, Moran C, Coffin JM (1988) Role of endogenous retroviruses as mutagens: the hairless mutation of mice. Cell 54: 383-391 Sun L, Wu J, Du F, Chen X, Chen ZJ (2013) Cyclic GMP-AMP Synthase Is a Cytosolic DNA Sensor That Activates the Type I Interferon Pathway. Science 339: 786-791 Telesnitsky A, Goff SP (1997) Reverse Transcriptase and the Generation of Retroviral DNA. In Retroviruses, Coffin JM, Hughes SH, Varmus HE (eds). Cold Spring Harbor (NY) 56 References Venables PJ, Brookes SM, Griffiths D, Weiss RA, Boyd MT (1995) Abundance of an endogenous retroviral envelope protein in placental trophoblasts suggests a biological function. Virology 211: 589-592 Volkman HE, Stetson DB (2014) The enemy within: endogenous retroelements and autoimmune disease. Nat Immunol 15: 415-422 Vyse TJ, Drake CG, Rozzo SJ, Roper E, Izui S, Kotzin BL (1996) Genetic linkage of IgG autoantibody production in relation to lupus nephritis in New Zealand hybrid mice. The Journal of clinical investigation 98: 1762-1772 Wang-Johanning F, Frost AR, Johanning GL, Khazaeli MB, LoBuglio AF, Shaw DR, Strong TV (2001) Expression of human endogenous retrovirus k envelope transcripts in human breast cancer. Clin Cancer Res 7: 1553-1560 Wang T, Zeng J, Lowe CB, Sellers RG, Salama SR, Yang M, Burgess SM, Brachmann RK, Haussler D (2007) Species-specific endogenous retroviruses shape the transcriptional network of the human tumor suppressor protein p53. P Natl Acad Sci USA 104: 18613-18618 Wang Y, Liska F, Gosele C, Sedova L, Kren V, Krenova D, Ivics Z, Hubner N, Izsvak Z (2010) A novel active endogenous retrovirus family contributes to genome variability in rat inbred strains. Genome Res 20: 19-27 Weiss R (2006) The discovery of endogenous retroviruses. Retrovirology 3: 67 Weiss RA (2013) On the concept and elucidation of endogenous retroviruses. Philos Trans R Soc Lond B Biol Sci 368: 20120494 Weiss RA, Mason WS, Vogt PK (1973) Genetic recombinants and heterozygotes derived from endogenous and exogenous avian RNA tumor viruses. Virology 52: 535-552 Wilkinson D, Mager D, Leong J-A (1994) Endogenous Human Retroviruses. In The Retroviridae, Levy J (ed), 9, pp 465-535. Springer US Xiong Y, Eickbush TH (1990) Origin and evolution of retroelements based upon their reverse transcriptase sequences. Embo J 9: 3353-3362 Yi JM, Kim HM, Kim HS (2004) Expression of the human endogenous retrovirus HERV-W family in various human tissues and cancer cells. J Gen Virol 85: 1203-1210 Yi JM, Kim HM, Kim HS (2006) Human endogenous retrovirus HERV-H family in human tissues and cancer cells: expression, identification, and phylogeny. Cancer Lett 231: 228-239 Yoshinobu K, Baudino L, Santiago-Raber ML, Morito N, Dunand-Sauthier I, Morley BJ, Evans LH, Izui S (2009) Selective Up-Regulation of Intact, but Not Defective env RNAs of Endogenous Modified Polytropic Retrovirus by the Sgp3 Locus of Lupus-Prone Mice. Journal of Immunology 182: 8094-8103 Young GR, Eksmond U, Salcedo R, Alexopoulou L, Stoye JP, Kassiotis G (2012a) Resurrection of endogenous retroviruses in antibody-deficient mice. Nature 491: 774-778 Young GR, Kassiotis G, Stoye JP (2012b) Emv2, the only endogenous ecotropic murine leukemia virus of C57BL/6J mice. Retrovirology 9: 23 Young GR, Ploquin MJ, Eksmond U, Wadwa M, Stoye JP, Kassiotis G (2012c) Negative selection by an endogenous retrovirus promotes a higher-avidity CD4+ T cell response to retroviral infection. PLoS Pathog 8: 10 Yu P, Lubben W, Slomka H, Gebler J, Konert M, Cai C, Neubrandt L, Prazeres da Costa O, Paul S, Dehnert S, Dohne K, Thanisch M, Storsberg S, Wiegand L, Kaufmann A, Nain M, Quintanilla-Martinez L, Bettio S, Schnierle 57 References B, Kolesnikova L, Becker S, Schnare M, Bauer S (2012) Nucleic acid-sensing Toll-like receptors are essential for the control of endogenous retrovirus viremia and ERV-induced tumors. Immunity 37: 867-879 Zeng M, Hu Z, Shi X, Li X, Zhan X, Li XD, Wang J, Choi JH, Wang KW, Purrington T, Tang M, Fina M, DeBerardinis RJ, Moresco EM, Pedersen G, McInerney GM, Karlsson Hedestam GB, Chen ZJ, Beutler B (2014) MAVS, cGAS, and endogenous retroviruses in T-independent B cell responses. Science 346: 1486-1492 Zhang Z, Carriero N, Gerstein M (2004) Comparative analysis of processed pseudogenes in the mouse and human genomes. Trends in Genetics 20: 62-67 58 on hydroxamic 83a25 acid; PdbU: positive cells phorbol as shown in 12,13- plots. density dibutyrate. Attachments Attachments Protocols B-cell isolation Harvest spleen Pass spleen through 0.2 micron filter with 5 ml ACK lysis buffer Add filtered spleen suspension to tube Add 1 ml of IMDM buffer to filter to take up remaining cells, add filtered suspension to tube, fill up until final volume of 10 ml is reached Take 10 µl of cells for counting Spin down cells for 7 minutes at 1200 rpm Following manufacturer’s instructions of EasySep™ Mouse PE Positive Selection Kit (Stemcell Technologies): Prepare cell suspension at 1x108/ml in AB IMDM. For rare cells this can be 2x108/ml. For fewer than 107 cells use 100 µl. Add FcBlock and primary PE-labelled antibody and incubate for at least 30 min (RT or 4C) Spin down for 7 minutes at 1200 rpm and wash once with AB IMDM and resuspend at 1x108/ml. Transfer into 14-ml round-bottom tubes (Falcon). Up to 10 ml per tube. Add EasySep PE Selection cocktail at 25 µl/ml of cell suspension (for 10 ml cells you need to add 250 µl). Mix well and incubate at RT for 15-20 min. Add EasySEp Magnetic Nanoparticles (beads). Mix well the beads to ensure uniform suspension by pipetting 5 times up and down (do not vortex). Add 25 µl/ml to cell suspension (they are usually supplied in excess, but check that the kit contains at least equal volumes of PE Selection cocktail and Magnetic Nanoparticles). Mix well and incubate at RT for 10-15 min. Mix the cells gently Place the tube (without cap) on the magnet and leave for 5 min Pour off non-labelled cells. Pick up the magnet, and in one continuous motion invert the magnet and tube, pouring off the supernatant fraction (the magnetically labelled cells will remain inside the tube). Leave the magnet and tube in inverted position for 2-3 seconds, then return to upright position (do not shake or blot off any drops that may remain hanging from the mouth of the tube) For positive selection Remove the tube from the magnet and add 10 ml of AB IMDM. Place in magnet and repeat last two steps once more. 59 Attachments Cytoplasmic extraction Following manufacturer’s instructions of NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Life Technologies): For suspension cells, harvest by centrifuging at 500 × g for 5 minutes. Wash cells by suspending the cell pellet with PBS. Transfer 1- 10 × 106 cells to a 1.5 mL microcentrifuge tube and pellet by centrifugation at 500 × g for 2 – 3 minutes. Use a pipette to carefully remove and discard the supernatant, leaving the cell pellet as dry as possible. Add ice - cold CER I to the cell pellet (Table 1). Proceed to Cytoplasmic and Nuclear Protein Extraction, using the reagent volumes indicated in Table 1. Table 1. Reagent volumes for different packed cell volumes.* Packed Cell Volume (μL) 10 20 50 100 CER I ( μL) CER II (μL) NER (μL) 100 5.5 50 200 11 100 500 27.5 250 1000 55 500 Vortex the tube vigorously on the highest setting for 15 seconds to fully suspend the cell pellet. Incubate the tube on ice for 10 minutes. Add ice-cold CER II to the tube. Vortex the tube for 5 seconds on the highest setting. Incubate tube on ice for 1 minute. Vortex the tube for 5 seconds on the highest setting. Centrifuge the tube for 5 minutes at maximum speed in a microcentrifuge (~16,000 × g). Immediately transfer the supernatant (cytoplasmic extract) to a clean pre-chilled tube. Place this tube on ice until use or storage (see Step 10). Store extracts at -80°C until use. 60 Attachments DNA extraction Spin cells down at 2000 rpm for 2 minutes Wash pellet with 500 µl DPBS (Sigma-Aldrich) Spin down at 2000 rpm for 2 minutes Discard supernatant carefully Resuspend pellet in 500 µl tail buffer add +/- 50 µg/ml (10 µl) protein kinase Incubate over night at 56°C Let cool down Add 5 µl 20 µg/µl RNase A (Life Technologies) Incubate for 1-2 hours at 37 °C Add 0.6 volumes of isopropanol to samples Mix well by turning upside down Spin down at max speed for 5 minutes Remove isopropanol Add 300 µl 70% ethanol Spin down at max speed for 5 minutes Remove ethanol Add 300 µl 100% ethanol Spin down at max speed for 5 minutes Remove ethanol Let air-dry Resuspend in water Leave at room temperature for 2-4 hours; at 37°C for 1-2 hours or overnight at 4°C Store at -20°C 61 Attachments RNA extraction and cDNA synthesis from cell culture Material Cell lysate in 350µl RLT buffer with β-mercaptoethanol (10µl/ml, Qiagen) (kept at 4 °C) RNase-Free DNase Set (Qiagen 79254) High Capacity cDNA Reverse Transcription Kit (Life Technologies 4368814) Recombinant RNasin Ribonuclease Inhibitor (Promega N2511) RNAeasy mini QIAcube Kit (Qiagen 74116) Rotor adapter (Qiagen 990394) QIAquick PCR purification (Qiagen 28106) RNA extraction Transfer cell lysate to 2 ml tubes Switch the Qiacube on and follow the instruction: RNA RNA easy mini Animal tissues and cells Standard Edit: elution volume to 80µl Press start and follow the instruction on the machine DNA digestion Prepare the following master mix (in µl for 1 tube) RDD buffer (4C) 10 DNase (aliquot in -20C) 5 H2O 5 Add 20µl of master mix per tube and incubate at room temperature for 10 minutes. Transfer 100 µl of RNA to 2 ml tube and clean on the Qiacube Qiacube: Clean up RNAeasy mini Edit elution volume: 30 µl Press start and follow the instruction cDNA synthesis Prepare the following master mix (in µl for 1 tube) RT buffer 6 Random primers 6 dNTP 2.4 RT 3 RNAin 0.75 H2O 11.85 62 Attachments Add 30 µl of master mix per tube and incubate at 37 °C for 2h. Prepare the QIAcube rotors with 1.5 mL tubes and QIAquick PCR purple columns. Transfer cDNA in 2 ml tube and clean on the Qiacube. Qiacube: Clean up QIAquick PCR Standard Edit fill up volume 40µl and elution volume 100µl. Store at -20 °C. 63 Attachments RNA extraction and cDNA synthesis from cell culture supernatant (viral) Material Cell culture supernatant (spun and frozen at -70 °C) RNase-Free DNase Set (Qiagen 79254) High Capacity cDNA Reverse Transcription Kit (Life Technologies 4368814) Recombinant RNasin Ribonuclease Inhibitor (Promega N2511) RNAeasy mini QIAcube Kit (Qiagen 74116) QIAamp viral RNA Kit (Qiagen 52906) Rotor adapter (Qiagen 990394) QIAquick PCR purification (Qiagen 28106) QIAamp viral RNA Kit reagent preparation For 12 samples: Carrier RNA: Add 310 µL of AVE buffer to 310 µg of lyophilised carrier RNA (1tube). Mix thoroughly and freeze aliquots of 70 µL Add 6.72 mL of AVL buffer to 67.2 µL of carrier RNA-AVE (prepare fresh) (for 12 samples) RNA extraction Manual lysis: Pipet 560 µL of AVL-AVE-carrier RNA in a 1.5 mL tube Add 140 µL of sup and mix by vortexing 15 s Incubate at room temperature for 10 min then centrifuge briefly Transfer mix to 2 mL tubes Switch the Qiacube on and follow the instruction (on the machine and the virus manual lysis protocol sheet): Virus QIAamp viral RNA Body fluid Manual lysis Edit: elution volume to 85 µL Press start and follow the instruction on the machine DNA digestion Prepare the following master mix (in µl for 1 tube) RDD buffer (4°C) 10 DNase (aliquot in -20°C) 5 Add 15 µL of master mix per tube and incubate at room temperature for 10 min. Transfer 100 µL of RNA to 2mL tube and clean on the Qiacube Qiacube: Clean up RNAeasy mini 64 Attachments Edit elution volume: 30 µL Press start and follow the instruction cDNA synthesis Prepare the following master mix (in µL for 1 tube) RT buffer 6 Random primers 6 dNTP 2.4 RT 3 RNAin 0.75 H2O 11.85 Add 30 µL of master mix per tube and incubate at 37 °C for 2h. Prepare the QIAcube rotors with 1.5 mL tubes and QIAquick PCR purple columns. Transfer cDNA in 2 mL tube and clean on the Qiacube. Qiacube: Clean up QIAquick PCR Standard Edit fill up volume 40 µL and elution volume 30 µL. Store at -20 °C. 65 Attachments Q(RT-)PCR Mastermix (for one reaction): Nuclease free water Forward primer Reverse primer Fast SYBR® Green Master Mix µl 10,5 0,5 0,5 12,5 Add 24 µl of mastermix to 1 µl of (c)DNA template Run on 7900HT Fast Real-Time PCR (life technologies) with fast qPCR program or fast qPCR with melting curve program with reaction volume of 25 µl 66 Attachments Flow cytometry In 96 well plate: 250 µl cells (duplicate without staining: secondary Ab only for negative control) (optional also complete negative control (no primary nor secondary Ab)) Spin cells down, discard supernatant prepare primary antibody e.g. Antibody 83A25: 1/300, add 1.16 µl of antibody to 350 µl of FACS buffer Add primary antibody to cells: 100 µl (not to control cells) Add 100 µl FACS buffer to negative controls Leave at room temperature for +/- twenty minutes Spin down cells at 1200 rpm for two minutes Discard supernatant Wash with FACS buffer For two-step staining: prepare secondary antibody e.g. Anti-rat IgG2a – FITC (1/200 in FACS buffer), 3.5µl of antibody in 700µl of FACS buffer Add 100 µl secondary antibody to cells Add 100 µl FACS buffer to double negative controls Turn on FACS so it can warm up Leave at room temperature for 20 minutes Spin down cells for 2 minutes Discard supernatant prepare FACS tubes: add 150 µl FACS buffer to tubes (unfiltered) Press stained cells (150 µl) through filter on tube Analyse content with BD FACSCANTO or BD FACS LSRFortessa with FACSDiva software Note: FACS buffer is PBS-azide with 2% FCS 67 Attachments Virus infectivity and titre assay (83A25 staining) Prepare serial dilutions of viral sample to be tested in a flat-bottom 96 well plate in 100 µl final volume in IMDM Start from 1:3 to 1:30 dilution 11 x 3-fold dilutions in duplicate are normally sufficient Always include a standard of known titre (e.g. M. dunni RARV2) Trypsinise a small flask of M. dunni cells Start with a small flask at mid-log phase Remove medium Wash once with 5 ml PBS + 2mM EDTA Add 1 ml of Trypsin (put back at 37C for a few minutes) When cells have come off add 5 ml IMDM + 5% FCS and mix well Spin, resuspend in IMDM and count Suspend at 2 x 104/ml in IMDM Add polybrene at 8 µg/ml concentration (final concentration will be 4 µg/ml) Add 100 µl of cell suspension/well (this will be 3 x 103cells/well) Culture for 3 days On day 3, Trypsinise the plate stain with 83A25 Remove supernatant by flicking the plate Wash once with 50 µl PBS + 2mM EDTA/well Add 25 µl trypsin/well and incubate until cells detach Add 50 µl FACS buffer (PBS/azide + 2% FCS) and mix Transfer in 96-V bottom well plate and spin Stain with 83A25 (1 in 300) and continue with flow cytometry protocol Note: Work fast with the virus at room temperature (e.g. have the cell suspension ready before you make the serial dilutions) 68 Attachments Statistical reports Difference in Mus-D/IFNAR1 in cytoplasm and cells t-test Normality Test (Shapiro-Wilk): Failed (P < 0,050) Test execution ended by user request, Rank Sum Test begun Mann-Whitney Rank Sum Test Data source: Data 2 in spliced cDNA version with 2605 (2).JNB Group Col 1 Col 4 N 5 5 Missing 0 0 Median 5749047,369 1838037,317 25% 4798296,223 1580502,896 75% 5873808,087 1918481,541 Mann-Whitney U Statistic= 0,000 T = 40,000 n(small)= 5 n(big)= 5 P(est.)= 0,012 P(exact)= 0,008 The difference in the median values between the two groups is greater than would be expected by chance; there is a statistically significant difference (P = 0,008) Difference in Mu-ERV-L/IFNAR1 in cytoplasm and cells t-test Normality Test (Shapiro-Wilk): Passed (P = 0,708) Equal Variance Test (Brown-Forsythe): Passed (P = 0,224) Group Name Col 2 Col 5 Difference N 4 4 Missing 0 0 Mean 311700179,001 104771605,544 Std Dev 47153921,100 26307593,397 SEM 23576960,550 13153796,699 206928573,457 t = 7,665 with 6 degrees of freedom. 95 percent two-tailed confidence interval for difference of means: 140866693,455 to 272990453,458 Two-tailed P-value = 0,000258 The difference in the mean values of the two groups is greater than would be expected by chance; there is a statistically significant difference between the input groups (P = <0,001). One-tailed P-value = 0,000129 The sample mean of group Col 2 exceeds the sample mean of group Col 5 by an amount that is greater than would be expected by chance, rejecting the hypothesis that the population mean of group Col 5 is greater than or equal to the population mean of group Col 2. (P = <0,001). Power of performed two-tailed test with alpha = 0,050: 1,000 Power of performed one-tailed test with alpha = 0,050: 1,000 69 Attachments Difference in IAP/IFNAR1 in cytoplasm and cells t-test Normality Test (Shapiro-Wilk): Passed (P = 0,502) Equal Variance Test (Brown-Forsythe): Passed (P = 0,631) Group Name Col 3 Col 6 Difference N 7 6 Missing 0 0 Mean 13907452,528 7812952,940 Std Dev 3934504,433 3671751,413 SEM 1487102,894 1498986,237 6094499,588 t = 2,870 with 11 degrees of freedom. 95 percent two-tailed confidence interval for difference of means: 1420140,991 to 10768858,184 Two-tailed P-value = 0,0153 The difference in the mean values of the two groups is greater than would be expected by chance; there is a statistically significant difference between the input groups (P = 0,015). One-tailed P-value = 0,00763 The sample mean of group Col 3 exceeds the sample mean of group Col 6 by an amount that is greater than would be expected by chance, rejecting the hypothesis that the population mean of group Col 6 is greater than or equal to the population mean of group Col 3. (P = 0,008). Power of performed two-tailed test with alpha = 0,050: 0,743 Power of performed one-tailed test with alpha = 0,050: 0,851 70 Attachments MAVS, cGAS, and endogenous retroviruses in T-independent B cell responses 71 Attachments 72 Attachments 73 Attachments 74 Attachments 75 Attachments 76 Attachments 77
