Download Mating behavior and the evolution of sperm design

Mating behavior and the evolution of sperm design
Lukas Schärera,1, D. Timothy J. Littlewoodb, Andrea Waeschenbachb, Wataru Yoshidac, and Dita B. Vizosoa
a
Evolutionary Biology, Zoological Institute, University of Basel, 4051 Basel, Switzerland; bDepartment of Zoology, Natural History Museum, London SW7 5BD,
United Kingdom; and cDepartment of Biology, Faculty of Agriculture and Life Science, Hirosaki University, Aomori 036-8561, Japan
Edited by John C. Avise, University of California, Irvine, CA, and approved December 1, 2010 (received for review September 16, 2010)
Sperm are the most diverse of all animal cell types, and much of
the diversity in sperm design is thought to reflect adaptations to
the highly variable conditions under which sperm function and
compete to achieve fertilization. Recent work has shown that
these conditions often evolve rapidly as a consequence of multiple
mating, suggesting a role for sexual selection and sexual conflict in
the evolution of sperm design. However, very little of the striking
diversity in sperm design is understood functionally, particularly in
internally fertilizing organisms. We use phylogenetic comparative
analyses covering 16 species of the hermaphroditic flatworm
genus Macrostomum to show that a complex sperm design is associated with reciprocal mating and that this complexity is lost
secondarily when hypodermic insemination—sperm injection
through the epidermis—evolves. Specifically, the complex sperm
design, which includes stiff lateral bristles, is likely a male persistence trait associated with sexual conflicts over the fate of received ejaculates and linked to female resistance traits, namely
an intriguing postcopulatory sucking behavior and a thickened
epithelium of the sperm-receiving organ. Our results suggest that
the interactions between sperm donor, sperm, and sperm recipient
can change drastically when hypodermic insemination evolves, involving convergent evolution of a needle-like copulatory organ,
a simpler sperm design, and a simpler female genital morphology.
Our study documents that a shift in the mating behavior may alter
fundamentally the conditions under which sperm compete and
thereby lead to a drastic change in sperm design.
|
|
Platyhelminthes sexually antagonistic coevolution simultaneous
hermaphrodite sperm morphology traumatic insemination
|
|
P
arker’s (1–3) far-reaching extension of Darwin’s (4) narrow
focus on precopulatory mating interactions highlighted that
sexual selection continues to operate after mating partners have
agreed to mate and that considering postcopulatory sexual selection therefore is crucial to understand the evolution of many
reproductive traits (5, 6). This insight has led to extensive research in evolutionary biology that focused on understanding the
biology of sperm (7), the most diverse of all animal cell types (8,
9). From this research emerged an apparent consensus that the
diversity in sperm design—the strikingly variable ways of constructing a sperm—reflects the highly variable physiological and
morphological environments in which sperm have to survive,
function, and compete for fertilization (5, 10–14). Moreover, recent studies have documented clearly that these environments
can evolve rapidly, probably because of coevolutionary interactions linked to multiple mating and the resulting sexual selection and sexual conflicts (15–21). However, the bewildering
diversity in sperm design is poorly understood at the functional
level, particularly in internally fertilizing organisms (9, 12, 22). A
recent review on the evolution of sperm morphological diversity
concluded that we “currently have only a rudimentary understanding of the adaptive significance of [the awe-inspiring variation in sperm form]” and that we “know very little about sperm
behavior, particularly within the female reproductive tract” (9).
The reason for this lack of understanding is that the “goings-on”
inside the female reproductive tract often are difficult to study
(but see refs. 23–25).
In organisms with internal fertilization, multiple mating by
females generally is expected to lead to sexual conflicts over the
1490–1495 | PNAS | January 25, 2011 | vol. 108 | no. 4
fate of received ejaculates (19). Females may mate multiply for
different reasons: because it allows them to choose among sperm
from different males based on compatibility (26) or male quality
(including the competitive quality of their sperm) (27, 28), because they can obtain material benefits from the males (e.g.,
nuptial gifts or an adequate sperm supply) (26), or because, even
though multiple mating may be costly to females, resisting male
harassment is even costlier (18). After multiple mating, females
may attempt to control the fate of the received ejaculates, either
to exert choice or to lower direct costs [e.g., resulting from
polyspermy (18, 29)], thereby removing some sperm from the
fertilization set. In contrast, males always should prefer that their
sperm, rather than that of a competitor, be used for fertilization
(19), leading to sexual conflict. This definition of sexual conflict
is a broad one (19, 30) and follows the reasoning of Parker (19)
that “sexual conflict is present in all forms of female choice involving the rejection of some males, whether rejection occurs
because they are not attractive enough or because of the costs
they impose” (p. 236). In this scenario males therefore are expected to develop male persistence traits that allow them to
overcome such female control, even if that persistence occurs at
a cost to the females (19). This situation may lead to sexually
antagonistic coevolution between the male persistence traits and
the female resistance traits [as has been pointed out before (31),
female resistance is equivalent to female preference in that both
lead to a bias in the reproductive success toward persistent
males] and is expected to affect the evolution of both the sperm
and their environment.
In species with separate sexes, females often may be able to
evade some of these postcopulatory sexual conflicts by avoiding
males—either altogether or via precopulatory female choice—
whenever the costs of mating exceed the benefits. This outcome
is reflected nicely in the classical (precopulatory) mating roles,
namely, eager males and choosy females (32–34). In contrast,
simultaneous hermaphrodites cannot resolve these conflicts so
easily, because each individual is both male and female at the
same time. Here mating should be attempted whenever an individual can gain a net benefit from mating, for example, when
its male benefits minus its female costs are positive (35). This
inequality will be fulfilled even if the costs of mating to an
individual’s female fitness are substantial, as long as they are
compensated by sufficiently large benefits to its male fitness.
Multiple mating in the female role therefore may occur not only
for the reasons mentioned above but also as a consequence of
behaviors that primarily serve the interests of an individual’s
male sex function, such as actively approaching mating partners
Author contributions: L.S. and D.B.V. designed research; L.S., D.T.J.L., A.W., W.Y., and D.B.V.
performed research; L.S., D.T.J.L., and A.W. analyzed data; and L.S. wrote the paper. L.S.
established the online Macrostomorpha Taxonomy and Phylogeny database; and D.B.V.
made the drawings of the reproductive structures.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. FJ715315–FJ715305).
1
To whom correspondence should be addressed. E-mail: [email protected].
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1013892108/-/DCSupplemental.
www.pnas.org/cgi/doi/10.1073/pnas.1013892108
A very different solution to the above-mentioned conflicting
mating interests is the uncooperative insistence of the mating
partners on sperm donation while attempting to avoid sperm
receipt, a scenario that is likely to lead to forced unilateral sperm
donation, such as hypodermic insemination. Another species of
the same genus, Macrostomum hystrix, exhibits a suite of reproductive characters that fits this scenario and which we here
call the “hypodermic mating syndrome” (Fig. 1B). First, mating
occurs via hypodermic insemination, during which sperm are
injected through the epidermis into the parenchyma of the
partner (Movie S5) using a needle-like stylet (i.e., a stylet with a
rigid and pointed distal thickening and a subterminal stylet
opening, which can puncture the partner’s epidermis, presumably without clogging the stylet opening). Sucking behavior
never has been observed in this species. Second, the aflagellate
sperm also are highly motile (Movie S6) but are smaller, simpler,
and carry no bristles, presumably facilitating their movement
through tissue. Third, the female antrum is simple, without
a thickened epithelium, and lacks a prominent cellular valve. The
female antrum is involved only in egg laying.
Here we examine the evolution and coevolution of these
morphological and behavioral characters in the free-living flatworm genus Macrostomum. Specifically, we are interested in
understanding how stable and widespread the reciprocal and
hypodermic mating syndromes are and how they are distributed
phylogenetically. To this end, we collected and morphologically
described 16 different Macrostomum species, established the
molecular phylogeny of this taxonomic group, and used this information to perform phylogenetic comparative analyses, including character mapping, constraint analyses, ancestral state
reconstructions, and analyses of correlated evolution. Our results
show that the majority of species fall into one of the two syndromes and that the molecular phylogeny does not fully match
this morphological dichotomy, with the hypodermic mating
syndrome having re-evolved independently at least once from
the reciprocal mating syndrome. Moreover, we find strong evidence for correlated evolution between the mating behavior and
both male and female morphological characters, shedding light
on the evolution of sperm design.
Results
Molecular Phylogeny, Character Mapping, and Constraint Analysis.
To study the phylogenetic distribution of the above-mentioned
reproductive character states, we assembled a molecular phylogeny comprising 16 species of the free-living flatworm genus
Macrostomum. By mapping the character states of the collected
species (Table S1) onto this phylogeny, we can identify a first
clade (clade 1 in Fig. 2), all members of which share the hypodermic mating syndrome. In addition, we can identify a second
clade (clade 2 in Fig. 2), most members of which exhibit the
reciprocal mating syndrome. However, clade 2 also includes
A
B
Fig. 1. Morphology of the sperm and stylet of two Macrostomum species. (A) M. lignano, a species that represents the reciprocal mating syndrome. (B) M.
hystrix, a species that represents the hypodermic mating syndrome.
Schärer et al.
PNAS | January 25, 2011 | vol. 108 | no. 4 | 1491
EVOLUTION
and attempting to engage in sperm donation. Matings that are
disadvantageous to the female function therefore are more likely
to occur in simultaneous hermaphrodites, shifting sexual selection and sexual conflict from the pre- to the postcopulatory stage.
This argument assumes that multiple mating in simultaneous
hermaphrodites is primarily male-driven and that all individuals
in a population therefore tend to show a general willingness to
donate but not necessarily to receive sperm in most matings,
leading to conflicting mating interests (36). The extent to which
the biology of many simultaneous hermaphrodites supports this
assumption is an important focus of empirical research and is the
subject of an ongoing debate (37–39), but in the following discussion we will assume that it approximately holds.
One solution to such conflicting mating interests is reciprocal
mating in which mating partners simultaneously assume both the
male and the female role, with individuals accepting an ejaculate from the partner in exchange for an opportunity to donate
an ejaculate (36, 40). Although this behavior initially appears to
be a cooperative solution, it offers ample opportunity for postcopulatory sexual selection and sexual conflicts. Specifically, we
expect the evolution of female resistance traits that allow the fate
of any unwanted ejaculates to be controlled (36, 40) [e.g., sperm
digestion (41, 42)] and male persistence traits that defend against
such control [e.g., love darts and chemical manipulation (42,
43)]. A suite of reproductive characters in the free-living flatworm Macrostomum lignano is highly suggestive of such a scenario (Fig. 1A). Based on detailed behavioral (44), in vivo light
microscopic, and transmission electron microscopic observations
(23), we here define the “reciprocal mating syndrome.” First,
mating is reciprocal, with the stylet (the male intromittent genitalia) of each mate inserted into the partner via the female
genital opening and sperm deposited into the female antrum
(the sperm-receiving organ) of its partner (23). Moreover, mating often is followed directly by a postcopulatory sucking behavior (44) during which the worm bows down onto itself, places
its pharynx over its own female genital opening, and appears to
suck. After this behavior, sperm shafts often stick out of the
female genital opening (Movie S1). We have hypothesized that
this behavior is a female resistance trait involved in manipulating
the fate of the received ejaculate (23, 44). Second, the aflagellate
(45, 46) but highly motile sperm carries unusual characters with
a number of proposed functions (Fig. 1A and Movie S2) (23). It
has a frontal feeler, which allows the sperm to anchor itself in the
epithelium of the female antrum (Movies S3 and S4), and two
stiff lateral bristles, which, by interaction with the wall of the
female genital opening, may prevent the sperm from being removed during the sucking behavior (23). Third, the female antrum, which is also involved in egg laying, has a thickened part of
the epithelium, the cellular valve, in which the great majority of
the sperm feelers are anchored (23).
Fig. 2. Phylogenetic mapping of reproductive character states. Variation in sperm and stylet morphology, mating behavior, and female antrum morphology
among 16 species in the genus Macrostomum. (Details on character states are given in Table S1.) The character states are mapped on the maximum-likelihood
tree of the genus (complete ssrDNA and partial lsrDNA), and nodes marked with a circle have Bayesian posterior probability >0.95 and maximum-likelihood
bootstrap support of >70%. (A detailed tree with outgroups and exact nodal support values is given in Fig. S1.) Note that the stylet of Macrostomum tuba is
depicted at one-third of the original size.
one species, M. hystrix, with the hypodermic mating syndrome
(second species from the bottom in Fig. 2) (for a detailed tree
with outgroups and exact nodal support values see Fig. S1). A
Shimodaira–Hasegawa test strongly rejects a constrained tree
with a single origin of the hypodermic mating syndrome (i.e.,
forcing M. hystrix within clade 1) as an alternative a priori hypothesis to the current placement of this species (P < 0.001)
(Fig. S2). The split between the two clades and the nodes at their
base are well supported (Fig. S1), suggesting that the hypodermic
mating syndrome has evolved independently twice, representing
a clear case of convergent evolution. Indeed, the species exhibiting the hypodermic mating syndrome show striking similarities
in the morphology of sperm, stylet, and female antrum, whereas
species with the reciprocal mating syndrome exhibit considerable
interspecific variation in these structures (Fig. 2). Additionally,
Macrostomum finlandense, whose mating behavior currently is unknown, appears to be in transition between the two syndromes.
Its sperm bristles are short but externally visible, and although the
stylet is pointed and fairly rigid, it lacks a pointed distal thickening and has an oblique rather than subterminal stylet opening.
1492 | www.pnas.org/cgi/doi/10.1073/pnas.1013892108
Ancestral State Reconstruction. To understand further the origins
and evolution of the studied reproductive characters, we performed ancestral state reconstructions to assess the most probable
character states at important nodes in the molecular phylogeny.
Although the results of these analyses do not allow conclusions to
be drawn about the ancestral states of any of the investigated
characters at the base of the genus Macrostomum, they clearly
support the presence of the reciprocal mating syndrome at the
base of clade 2 (for trees with the estimated ancestral character
states, see Fig. S3). This result further supports the independent
origin of the hypodermic mating syndrome in M. hystrix.
Correlated Evolution. To assess statistically the degree to which
there is coevolution between the morphological and behavioral
characters, we performed two analyses of correlated evolution
(analysis A: male morphology vs. copulation behavior; analysis B:
female morphology vs. copulation behavior). The likelihoods resulting from these analyses indicate strong evidence for correlated
evolution, both for analysis A between the sperm design (and the
stylet morphology) and copulation behavior (logHdep = −9.82,
logHindep = −13.01, test statistic = 6.38), and for analysis B
Schärer et al.
between the female antrum morphology and copulation behavior
(logHdep = −11.77, logHindep = −14.61, test statistic = 5.68).
Moreover, the posterior distributions for the rate parameters
resulting from both analyses clearly confirm that the data do not fit
an independent model of character evolution (Fig. 3 and Fig. S4).
Because our ancestral state reconstructions leave the character
states at the base of the genus Macrostomum open, the analyses
further suggest that the hypodermic and reciprocal mating syndromes act as evolutionary attractors (i.e., species evolve away
from the transitional states toward the syndromes; Fig. 3, thick
arrows) and that it is somewhat more likely that a species evolves
a transition from the reciprocal to the hypodermic mating syndrome than vice versa (Fig. 3, medium arrows vs. thin arrows).
Discussion
Our study reveals an evolutionary link between mating behavior, male and female genital morphology, and sperm design.
Specifically, our results suggest that the character states defining the reciprocal mating and the hypodermic mating syndromes in the genus Macrostomum are the result of concerted
evolutionary changes and show that the majority of the studied
species clearly exhibit one of the two syndromes. The reciprocal
mating syndrome probably is driven by sexual conflict over the
fate of received ejaculates; this conflict occurs as a result of
reciprocal mating, leading to elaborate and highly variable female resistance and male persistence traits. In contrast, the hypodermic mating syndrome probably results from selection to
by-pass female resistance traits (36, 40, 47, 48), leading to
striking convergent evolution with little morphological variation
between species.
Hypodermic insemination is expected to impose novel selection pressures related to this type of sperm transfer and simultaneously to relax selection on the character states defining the
reciprocal mating syndrome. For example, sperm may be selected for efficient movement through tissue, perhaps favoring
Schärer et al.
the loss of the bristles. As hypodermic insemination spreads
through a population, the way sperm of different donors compete within the body of the recipient should resemble more
closely a fair-raffle sperm competition (2, 48), potentially favoring smaller and more numerous sperm. Furthermore, we expect
selection on the stylet for efficient hypodermic delivery of sperm
and that the evolution of the stylet no longer will be affected by
the female antrum. Similarly, selection on the female antrum will
be solely on the function of egg laying, because the antrum no
longer interacts with the stylet or the sperm.
A more detailed look at the stylet and female antrum morphologies associated with the reciprocal mating syndrome may
help identify possible starting points for the evolution of hypodermic insemination, because these morphologies suggest that
wounding might occur during reciprocal mating. In several species the stylets carry blunt distal thickenings, indicative of selection on the male function against wounding of the female
antrum. Furthermore, at least two species of Macrostomum have
sclerotized regions in the female antrum (49, 50) that might
represent female adaptations against wounding. However, when
the costs of wounding are small for the sperm donor, accidental
wounding during copulation could lead eventually to the evolution of hypodermic insemination.
The evolutionary origin of the sperm bristles currently is unclear (51). A study of sperm ultrastructure suggests a homology
between the bristles in Macrostomum and lateral ledges in the
sperm of Bradynectes sterreri (one of our outgroup species) and
Psammomacrostomum turbanelloides (51) (a likely relative of our
Gen. nov. 1, sp. nov. 1). These morphological structures do not
protrude outside the sperm, however, and therefore cannot have
an anchoring function. Moreover, it has been shown that
Macrostomum pusillum (a member of clade 1 in Fig. 2) has rudimentary bristles that are visible only at the ultrastructural level
(52). Together, these findings suggest that the morphological
structures that gave rise to the bristles were already present at
PNAS | January 25, 2011 | vol. 108 | no. 4 | 1493
EVOLUTION
Fig. 3. Correlated evolution of reproductive character states. Schematic diagram showing the most probable evolutionary routes for transitions between the
four possible combinations of character states of two binary variables. For analysis A, the first variable represents the sperm morphology (0, bristles absent; 1,
bristles present) or the stylet morphology (0, needle-like; 1, not needle-like) (SI Materials and Methods). For analysis B, the first variable represents female
antrum morphology (0, simple; 1, thickened). For both analyses A and B, the second variable represents the copulation behavior (0, hypodermic; 1, reciprocal).
Because the results of the two analyses are qualitatively similar, we show only one summary graph. The different arrows indicate three classes of transition rate
parameters: transition rates with a high probablitiy (>55%, thin arrows), intermediate probability (30–40%, medium arrows), and low probability (<15%, thick
arrows) of being zero. (The actual distributions of the transition rate parameters are given in Fig. S4.) Thus, thicker arrows represent more likely transitions.
Under the null hypothesis of independent evolution, certain pairs of transition parameters must be equal. (The rationale is discussed in SI Materials and
Methods.) The results clearly reject this null hypothesis, suggesting strong evidence for correlated evolution between the analyzed character states. Specifically,
the estimated transition rate parameters tend to favor correlated evolution toward either the hypodermic mating or reciprocal mating syndrome.
the base of the genus Macrostomum. The externally visible
bristles thus may have arisen at the base of the genus and been
lost twice, or they may have arisen at the base of clade 2 and
been lost once. Future studies on a wider range of taxa may
arbitrate between these two scenarios and may uncover more
cases of gains and losses in this structure.
It has been suggested that sexual selection and sexual conflicts
can generate rapid evolutionary diversification in reproductive
traits, and this notion is reflected by the use of these traits for
taxonomy in many groups of organisms (5, 9, 11, 53, 54). Our
results suggest that the degree to which this morphological diversification occurs may depend on the nature of the mating
behavior. The striking convergent evolution between the species
exhibiting the hypodermic mating syndrome (i.e., M. hystrix and
the members of clade 1) helps explain why these species are
difficult to distinguish based on reproductive morphology alone
and has considerable impact on a number of pressing taxonomical questions in this genus (SI Materials and Methods). In
contrast, the reciprocal mating syndrome appears to generate
extensive diversification in reproductive traits, thus providing
ample morphological information to distinguish species. It is interesting to speculate that the greater diversification within the
reciprocal mating syndrome may make it less evolutionarily stable
than the hypodermic mating syndrome, as suggested by the correlated evolution analyses (Fig. 3). If so, we would expect that
expanding the taxon sampling will reveal additional departures
from the reciprocal mating syndrome in clade 2. Alternatively,
because clade 1 currently contains few studied species, it also is
possible that wider taxon sampling will reveal departures from the
hypodermic mating syndrome.
Most studies that have investigated variation in sperm morphology in internally fertilizing organisms have aimed at explaining quantitative variations such as in sperm length within one
particular sperm design and have identified sperm competition (9,
12, 55) or the interactions between the sperm and the female
genital tract (11, 17, 21, 56) as the main evolutionary forces. Our
results suggest that a change in the mating behavior may lead to
strikingly different sperm designs within a single genus, and we
thus have identified conditions under which drastic shifts in sperm
design may arise rapidly and repeatedly. Shifts in mating behavior
from normal copulation to hypodermic or traumatic insemination
have occurred many times in both hermaphroditic [e.g., acoel
flatworms (57), polyclad flatworms (58), and sea slugs (59)] and
separate-sexed organisms [e.g., bed bugs (47), plant bugs (60),
and drosophilids (61)]. Therefore it will be interesting to investigate further the consequences of these shifts for the evolution of sperm design, morphology, and function. The striking
diversity in sperm and genital morphology in the genus Macrostomum, combined with the transparent nature of these worms,
offers a veritable ‘window of opportunity’ to begin to understand
the evolution of sperm morphological diversity.
have collected and observed ourselves were included in our data set, but
data for the outgroups were taken in part from the literature.
Digital Documentation and DNA Samples. We observed live specimens in
squeeze preparations using a Diaplan or a DM2500 compound microscope
(Leica Microsystems) with bright-field, differential interference contrast, or
phase-contrast illumination and at magnifications of 40×–1000× and documented their morphology with spatially calibrated micrographs and video,
using a digital videocamera [DFW-X700 (SONY) or DFK 41BF02 (Imaging
Source)] and image capture software (BTV Pro 5.4.1 or 6.0b1, available at
http://www.bensoftware.com/). Because these worms are transparent, we
can observe and document internal structures in detail without histological
sections (23, 63). Stylets were scored as “needle-like” if they had a rigid and
pointed distal thickening and a subterminal stylet opening, and the female
antrum was scored as “thickened” if the epithelium was clearly visible
(Movie S3) and/or if there was a clear cellular valve (23) (Table S1). To document sperm morphology, we recovered worms from squeeze preparations,
amputated the tail plate (64), and ruptured it by placing it on a microscope
slide in 1–2 μL of liquid and covering it with a coverslip. Fully formed sperm
emerged from the ruptured seminal vesicle and were documented (65).
Because sperm are sensitive to low osmotic pressure, we added small
amounts of diluted seawater for freshwater species to prevent osmotic
damage to the sperm (artifacts thereof sometimes are reported as bona fide
sperm morphology). Sperm were scored as “bristles present” if they had
externally visible bristles (Table S1). To prepare a DNA sample, we placed the
frontal part of the worm into absolute ethanol and stored it at 4 °C. We
documented the mating behavior with our established technique (44) for
a total of 6–52 h of observation of 4–29 individuals per field-collected species
(in pairs and larger groups) and analyzed the videos by frame-by-frame
observation. However, not all field-collected species mated under these
conditions, leading to some missing data in these character states (Table S1).
Moreover, extensive observational data were derived from observations
of the laboratory-cultured species (i.e., M. pusillum (Lignano), M. spirale,
M. lignano, and M. hystrix).
PCR, Sequencing, and Phylogenetic Analysis. For each species we sequenced (in
one to three specimens) the complete small subunit ribosomal DNA (ssrDNA)
and part (D1–D3) of the large subunit ribosomal DNA (lsrDNA) resulting in
a total of ∼2,850 base pairs. (Details on primers, PCR, sequencing, and deposition of sequences are given in Tables S2 and S3 and SI Materials and
Methods.) The resulting sequences were used to generate a phylogenetic
hypothesis for the interrelationships between the studied taxa using both
Bayesian inference and maximum likelihood analyses. (Details on alignments
and parameters used in analyses are given in SI Materials and Methods.)
Materials and Methods
Constraint Analysis, Ancestral State Reconstruction, and Analysis of Correlated
Evolution. We performed a constraint analysis (66) that tested whether the
data support the a priori hypothesis of a single origin of the hypodermic
mating syndrome. (Details are given in Fig. S2 and SI Materials and Methods.) Next we performed ancestral state reconstructions (67) to infer the
character states at the base of the genus Macrostomum and the base of
clade 2, both nodes that are well supported in the maximum likelihood and
Bayesian inference analyses. (Details are given in Table S1, Fig. S3, and SI
Materials and Methods.) Finally, we tested for correlated evolution between
pairs of discrete binary character states (i.e., male morphology vs. mating
behavior and female morphology vs. mating behavior) using BayesDiscrete
implemented in BayesTraits (68). The analyses were performed on a reduced
taxon set containing only the genus Macrostomum, the main focus of our
study. (Details are given in Fig. 3, Fig. S4, and SI Materials and Methods.)
Specimens. We collected specimens in a range of countries, habitats, and
water bodies, using a range of extraction techniques (i.e., decantation with
MgCl2, oxygen deterioration, direct extraction). For each species we give
information (SI Materials and Methods) on specimens, collection sites, species identification, taxonomic notes, and accession numbers to digital reference material deposited on the online Macrostomorpha Taxonomy and
Phylogeny database, an EDIT scratchpad (62) available at http://macrostomorpha.info. Given the highly variable quality of taxonomic descriptions
of the >100 species in the genus, only data on Macrostomum species that we
ACKNOWLEDGMENTS. We are indebted to the late Reinhard Rieger for
introducing us to the taxonomy of the Macrostomorpha, and thank Seth
Tyler and colleagues for maintaining the Turbellarian Taxonomic Database
(http://turbellaria.umaine.edu/). We also thank many volunteers and colleagues who helped us with field collections, especially Gregor Schulte, Peter
Ladurner, Floriano Papi, and Werner Armonies. We are grateful to Göran
Arnqvist, Dieter Ebert, Tim Janicke, Joris Koene, Nico Michiels, Markus
Pfenninger, Steve Ramm, Gunde Rieger, and Walter Salzburger for discussion and/or comments on earlier versions of the manuscript.
1. Parker GA (1970) Sperm competition and its evolutionary consequences in the insects.
Biol Rev Camb Philos Soc 45:525–567.
2. Parker GA (1998) Sperm competition and the evolution of ejaculates: Towards
a theory base. Sperm Competition and Sexual Selection, eds Birkhead TR, Møller AP
(Academic, London, England), pp 3–54.
3. Parker GA (1979) Sexual selection and sexual conflict. Sexual Selection and
Reproductive Competition in Insects, eds Blum MS, Blum NA (Academic, London), pp
123–166.
4. Darwin C (1871) The Descent of Man, and Selection in Relation to Sex (John Murray,
London).
1494 | www.pnas.org/cgi/doi/10.1073/pnas.1013892108
Schärer et al.
Schärer et al.
37. Leonard JL (2006) Sexual selection: Lessons from hermaphrodite mating systems.
Integr Comp Biol 46:349–367.
38. Janicke T, Schärer L (2009) Sex allocation predicts mating rate in a simultaneous
hermaphrodite. Proc R Soc London Ser B 276:4247–4253.
39. Anthes N, et al. (2010) Quantifying sexual selection through Bateman gradients: A reexamination of methods for hermaphroditic organisms. Am Nat 173:249–263.
40. Michiels NK (1998) Mating conflicts and sperm competition in simultaneous
hermaphrodites. Sperm Competition and Sexual Selection, eds Birkhead TR,
Møller AP (Academic, London), pp 219–254.
41. Sluys R (1989) Sperm resorption in triclads (Platyhelminthes, Tricladida). Inv Rep Dev
15:89–95.
42. Koene JM (2006) Tales of two snails: Sexual selection and sexual conflict in Lymnaea
stagnalis and Helix aspersa. Integr Comp Biol 46:419–429.
43. Chase R, Blanchard KC (2006) The snail’s love-dart delivers mucus to increase
paternity. Proc R Soc London Ser B 273:1471–1475.
44. Schärer L, Joss G, Sandner P (2004) Mating behaviour of the marine turbellarian
Macrostomum sp.: These worms suck. Mar Biol 145:373–380.
45. Bedini C, Papi F (1970) Peculiar patterns of microtubular organisation in spermatozoa
of lower Turbellaria. Comparative Spermatology, ed Baccetti B (Academic, New York),
pp 363–368.
46. Morrow EH (2004) How the sperm lost its tail: The evolution of aflagellate sperm. Biol
Rev Camb Philos Soc 79:795–814.
47. Stutt AD, Siva-Jothy MT (2001) Traumatic insemination and sexual conflict in the bed
bug Cimex lectularius. Proc Natl Acad Sci USA 98:5683–5687.
48. Schärer L, Janicke T (2009) Sex allocation and sexual conflict in simultaneously
hermaphroditic animals. Biol Lett 5:705–708.
49. Schmidt P, Sopott-Ehlers B (1976) Interstitielle Fauna von Galapagos XV. Macrostomum
O. Schmidt, 1948 und Siccomacrostomum triviale nov. gen. nov. spec. (Turbellaria,
Macrostomidae). Mikrofauna Meeresboden 57:1–45.
50. Ax P (1959) Zur Systematik, Ökologie und Tiergeographie der Turbellarienfauna in
den ponto-kaspischen Brackwassermeeren. Zool Jb Syst 87:43–187.
51. Willems M, et al. (2009) Ontogeny of the complex sperm in the macrostomid
flatworm Macrostomum lignano (Macrostomorpha, Rhabditophora). J Morphol 270:
162–174.
52. Rohde K, Faubel A (1997) Spermatogenesis in Macrostomum pusillum (Platyhelminthes,
Macrostomida). Inv Rep Dev 32:209–215.
53. Hosken DJ, Stockley P (2004) Sexual selection and genital evolution. Trends Ecol Evol
19:87–93.
54. Eberhard WG (1985) Sexual Selection and Animal Genitalia (Harvard Univ Press,
Cambridge, MA).
55. Fitzpatrick JL, et al. (2009) Female promiscuity promotes the evolution of faster sperm
in cichlid fishes. Proc Natl Acad Sci USA 106:1128–1132.
56. Dybas LK, Dybas HS (1981) Coadaptation and taxonomic differentiation of sperm and
spermathecae in featherwing beetles. Evolution 35:168–174.
57. Apelt G (1969) Fortpflanzungsbiologie, Entwicklungszyklen und vergleichende
Frühentwicklung acoeler Turbellarien. Mar Biol 4:267–325.
58. Michiels NK, Newman LJ (1998) Sex and violence in hermaphrodites. Nature 391:647.
59. Anthes N, Michiels NK (2007) Precopulatory stabbing, hypodermic injections and
unilateral copulations in a hermaphroditic sea slug. Biol Lett 3:121–124.
60. Tatarnic NJ, Cassis G, Hochuli DF (2006) Traumatic insemination in the plant bug
genus Coridromius Signoret (Heteroptera: Miridae). Biol Lett 2:58–61.
61. Kamimura Y (2007) Twin intromittent organs of Drosophila for traumatic insemination.
Biol Lett 3:401–404.
62. Smith VS, Rycroft SD, Harman KT, Scott B, Roberts D (2009) Scratchpads: A datapublishing framework to build, share and manage information on the diversity of
life. BMC Bioinformatics 10(Suppl 14):S6.
63. Ladurner P, Schärer L, Salvenmoser W, Rieger RM (2005) A new model organism
among the lower Bilateria and the use of digital microscopy in taxonomy of
meiobenthic Platyhelminthes: Macrostomum lignano, n. sp. (Rhabditophora,
Macrostomorpha). J Zool Syst Evol Res 43:114–126.
64. Schärer L, Vizoso DB (2007) Phenotypic plasticity in sperm production rate: There’s
more to it than testis size. Evol Ecol 21:295–306.
65. Janicke T, Schärer L (2010) Sperm competition affects sex allocation but not sperm
morphology in a flatworm. Behav Ecol Sociobiol 64:1367–1375.
66. Shimodaira H, Hasegawa M (1999) Multiple comparisons of log-likelihoods with
applications to phylogenetic inference. Mol Biol Evol 16:1114–1116.
67. Maddison WP, Maddison DR (2008) Mesquite: A modular system for evolutionary
analysis. Version 2.5. http://mesquiteproject.org. Accessed August 15, 2010.
68. Pagel M, Meade A (2006) Bayesian analysis of correlated evolution of discrete
characters by reversible-jump Markov Chain Monte Carlo. Am Nat 167:808–825.
PNAS | January 25, 2011 | vol. 108 | no. 4 | 1495
EVOLUTION
5. Eberhard WG (2009) Postcopulatory sexual selection: Darwin’s omission and its
consequences. Proc Natl Acad Sci USA 106(Suppl 1):10025–10032.
6. Birkhead TR (2010) How stupid not to have thought of that: Post-copulatory sexual
selection. J Zool (Lond) 281:78–93.
7. Birkhead TR, Hosken DJ, Pitnick S, eds (2009) Sperm Biology: An Evolutionary
Perspective (Academic, Burlington, MA).
8. Sivinski J (1984) Sperm in competition. Sperm Competition and the Evolution of
Animal Mating Systems, ed Smith RL (Academic, Orlando, FL), pp 85–115.
9. Pitnick S, Hosken DJ, Birkhead TR (2009) Sperm morphological diversity. Sperm Biology:
An Evolutionary Perspective, eds Birkhead TR, Hosken DJ, Pitnick S (Academic,
Burlington, MA), pp 69–149.
10. Franzén Å (1956) On spermiogenesis, morphology of the spermatozoon, and biology
of fertilization among invertebrates. Zoologiska Bidrag från Uppsala 33:1–28.
11. Pitnick S, Wolfner MF, Suarez SS (2009) Ejaculate-female and sperm-female
interaction. Sperm Biology: An Evolutionary Perspective, eds Birkhead TR, Hosken DJ,
Pitnick S (Academic, Burlington, MA), pp 247–304.
12. Pizzari T, Parker GA (2009) Sperm competition and the sperm phenotype. Sperm
Biology: An Evolutionary Perspective, eds Birkhead TR, Hosken DJ, Pitnick S (Academic,
Burlington, MA), pp 207–245.
13. Jamieson BGM, Rouse GW (1989) The spermatozoa of the polychaeta (Annelida): An
ultrastructural review. Biol Rev Camb Philos Soc 64:93–157.
14. Burns JR, Weitzman SH, Grier HJ, Menezes NA (1995) Internal fertilization, testis and sperm
morphology in glandulocaudinae fishes (Teleostei: Characidae: Glandulocaudinae).
J Morphol 224:131–145.
15. Swanson WJ, Clark AG, Waldrip-Dail HM, Wolfner MF, Aquadro CF (2001)
Evolutionary EST analysis identifies rapidly evolving male reproductive proteins in
Drosophila. Proc Natl Acad Sci USA 98:7375–7379.
16. Miller GT, Pitnick S (2002) Sperm-female coevolution in Drosophila. Science 298:
1230–1233.
17. Snook RR (2005) Sperm in competition: Not playing by the numbers. Trends Ecol Evol
20:46–53.
18. Arnqvist G, Rowe L (2005) Sexual Conflict (Princeton Univ Press, Princeton).
19. Parker GA (2006) Sexual conflict over mating and fertilization: An overview. Philos
Trans R Soc Lond B Biol Sci 361:235–259.
20. Koene JM, Schulenburg H (2005) Shooting darts: Co-evolution and counteradaptation in hermaphroditic snails. BMC Evol Biol 5:25.
21. Beese K, Armbruster GFJ, Beier K, Baur B (2009) Evolution of female sperm-storage
organs in the carrefour of stylommatophoran gastropods. J Zool Syst Evol Res 47:
49–60.
22. Martin OY, Demont M (2008) Reproductive traits: Evidence for sexually selected
sperm. Curr Biol 18:R79–R81.
23. Vizoso DB, Rieger G, Schärer L (2010) Goings-on inside a worm: Functional hypotheses
derived from sexual conflict thinking. Biol J Linn Soc Lond 99:370–383.
24. Manier MK, et al. (2010) Resolving mechanisms of competitive fertilization success in
Drosophila melanogaster. Science 328:354–357.
25. LaMunyon CW, Ward S (1998) Larger sperm outcompete smaller sperm in the
nematode Caenorhabditis elegans. Proc R Soc London Ser B 265:1997–2002.
26. Zeh JA, Zeh DW (2003) Toward a new sexual selection paradigm: Polyandry, conflict
and incompatibility. Ethology 109:929–950.
27. Keller L, Reeve HK (1995) Why do females mate with multiple males? The sexually
selected sperm hypothesis. Adv Stud Behav 24:291–315.
28. Evans JP, Simmons LW (2008) The genetic basis of traits regulating sperm competition
and polyandry: Can selection favour the evolution of good- and sexy-sperm?
Genetica 134:5–19.
29. Birkhead TR, Møller AP, Sutherland WJ (1993) Why do females make it so difficult for
males to fertilize their eggs? J Theor Biol 161:51–60.
30. Eberhard WG, Cordero C (2003) Sexual conflict and female choice. Trends Ecol Evol 18:
438–439.
31. Rowe L, Cameron E, Day T (2005) Escalation, retreat, and female indifference as
alternative outcomes of sexually antagonistic coevolution. Am Nat 165(Suppl 5):
S5–S18.
32. Bateman AJ (1948) Intra-sexual selection in Drosophila. Heredity 2:349–368.
33. Dewsbury DA (2005) The Darwin-Bateman paradigm in historical context. Integr
Comp Biol 45:831–837.
34. Snyder BF, Gowaty PA (2007) A reappraisal of Bateman’s classic study of intrasexual
selection. Evolution 61:2457–2468.
35. Michiels NK, Koene JM (2006) Sexual selection favors harmful mating in
hermaphrodites more than in gonochorists. Integr Comp Biol 46:473–480.
36. Charnov EL (1979) Simultaneous hermaphroditism and sexual selection. Proc Natl
Acad Sci USA 76:2480–2484.
Supporting Information
Schärer et al. 10.1073/pnas.1013892108
SI Materials and Methods
PCR and Sequencing. For each species we sequenced (in one to
three specimens) the complete small subunit ribosomal DNA
(ssrDNA) and part (D1–D3) of the large subunit ribosomal DNA
(lsrDNA) resulting in a total of ∼2,850 base pairs. Total genomic
DNA (gDNA) was extracted from the DNA samples using the
DNeasy tissue kit (QIAGEN) following the manufacturer’s
instructions; gDNA was eluted in 2× 100-μL volumes. PCR reactions were carried out in 25-μL volumes using Illustra puReTaq
Ready-To-Go PCR beads (GE Healthcare), 1 μL of 10 μM of
each primer (a list of primers is given in Table S2), and 1–2 μL
gDNA extract. Partial lsrDNA (1,142–1,189 base pairs) was amplified using ZX-1 (1) + 1500R (2); difficult templates were
amplified with nested PCR using ZX-1 + 1200R and 300F +
1500R. ssrDNA (1,706–1,711 base pairs) was amplified using
WormA + WormB; difficult templates were amplified with nested
PCR using Macro_18S_200F + Macro_18S_1640R. Cycling
conditions for lsrDNA were as follows: denaturation for 5 min at
95 °C followed by 40 cycles of 30 s at 95 °C, 30 s at 55 °C, 2 min at
72 °C, and 7 min extension at 72 °C. Cycling conditions for
ssrDNA were as follows: denaturation for 2 min at 94 °C followed
by 40 cycles of 30 s at 94 °C, 30 s at 54 °C, 2 min at 72 °C, and 7 min
extension at 72 °C. PCR amplicons were gel-excised using the
QIAquick Gel Extraction Kit (QIAGEN) or purified directly
using the QIAquick PCR Purification Kit (QIAGEN) following
the manufacturer’s instructions. Cycle-sequencing from both
strands was carried out on an ABI 3730 DNA Analyzer, Big Dye
version 1.1 using ABI BigDye chemistry. Contiguous sequences
were assembled and edited using Sequencher version 4.6 (GeneCodes Corp.), and sequence identity was checked using BLAST
(http://www.ncbi.nih.gov/BLAST/). New sequences have been
deposited with GenBank under accessions FJ715295–FJ715334
inclusive (Table S3).
Phylogenetic Analysis. Alignments were performed in ClustalX (3)
using default settings and were improved by eye in MacClade
(4). Regions that could not be aligned unambiguously were excluded from the analysis. The full alignments for lsrDNA and
ssrDNA gene partitions (with an indication of exclusion sets) are
available upon request. MODELTEST version 3.7maxX (5) was
used to select a model of evolution using the Akaike Information
Criterion. Phylogenetic trees were constructed using Bayesian inference (BI) with MrBayes version 3.1 (6) and using maximum
likelihood (ML) with PAUP* version 4.0b10 (7). For BI, likelihood
settings were set to number of substitution types (nst) = 6,
rates = invgamma, ngammacat = 4 [equivalent to the general
time-reversible plus proportion of invariant sites plus gammadistributed rate variation across sites (i.e., GTR+I+G) model of
nucleotide evolution]; parameters were estimated separately for
each gene. Four chains (temp = 0.2) were run for 5 × 106 generations and sampled every 103 generations; 5 × 105 generations
were discarded as burn-in. ML analyses were performed using
successive approximation: Model parameters were estimated
based on a starting tree determined by neighbor joining. A
heuristic search was performed implementing the estimated
model parameters using nearest-neighbor–interchange branch
swapping. Model parameters were estimated on the best tree,
and a heuristic search was performed using subtree-pruningregrafting branch swapping. After model parameters were estimated, heuristic searches using tree-bisection-reconnection (TBR)
branch swapping were performed until the topology remained
unchanged. In addition to posterior probability values from BI
Schärer et al. www.pnas.org/cgi/content/short/1013892108
analyses, nodal support was estimated using ML bootstrapping
(100 replicates) as implemented in GARLI version 0.942 (8)
using default settings, except setting Genthreshfortopoterm to
104 generations. Clades were considered to have high nodal
support if BI posterior probability was ≥95% and ML bootstrap
resampling was ≥70%.
Constraint Analysis. We performed a constraint analysis that tested
whether the data support the a priori hypothesis of a single origin
of the hypodermic mating syndrome. A constrained tree holding
the five taxa with this feature as monophyletic was loaded as
a backbone constraint before ML analysis under the same model
as the unconstrained tree (Fig. S2). Log likelihood scores of
constrained and unconstrained trees were used in a Shimodaira–
Hasegawa test (9), as implemented in PAUP*, with 103 RELL
bootstrap replicates.
Ancestral State Reconstruction. We performed ancestral state
reconstructions to infer the character states at the base of the
genus Macrostomum and the base of clade 2 (both nodes are well
supported in the ML and BI analyses). We used Mesquite version 2.5 (10) to estimate ancestral states of characters illustrated
in Fig. 2 and listed in Table S1, under a ML continuous-time
Markov model (Mk1) on the ML tree shown in Fig. S1. Ancestral states were reported as proportional likelihoods at each
node for both character states. Missing data resulted in some
ancestral character states being reported as equivocal (Fig. S3).
Analysis of Correlated Evolution. We used BayesDiscrete in BayesTraits (available at http://www.evolution.reading.ac.uk/BayesTraits.
html) to test for correlated evolution between pairs of discrete
binary character states (11). BayesTraits uses a reversible-jump
Markov chain Monte Carlo (RJ MCMC) approach to search
among possible models of character state evolution while sampling
from a set of trees derived from a Bayesian phylogenetic analysis,
thus taking phylogenetic uncertainty into account (11). The analysis is run twice for each pair of character states, once allowing for
dependent (or correlated) evolution (dep), and once restricting the
models to the null hypothesis of independent evolution (indep).
The rationale is that under independent evolution the transition
rate of character 1 from one state to the other should be independent of the state of character 2 (11). The statistical inference
compares the two analyses by the harmonic means (H) of the
resulting likelihoods using the test statistic 2×(logHdep − logHindep). By convention, values for this test statistic >2 are taken
as positive evidence that the dependent model is favored, and
values >5 and >10 represent strong and very strong evidence,
respectively (11).
We performed the analyses on a reduced taxon set containing
only the genus Macrostomum, the main focus of our study. Specifically, we tested if the character states for copulation behavior
(0, hypodermic; 1, reciprocal) correlate with those for sperm
bristles (0, absent; 1, present), or female antrum morphology (0,
simple; 1, thickened). (Fig. 2, Fig. S3, and Table S1 give details on
character states.) Note that the character states for sperm bristles
and stylet morphology (0, needle-like; 1, not needle-like) are fully
congruent among the available Macrostomum species, so the results we present for sperm bristles also are valid for stylet morphology. Moreover, the character states for the copulation
behavior and the sucking behavior (0, never observed; 1, present)
are nearly congruent, but the latter character has more uncertainty about its states (Table S1); here we focus only on the
1 of 14
copulation behavior. Using this method we performed analysis A
(sperm bristles vs. copulation behavior) and analysis B (female
antrum morphology vs. copulation behavior), each with a separate run for dependent and independent models.
Based on initial ML runs, we used a RJ hyperprior with a gamma
distribution (rjhp gamma 0 1 0 1) for the RJ MCMC analyses (11).
Next we optimized the rate deviation (ratedev) parameters to
achieve acceptance rates between 20–40% (11) and settled for
0.18 and 0.12, respectively, for the dependent and independent
runs of analysis A and 0.3 and 0.25, respectively, for the dependent and independent runs of analysis B. We ran the analyses
with a sample of 500 best trees taken from our Bayesian phylogenetic analysis (performed as outlined above but with the reduced taxon set) for 505 × 106 iterations with a burn-in of 5 × 106
iterations and sampling period of 103 for the independent models
and for 1,020 × 106 iterations with a burn-in of 2 × 107 iterations
and sampling period of 4 × 103 for the dependent models (to
achieve reliable convergence stability).
Notes on Species Identification, Sampling Locations, and
Taxonomic Status of the Studied Specimens
We have deposited extensive digital reference material for all
specimens that we have sequenced to construct the molecular
phylogeny on the online Macrostomorpha Taxonomy and Phylogeny database (available at http://macrostomorpha.info), an
EDIT scratchpad (12), including images, videos, and maps. Each
specimen carries a unique accession number (e.g., MTP LS 200,
short for Macrostomorpha Taxonomy and Phylogeny, Lukas
Schärer, specimen ID 200). In the following section we give detailed notes on species identification, sampling locations, and
taxonomic status of the species and specimens studied.
Dolichomacrostomum uniporum Luther 1947 was described
from Tvärminne, Finland (13). Rieger (14) and Ax (15) list the
Baltic Sea, the east and west coasts of Sweden, and the Irish Sea
as the distribution. Our specimen (MTP LS 222, not documented) was taken from a laboratory culture that we established
from specimens collected on March 13, 2007, at low tide on an
intertidal sand flat in the Königshafen, Sylt, Germany (55°02′
51.0′′N, 8°25′12.5′′E). It matches the descriptions by Luther (13,
16) and Rieger (14) in every detail studied. Because the sequenced specimen was not documented, we deposited an additional specimen (MTP LS 200) taken from the same sample
location from which we founded the laboratory culture.
Microstomum papillosum von Graff 1882 was described by
Claparède (17) as a larva of a dendrocoel flatworm from the
coast of Norway but was recognized as a Microstomum and
named by von Graff (18). Our identification is based on the
description of Faubel (19) from Sylt, Germany. Our specimen
(MTP LS 146) was collected on March 8, 2007, at low tide in the
top layer of a sandy intertidal mud flat in the Königshafen, Sylt,
Germany (55°02′23.9′′N, 8°23′53.1′′E). It matches the description of Faubel (19) in every detail studied.
Bradynectes sterreri Rieger 1971 was described with three different forms from Kristineberg (west coast of Sweden), Beaufort,
NC (east coast of the United States), and Robin Hood’s Bay
(east coast of England), respectively (20). In addition, Faubel
(21) and Martens and Schockaert (22) published additional
forms from Sylt, Germany, and the Eastern Scheldt, The Netherlands, respectively, which Faubel and Warwick (23) later referred to as “Bradynectes syltensis” and “Bradynectes scheldtensis,”
respectively. However, these species were never formally named.
Finally, Faubel and Warwick (23) named a species, Bradynectes
scilliensis Faubel and Warwick 2005, from the Scilly Isles, England. For use as an outgroup species, the exact species identity of
our specimen is not critical. Our specimen (MTP LS 180) was
collected on a sandy beach in front of the old Litoralstation, List,
Sylt, Germany (55°00′55.5′′N, 8°26′18.0′′E), about 15 cm deep in
the sediment.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
Gen. nov. 1, sp. nov. 1 (Macrostomidae) has been collected
repeatedly by our group from a single location in Lignano, Italy
(45°41′28.5′′N, 13°07′54.0′′E). The location is on the shore of
the Laguna di Marano below dense vegetation and consists of
relatively clean sand with some humus content This genus
probably belongs to a diffuse group of Macrostomidae that lack
a sclerotized stylet, although currently it is unclear if these taxa
form a monophyletic clade (24). These taxa might include Myozona Marcus 1949, Siccomacrostomum Schmidt and SopottEhlers 1976, Dunwichia Faubel, Bloome and Cannon 1994,
Psammomacrostomum Ax 1966, and Antromacrostomum Faubel
1974. Our species is clearly distinct from Myozona by the absence
of a muscular gizzard in the gut, from Siccomacrostomum by the
absence of a common genital opening, from Dunwichia by the
presence of paired testes and ovaries, from Psammomacrostomum
by the presence of a vagina and female antrum, and from Antromacrostomum by the absence of an armed pharynx and the
presence of a paired ovary. However, the copulatory organ in our
species is similar to that of Psammomacrostomum equicaudatum,
and the close proximity of the male and female genital openings is
similar to Antromacrostomum armatum. Thus, these three genera
may be closely related. Our specimen (MTP LS 309) was collected at low tide from the typical location on July 22, 2007. From
two additional specimens (MTP LS 55 and MTP LS 59), collected
from the same location on April 9, 2006, we obtained partial
sequences of 18S, which were identical to that of the main specimen. We plan to name this genus in honor of the late Reinhard
M. Rieger, and a detailed taxonomic description will be presented
elsewhere.
Macrostomum sp. nov. 1 has been collected repeatedly by our
group from a single location in Lignano, Italy (45°41′28.7′′N, 13°
07′54.3′′E). The sample location is among coarse algae-covered
gravel, which lies on a strongly anoxic base of finer sediment. The
species belongs to a group of Macrostomum species that are not
easy to distinguish based on morphology alone, and therefore we
cannot exclude the possibility that it corresponds to a previously
described species. However, we can state clearly that it differs from
the other species with a similar morphology that we have collected
in Europe. It differs from Macrostomum pusillum Ax 1951 by the
absence of long sensory cilia and droplets in the stylet, from
Macrostomum hystricinum marinum Rieger 1977 by the absence of
a separated tail plate, and from Macrostomum hystrix Ørsted 1843
sensu Luther 1905 (see below) by the absence of large testes. One
characteristic of this Macrostomum species is that it can swim very
fast through open water. Our specimen (MTP LS 302) was collected at low tide from the typical location on July 16, 2007.
Macrostomum hystricinum marinum Rieger 1977 was described from the west coast of the United States and the Mediterranean from sheltered beaches and shallow subtidal fine sand
flats with salinity above 25‰ (25). It belongs to a group of
Macrostomum species that are not easy to distinguish based on
morphology alone. Our specimen (MTP LS 278) was collected
on July 16, 2007, at low tide on an intertidal sand flat near
Grado, Italy (45°42′51.7′′N, 13°23′06.0′′E), where this species
was collected previously together with R. M. Rieger. The published 18S sequence of Macrostomum hystricinum (GenBank
AF051329 from ref. 26) stemmed from a laboratory culture of
Macrostomum hystricinum marinum from a population collected
by R. M. Rieger on the west coast of the United States. That
sequence, however, is somewhat distinct from that of our Mediterranean form.
Macrostomum pusillum Ax 1951 was described from fine sands
in the intertidal zone of the North Sea coast of Germany (27). Ax
and Armonies (28) list the distribution as North Sea, Baltic Sea,
Atlantic Coast of Norway, Mediterranean, Black Sea, southeast Canada, and Alaska. Although it belongs to a group of
Macrostomum species that are not easy to distinguish based on
morphology alone, the identity of Macrostomum pusillum is
2 of 14
thought to be clear because of its long sensory cilia and droplets
in the stylet. Our specimens were collected from two localities.
One specimen (MTP LS 112, not documented) was taken from
a laboratory culture that we are maintaining from specimens
collected on April 8, 2006, at low tide on an intertidal sand flat in
Lignano, Italy (around 45°41′30′′N, 13°07′52′′E). From an additional specimen (MTP LS 53) taken from the same sample
location from which we founded the laboratory culture, we obtained a partial sequence of 18S, which was identical to that of
the main specimen. Another specimen (MTP LS 132) was collected on March 7, 2007, at low tide on an intertidal sand flat
near Rantum, Sylt, Germany (54°50′53.8′′N, 8°17′54.4′′E). Because the stylet of this sequenced specimen was not documented
in much detail, we deposited an additional specimen (MTP LS
136) collected in the same sample. The specimens from Lignano
and Sylt clearly are genetically distinct but currently cannot be
distinguished based on their morphology. Because the type
specimen of this species is from the North Sea, the Mediterranean form probably should be renamed.
Macrostomum balticum Luther 1947 was described from Tvärminne, Finland (13) based on material from Tor Karling. Luther
(16) lists the Baltic Sea, the west coast of Sweden, and Sylt,
Germany, as the distribution. Our specimen (MTP LS 144) was
collected on March 7, 2007, at low tide on an intertidal sand flat
near Rantum, Sylt, Germany (54°50′54.1′′N, 8°17′55.0′′E). It
matches the descriptions of Luther (13, 16) in every detail studied.
Macrostomum spirale Ax 1956 was discovered by Schulz (29)
from a sandy mudflat in Amrum, Germany. It was supposed to
be described by Meixner, but his original account was never
published because of the Second World War. The species later
was described formally by Ax (30) from the Etang de Canet, near
Perpignan, France. Ax (15) lists the distribution as North Sea,
Baltic Sea, Channel Coast of England, Mediterranean, Black
Sea, and Alaska. Our specimen (MTP LS 227, not documented)
was taken from a laboratory culture that we established from
specimens collected on March 7, 2007, from a water-covered salt
marsh near Rantum, Sylt, Germany (54°50′50′′N, 8°17′53′′E).
Because MTP LS 227 was not documented, we deposited an
additional specimen (MTP LS 138) taken from the same sample
location from which we founded the laboratory culture. We also
obtained a partial 18S sequence from one additional specimen
(MTP LS 1B) collected in Bibione, Italy (45°38′02′′N, 13°04′32′′
E), which was identical to that of the main specimen.
Macrostomum longituba Papi 1953 was described from a small
ditch near the sea in the San Rossore Park near Pisa, Italy (31).
Our specimen (MTP LS 274) was collected on July 15, 2007,
from a small drainage ditch in an agricultural area near Bibione,
Italy (45°38′50.1′′N, 13°01′10.7′′E). These ditches are close to
the mouth of the Tagliamento River and thus are quite variable
in salinity. Our specimen matches the original description in
every detail studied, except in the exact position of the opening
in the tip of the stylet, which was drawn as a lateral hole, whereas
our specimen suggests a sharp turn at the end of the stylet tip.
Macrostomum clavituba Ax 2008 was described from the
brackish Etang de Salses, north of Perpignan, France (15). Our
specimen (MTP LS 301) was collected on July 15, 2007, from the
surface layer of relatively coarse sand at the high-tide level of a
beach in the Laguna di Marano, Marano, Italy (45°45′23.0′′N,
13°09′53.4′′E). The sample location is unusual in that it consists
of relatively clean sand in a highly protected area where wave
action stems primarily from passing boats and fishing vessels.
Because the stylet of this specimen was not documented in much
detail, we deposited an additional specimen (MTP LS 514) collected from the same sample location on May 3, 2004. Moreover,
from an additional specimen (MTP LS 1A, not documented),
which also was collected from that sample, we obtained a partial
sequence of 18S, which was identical to that of the main speciSchärer et al. www.pnas.org/cgi/content/short/1013892108
men. Our specimens match the original description in every
detail studied.
Macrostomum gieysztori Ferguson 1939 was described originally by Ferguson (32) based solely on a drawing of the tip of
a stylet of a freshwater species collected in rice fields in the La
Albufera wetlands south of Valencia, Spain, by Gieysztor (33).
This drawing matches the drawing of Ferguson (32) and our
specimens very well. Gieysztor, without any justification, considered this species to correspond to Macrostomum gracile
Pereyaslawzewa 1982, which is a marine species from the Black
Sea and whose stylet bears no resemblance to the one depicted
by Gieysztor. However, von Graff (34) describes a species from
the same area that he calls “Macrostomum gracile von Graff 1905”
which has a stylet somewhat more similar to that of Gieysztor’s
specimen but which does not match Pereyaslawzewa’s specimen
well. We therefore agree with Ferguson (21) that Macrostomum
gieysztori is a separate species. Papi (35), based on a detailed
study of the female antrum, moved Macrostomum gieysztori to
the genus Promacrostomum, which is characterized by two female genital openings (36). Finally, Ferguson (37) moved the
species to the new genus, Axia, to distinguish it from Promacrostomum paradoxum An-der-Lan 1939, which has a connection
between the female antrum and the gut, a feature that is absent
in this species. Given that our specimen clusters well within the
genus Macrostomum, we suggest that the old name Macrostomum gieysztori be reinstated. Moreover, we note that the genus name Axia has been occupied by a genus of Lepidoptera
since 1821 (38). Our specimen (MTP LS 264) was collected on
July 1, 2007, from a captured source of the Rio Genal in Juzcar,
Andalusia, Spain (36°37′37′′N, 5°10′27′′W). Because the female
antrum of the genotyped specimen was not documented well and
probably was in formation, we deposited an additional specimen
(MTP LS 344) collected from the same site on March 30, 2008.
Macrostomum quiritium Kolasa 1973 originally was described
from a basin in the Poznan palm house, in Poznan, Poland (39).
In that paper Kolasa attributes the name Macrostomum quiritium
to Beklemischev (40), who, however, never named such a species.
Instead Beklemischev (40) described a variety of Macrostomum
japonicum Okugawa 1930 from an aquarium of a Russian malaria
research facility, which he called “Macrostomum japonicum var.
quiritium Beklemischev 1951.” However, neither Macrostomum
japonicum (by the shape of the stylet) nor Macrostomum japonicum var. quiritium (by the arrangement of the seminal vesicles and
the vesicula granulorum with respect to the stylet) matches the
species described by Kolasa. Macrostomum quiritium has been
collected repeatedly by our group from a small pond in the Tropenhaus of the Botanical Garden of the University of Basel,
Switzerland (47°33′31.0′′N, 7°34′54.5′′E). This pond contains a
great diversity of aquatic plants of worldwide tropical origin. It
appears likely that this species was introduced with the plants. Our
specimen (MTP LS 102) was collected from this pond on
November 6, 2006. Our specimens match Macrostomum quiritium in many aspects studied, including the type of the collection
site, but because of the lack of collections in the natural habitat
and the resulting wide range of possible origins, our species
identification should be regarded with caution.
Macrostomum tuba von Graff 1882 was described from a pond
in the Botanical Garden of Munich, Germany (18). Moreover,
there are worldwide reports of this or similar species, mostly
from artificial ponds or aquaria. The different published 18S sequences of Macrostomum tuba (GenBank U70080 from ref. 41,
called “U70081” in their paper, and D85091 from ref. 42) and
Macrostomum sp. (GenBank L41127 from ref. 43) are all somewhat distinct from that of our specimen. No reference material for
these specimens is available, and in some cases it is not clear
where they were collected. The taxon Macrostomum tuba therefore is best regarded currently as an assemblage of dorsoventrally
flattened fresh-water Macrostomum species with very long and
3 of 14
slender stylets about 200–300 μm in length and a worldwide
distribution, and it probably also includes the species described
as Macrostomum tuba gigas Okugawa 1930, Macrostomum gigas
Okugawa 1930, and Macrostomum bulbostylum Ferguson 1939.
Macrostomum tuba has been collected repeatedly by our group
from small ponds in the Victoriahaus of the Botanical Garden of
the University of Basel, Switzerland (47°33′32.7′′N, 7°34′54.1′′
E). Our specimen (MTP LS 261) was collected at this locality on
June 26, 2007. Our specimen matches Macrostomum tuba in
many aspects studied, including the type of the collection site.
However, because of the lack of collections in the natural habitat, and because these ponds contain a great diversity of aquatic
plants of worldwide origin, it is difficult to judge if the collected
specimens match the type species.
Macrostomum finlandense (Ferguson 1940) was described
originally as “Macrostomum viride Luther 1905” from freshwater
in Lohja (Lojo), Southern Finland (44). It later was transferred
to Macrostomum ruebushi finlandensis by Ferguson (45), then to
Macrostomum appendiculatum finlandensis by Luther (pp. 11–14
in ref. 13), and finally to its current designation by Luther (pp.
72–73 in ref. 15). Moreover, the (sub)species name has been
referred to variably as “finlandense,” “finnlandense,” or “finlandensis.” Luther (16) lists Finland and Italy as the distribution, but
other authors have reported it from Holland and Germany (46–48)
and from Romania (49). Our specimen (MTP LS 91) was collected by Peter Ladurner from the Schwarzsee near Kitzbühel,
Austria (47°27′22.9′′N, 12°21′58.7′′), on July 4, 2006. Because
this specimen was not documented in much detail, we deposited
an additional specimen (MTP LS 515) collected in the same
sample. The specimens match the description by Luther (13, 16)
in every detail studied.
Macrostomum kepneri (Ferguson and Jones 1940) was described originally by Ferguson and Jones (50) as “Macrostomum
ruebushi var. kepneri” from brackish water in Norfolk, VA, and
later was transferred to its current designation by Ferguson (37).
Our specimen (MTP LS 285) was collected on July 15, 2007,
from a small drainage ditch in an agricultural area near Bibione,
Italy (45°38′34.5′′N, 12°58′52.5′′E), which is close to the Adriatic
Sea and thus is quite variable in salinity. The specimen matches
the original description in every detail studied. However, given
the large distance between the type locality and our collection
site, the species identity needs to be regarded with some caution.
Macrostomum lignano Ladurner, Schärer, Salvenmoser and
Rieger 2005 was described from clean intertidal sand of the
northern Adriatic Sea around Lignano, Italy (51). Our specimen
(MTP LS 244, not documented) was taken from a laboratory
culture from specimens collected on May 3, 2003, from the PS
(45°42′14.2′′N, 13°09′28.7′′E) and on May 5, 2003, from the
UV (45°38′2.6′′N, 13°04′34.0′′E) type localities respectively (see
ref. 51 for a description of the PS and UV sample locations).
Because the sequenced specimen was not documented, we deposited an additional specimen (MTP LS 517) taken from the
PS location.
Macrostomum hystrix Ørsted 1843 sensu Luther 1905 was described by Ørsted (52) from the Baltic Sea and studied in detail by
Luther (44) from samples collected in Tvärminne, Finland. It
belongs to a group of Macrostomum species that are not easy to
distinguish based on morphology alone, and as a result the species
boundaries within this group often are unclear. Our molecular
phylogeny, however, clearly reveals that M. hystrix is not closely
related to the other species in clade 1 (e.g., M. pusillum and
M. hystricinum marinum), despite its striking similarity in both male
and female traits, which has caused even an expert like Luther to
synonymize this species variably with Macrostomum appendiculatum (13) and Macrostomum hystricinum (16). However, Luther (44)
gives an exquisite drawing of the stylet of his specimen (ref. 33,
plate 4, fig. 1) that matches ours in every detail, and both the above
names are taxonomically problematic. We therefore prefer to refer
to our specimens as Macrostomum hystrix Ørsted 1843 sensu Luther
1905. Convergent evolution evidently can lead to very similar
outcomes and trait simplifications, and we thus argue strongly
against the future use of the genera Inframacrostomum and Archimacrostomum, as has been stressed repeatedly (53, 54), or the
unwarranted erection of new genera based on minor morphological differences (see also Macrostomum gieysztori). Our specimen
(MTP LS 68) was collected on April 10, 2006, from a drainage canal
in an agricultural area near Bibione, Italy (45°39′16.2′′N, 13°04′
10.2′′E). This canal is close to the mouth of the Tagliamento River
and therefore is highly variable in salinity. From an additional
specimen (MTP LS 1G, not documented), collected on April 1,
2005, from a nearby sample location (45°38′33.5′′N, 12°58′52′′E),
we obtained a partial sequence of 18S, which was identical to that of
the main specimen. Because the main specimen was not documented in much detail, we deposited an additional specimen (MTP
LS 292), collected from the second site on July 15, 2007.
Macrostomum mystrophorum Meixner 1926 was described
briefly by Meixner (55) from moss in a fresh-water spring in the
Steiermark, Austria, based primarily on the morphology of the
stylet. A more detailed description was given by Papi (31) from
a flooded zone near the sea in the San Rossore park near Pisa,
Italy (variable salinity, ∼5‰). Our specimen (MTP LS 64) was
collected on April 10, 2006, from a small drainage ditch in an
agricultural area near Bibione, Italy (45°39′16.5′′N, 13°04′11.9′′
E). This ditch is close to the mouth of the Tagliamento River and
therefore is highly variable in salinity. At the time of collection
the salinity was about 12‰. Because the main specimen was not
documented in much detail, we deposited an additional specimen (MTP LS 516) collected in the same sample. Our specimens
match the description by Papi (31) in every detail studied.
1. Van der Auwera G, Chapelle S, De Wachter R (1994) Structure of the large ribosomal
subunit RNA of Phytophthora megasperma, and phylogeny of the oomycetes. FEBS
Lett 338:133–136.
2. Tkach VV, Littlewood DTJ, Olson PD, Kinsella JM, Swiderski Z (2003) Molecular
phylogenetic analysis of the Microphalloidea Ward, 1901 (Trematoda: Digenea). Syst
Parasitol 56:1–15.
3. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The
CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res 25:4876–4882.
4. Maddison WP, Maddison DR (2005) MacClade. Version 4.07 (Sinauer Associates,
Sunderland, Massachusetts).
5. Posada D, Crandall KA (1998) MODELTEST: testing the model of DNA substitution.
Bioinformatics 14:817–818.
6. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic
trees. Bioinformatics 17:754–755.
7. Swofford DL (2003) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other
Methods).Version 4. (Sinauer Associates, Sunderland, MA).
8. Zwickl DJ (2006) Genetic algorithm approaches for the phylogenetic analysis of large
biological sequence datasets under the maximum likelihood criterion. PhD thesis.
(Univ of Texas, Austin, TX).
9. Shimodaira H, Hasegawa M (1999) Multiple comparisons of log-likelihoods with
applications to phylogenetic inference. Mol Biol Evol 16:1114–1116.
10. Maddison WP, Maddison DR (2008) Mesquite: A modular system for evolutionary
analysis. Version 2.5. http://mesquiteproject.org. Accessed August 15, 2010.
11. Pagel M, Meade A (2006) Bayesian analysis of correlated evolution of discrete
characters by reversible-jump Markov Chain Monte Carlo. Am Nat 167:808–825.
12. Smith VS, Rycroft SD, Harman KT, Scott B, Roberts D (2009) Scratchpads: a datapublishing framework to build, share and manage information on the diversity of
life. BMC Bioinformatics 10(Suppl 14):S6.
13. Luther A (1947) Untersuchungen an rhabdocoelen Turbellarien VI. Macrostomiden
aus Finnland. Acta Zool Fenn 49:1–38.
14. Rieger RM (1971) Die Turbellarienfamilie Dolichomacrostomidae Rieger: II. Teil.
Dolichomacrostominae 1. Zool Jb Sys. 98:598–703.
15. Ax P (2008) Plathelminthes aus Brackgewässern der Nordhalbkugel (Franz Steiner,
Stuttgart, Germany).
16. Luther A (1960) Die Turbellarien Ostfennoskandiens I. Acoela, Catenulida, Macrostomida,
Lecithoepitheliata, Prolecithophora, und Proseriata. Fauna Fennica 7:1–155.
17. Claparède R-É (1861) Recherches anatomiques sur les Annélides, Turbellariés,
Opalines et Gregarines observés dans les Hébrides. Mémoires de la Societé de
Physique et d’Histoire Naturelle de Genéve 16:56–55–8057.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
4 of 14
18. von Graff L (1882) Monographie der Turbellarien. I. Rhabdocoelida (Willhelm
Engelmann, Leipzig, Germany) 420 plates.
19. Faubel A (1974) Macrostomida (Turbellaria) von einem Sandstrand der Nordseeinsel
Sylt. Mikrofauna Meeresboden 45:1–32.
20. Rieger RM (1971) Bradynectes sterreri gen nov., spec. nov., eine psammobionte
Macrostomide (Turbellaria). Zool Jb Syst 98:205–235.
21. Faubel A, Blome D, Cannon LRG (1994) Sandy beach meiofauna of eastern Australia
(Southern Queensland and New South Wales). I. Introduction and Macrostomida
(Platyhelminthes). Invertebr Taxon 8:989–1007.
22. Martens P, Schockaert E (1981) Sand dwelling Turbellaria from the Netherlands Delta
area. Hydrobiologia 84:113–127.
23. Faubel A, Warwick RM (2005) The marine flora and fauna of the Isles of Scilly: Freeliving Plathelminthes (‘Turbellaria’). J Nat Hist 39:1–45.
24. Rieger RM (2001) Phylogenetic systematics of the Macrostomorpha. Interrelationships of the Platyhelminthes, eds Littlewood DTJ, Bray RA (Taylor & Francis,
New York), pp 28–38.
25. Rieger RM (1977) The relationship of character variability and morphological
complexity in copulatory structures of Turbellaria-Macrostomida and -Haplopharyngida.
Mikrofauna Meeresboden 61:197–216.
26. Baguña J, Carranza S, Paps J, Ruiz-Trillo I, Riutort M (2001) Molecular taxonomy and
phylogeny of the Tricladida. Interrelationships of the Platyhelminthes, eds Littlewood DTJ,
Bray RA (Taylor & Francis, New York), pp 49–56.
27. Ax P (1951) Die Turbellarien des Eulitorals der Kieler Bucht. Zool Jb Syst. 80:277–378.
28. Ax P, Armonies W (1990) Brackish water Platyhelminthes from Alaska as evidence for
the existence of a boreal brackish water community with circumpolar distribution.
Microfauna Marina 6:7–109.
29. Schulz E (1937) Das Farbstreifen-Sandwatt und seine Fauna, eine ökologischebiozönotische Untersuchung an der Nordsee. Kieler Meeresforschungen 1:359–378.
30. Ax P (1956) Les turbellariés des étangs côtiers du littoral méditerranéen de la France
méridionale. Vie Milieu Suppl. 5):1–215.
31. Papi F (1953) Beiträge zur Kenntnis der Macrostomiden (Turbellarien). Acta Zool Fenn
78:1–32.
32. Ferguson FF (1939) A monograph of the genus Macrostomum O. Schmidt 1848. Part
IV. Zool Anz 128:188–205.
33. Gieysztor M (1931) Contribution à la connaissance des Turbellariés Rhabdocoèles
(Turbellaria Rhabdocoela) d’Espagne. Bulletin International de l’Academie Polonaise
des Sciences et des Lettres, Classe des Sciences Mathematiques et Naturelles B 2:
125–113–153114.
34. von Graff L (1905) Marine Turbellarien Orotavas und der Küsten Europas. Z Wiss Zool
83:97–179.
35. Papi F (1951) Richerche sui Turbellari Macrostomidae. Archivo Zoologico Italiano 36:
289–341.
36. An-der-Lan H (1939) Zur rhabdocoelen Turbellarienfauna des Ochridasees (Balkan)
[On the rhabdocoel turbellarian fauna of Lake Ohrid]. Aus den Sitzungsberichten der
Akademie der Wissenschaften in Wien: Mathematisch Naturwissenschaftliche Klasse.
Abteilung I 148:195–254.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
37. Ferguson FF (1954) Monograph of the macrostomine worms of Turbellaria. Trans Am
Microsc Soc 73:137–164.
38. Yen S-H, Minet J (2007) Cimelioidea: a new superfamily name for the gold moths
(Lepidoptera: Glossata). Zoological Studies 46:262–271.
39. Kolasa J (1973) Two new species of Macrostomum (Turbellaria), a redescription of an
established species, and new records from Poland. Boll Zool 40:181–200.
40. Beklemischev VN (1951) O vidach roda Macrostomum (Turbellaria, Rhabdocoela)
SSSR. Zeitschrift der Moskauer Naturwissenschaftlichen Gesellschaft 56:31–40.
41. Carranza S, Baguñà J, Riutort M (1997) Are the Platyhelminthes a monophyletic
primitive group? An assessment using 18S rDNA sequences. Mol Biol Evol 14:
485–497.
42. Katayama T, Nishioka M, Yamamoto M (1996) Phylogenetic relationships among
turbellarian orders inferred from 18S rDNA sequences. Zoolog Sci 13:747–756.
43. Rohde K, Luton K, Baverstock PR, Johnson AM (1994) The phylogenetic relationships
of Kronborgia (Platyhelminthes, Fecampiida) based on comparison of 18S ribosomal
DNA sequences. Int J Parasitol 24:657–669.
44. Luther A (1905) Zur Kenntnis der Gattung Macrostoma. Festschrift für Palmén,
Helsingfors, 5:1–61 (64 plates).
45. Ferguson FF (1940) A monograph of the genus Macrostomum O. Schmidt 1848. Part
VI. Zool Anz 129:21–48.
46. Rixen J-U (1961) Kleinturbellarien aus dem Litoral der Binnengewässer SchleswigHolsteins. Arch Hydrobiol 57:464–538.
47. Bauchhenss J (1971) Die Kleinturbellarien Frankens. Ein Beitrag zur Systematik und
Ökologie der Turbellaria excl. Tricladida in Süddeutschland. Int Rev Gesamten
Hydrobiol 56:609–666.
48. den Hartog C (1977) Turbellaria from intertidal flats and salt-marshes in estuaries of
the south-western part of the Netherlands. Hydrobiologia 52:29–32.
49. Mack-Fira V (1968) Macrostomide (Turbellaria Macrostomida) din apele interioare ale
Romaniei. Stud. Cercet. Biol. Ser. Zool. 20:131–136.
50. Ferguson FF, Jones ER (1940) Studies on the Turbellarian fauna of the Norfolk Area, I.
Am Midl Nat 24:184–189.
51. Ladurner P, Schärer L, Salvenmoser W, Rieger RM (2005) A new model organism
among the lower Bilateria and the use of digital microscopy in taxonomy of
meiobenthic Platyhelminthes: Macrostomum lignano, n. sp. (Rhabditophora,
Macrostomorpha). J Zoolog Syst Evol Res 43:114–126.
52. Ørsted AS (1843) Forsøg til en ny Classification of Planarierne (Planariea Dugés) grundet
paa mikroskopish-anatomiske Undersøgelser. Kroyer’s Naturhistorisk Tidsskrift (I) 4:
519–581.
53. Papi F (1959) Specie nuove o poco note del gen. Macrostomum (Turbellaria:
Macrostomida) rinvenute in Italia. Monit. Zool. Ital. 66:1–19.
54. Ax P (1959) Zur Systematik, Ökologie und Tiergeographie der Turbellarienfauna in
den ponto-kaspischen Brackwassermeeren. Zool Jb Syst 87:43–187.
55. Meixner J (1926) Beitrag zur Morphologie und zum System der TurbellariaRhabdocoela: II. Über Typhlorhynchus nanus Laidlaw und die parasitischen
Rhabdocoelen nebst Nachträgen zu den Calyptorhynchia. Z Morphol Oekol Tiere 5:
577–624.
5 of 14
Fig. S1. Molecular phylogeny of 16 Macrostomum and four outgroup species. ML tree based on combined partial lsrDNA and complete ssrDNA sequences (for
a total of ∼2,850 base pairs) from 16 Macrostomum and four outgroup species, covering members of all three families in the order Macrostomida (Platyhelminthes: Macrostomorpha). Values above branches are Bayesian posterior probabilities, and values below branches are ML bootstrap values. The topologies
of trees derived from Bayesian and ML analyses are in broad agreement. Final ML model settings were as follows: nucleotide frequencies [π (A) = 0.2334; π (C) =
0.2233; π (G) = 0.2894; π (T) = 0.2538]; rate matrix [(A,C) = 0.6007; (A,G) = 3.6492; (A,T) = 2.1686; (C,G) = 0.4266; (C,T) = 7.9278; (G,T) = 1.0000]; invariable sites =
0.5247; γ shape parameter = 0.4968; log likelihood = −11679.817. The accession code identifies the morphological documentation of each sequenced specimen,
which we have deposited as digital reference material at http://macrostomorpha.info (GenBank accession numbers are given in Table S3). Details on phylogenetic reconstruction are given in SI Materials and Methods.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
6 of 14
Fig. S2. Unconstrained and constrained tree used for the Shimodaira–Hasegawa test. The test shows that the unconstrained tree (A) fits the data significantly
better (Δ −ln likelihood = 66.0; P < 0.001) than the constrained tree (B). Details of analysis are given in SI Materials and Methods.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
7 of 14
Fig. S3. ML ancestral state reconstruction of character states. The small pie charts indicate the likelihoods of the black vs. white character states at each node,
and gray nodes indicate equivocal character states. (A) Sperm bristles. (B) Stylet morphology. (C) Copulation behavior. (D) Sucking behavior. (E) Female antrum
morphology. (F) Phylogeny with ancestral nodes numbered. (G) Probabilities (P values) for the black character state at each node. Details on analysis are
provided in SI Materials and Methods.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
8 of 14
Fig. S4. Posterior distributions of the rate parameters of the models of character state evolution. Graphs are based on 2.5 × 105 observations drawn from 109
iterations of the Markov chain. (A) Correlated evolution between the sperm/stylet morphology and the copulation behavior. (B) Correlated evolution between
the female antrum morphology and the copulation behavior. The percentages indicate the proportion of the rate parameter estimates that are zero, with
higher values indicating less likely transitions. The panels are arranged so that vertical pairs correspond to rates that would be expected to be the same if the
independent model of character evolution were true, which is never the case in our data. For example, in the first pair of analysis A, the transition from
hypodermic to reciprocal mating is more likely when bristles are present than when they are not (i.e., the rate parameter estimate is zero in 14% and 59.9% of
the iterations, respectively). Details on analysis are provided in SI Materials and Methods.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
9 of 14
Table S1. Character states of all species studied
Species
Bristles
Stylet
Copulation
Sucking
Antrum
Dolichomacrostomum uniporum
Microstomum papillosum
Bradynectes sterreri
Gen. nov. 1, sp. nov. 1
Macrostomum sp. nov. 1
Macrostomum hystricinum marinum
Macrostomum pusillum (Lignano)
Macrostomum pusillum (Sylt)
Macrostomum balticum
Macrostomum spirale
Macrostomum longituba
Macrostomum clavituba
Macrostomum gieysztori
Macrostomum quiritium
Macrostomum tuba
Macrostomum finlandense
Macrostomum kepneri
Macrostomum lignano
Macrostomum hystrix
Macrostomum mystrophorum
0a
0b
0c
0
0
0
0
0d
1
1
1
1
1
1
1
1e
1
1
0
1
NDf
NDg
1h
1i
0
0
0
0
1
1
1
1
1
1
1
1j
1k
1
0
1
NDl
NDm
NDn
1
ND
0o
0
ND
1
1
1
1
1
ND
1
ND
ND
1
0
ND
NDl
NDm
NDn
0
ND
0
0
ND
1
1
1
1
0p
ND
1q
ND
1
1
0
ND
NDr
NDs
NDt
NDu
0
0
0
0
1
1
1
1
1
1
1
0
1
1
0
1
Sperm bristles (0, absent; 1, present), stylet morphology (0, needle-like; 1, not needle-like), copulation behavior (0, hypodermic; 1, reciprocal), sucking behavior (0, never observed; 1, present); female antrum morphology (0, simple; 1, thickened); ND, no data.
a
ND for D. uniporum; character state based on data for other Dolichomacrostomidae, namely Paromalostomum
fusculum (1, 2) and P. atratum (3).
b
ND for M. papillosum; character state based on data for other Microstomidae, namely M. spiculifer (4) and
Microstomidae (5).
c
Sopott-Ehlers and Ehlers (2) state, “[T]he two lateral ledges found in spermatozoa of B. sterreri are discussed to
correspond to the pair of ‘lateral bristles’ known from Macrostomum species,” but even if they were homologous, these structures do not protrude outside of the sperm and thus cannot have a sperm anchoring function.
d
Sperm ultrastructure suggests putative rudimentary bristles (6).
e
Bristles are small but clearly visible.
f
Homology is unclear; many Dolichomacrostomidae have two stylets, a penis stylet and a gland stylet, the latter
of which can be needle-like.
g
Stylet shape very variable within the Microstomidae.
h
Stylet tip opening is oblique, not needle-like.
i
Has no stylet but has a fleshy cirrus, which is representative of a number of presumably related genera (SI Text).
j
Stylet tip opening is oblique, not subterminal; lacks distal thickening.
k
stylet tip has a tapering, flexible flap.
l
No data on mating behavior exist for any Dolichomacrostomidae.
m
No data on mating behavior exist for any Microstomidae.
n
No data on mating behavior exist for any Bradynectes species.
o
Not observed directly but inferred from the presence of sperm in the parenchyma.
p
M. gieysztori has two female genital openings, perhaps explaining the absence of the postcopulatory sucking
behavior.
q
M. tuba is the largest Macrostomum species in our dataset and shows a behavior that may correspond to the
sucking behavior but which looks somewhat different because of the large size of the worms.
r
Homology is unclear; the Dolichomacrostomidae have a common (male and female) genital opening and
atrium genitale (7).
s
Homology is somewhat unclear (8).
t
Lacks a vagina and female antrum (8, 9); mechanism of sperm transfer is unclear.
u
Structure of female antrum is unclear.
1.
2.
3.
4.
5.
6.
7.
8.
Rohde K, Faubel A (1997) Spermatogenesis in Macrostomum pusillum (Platyhelminthes, Macrostomida). Invertebr Reprod Dev 32:209–215.
Rieger RM (1971) Die Turbellarienfamilie Dolichomacrostomidae Rieger: II. Teil. Dolichomacrostominae 1. Zool Jb Syst 98:598–703.
Faubel A (1974) Macrostomida (Turbellaria) von einem Sandstrand der Nordseeinsel Sylt. Mikrofauna Meeresboden 45:1–32.
von Graff L (1882) Monographie der Turbellarien. I. Rhabdocoelida (Willhelm Engelmann, Leipzig, Germany). 420 plates.
Rohde K, Faubel A (1997) Spermatogenesis in Macrostomum pusillum (Platyhelminthes, Macrostomida). Inv Rep Dev 32:209–215.
Rieger RM (1971) Die Turbellarienfamilie Dolichomacrostomidae nov. fam. (Macrostomida): I. Teil, Vorbemerkungen und Karlingiinae nov. subfam. 1. Zool Jb Syst 98:236–314.
Rieger RM (2001) Phylogenetic systematics of the Macrostomorpha. Interrelationships of the Platyhelminthes, eds Littlewood DTJ, Bray RA (Taylor & Francis, New York), pp 28–38.
Rieger RM (1971) Bradynectes sterreri gen nov., spec. nov., eine psammobionte Macrostomide (Turbellaria). Zool Jb Syst 98:205–235.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
10 of 14
Table S2. Primers used for amplification and sequencing
lsrDNA primers
PCR and sequencing primers
ZX-1a
1200R
1500R
Additional sequencing primers
300F
ECD2
1090F
ssrDNA primers
PCR and sequencing primers
WormA
WormB
Macro_18S_200F
Macro_18S_1640R
Additional sequencing primers
300F
600R
1270F
1270R
1200F
F
R
R
ACCCGCTGAATTTAAGCATAT
GCATAGTTCACCATCTTTCGG
GCTATCCTGAGGGAAACTTCG
F
R
F
CAAGTACCGTGAGGGAAAGTTG
CTTGGTCCGTGTTTCAAGACGGG
TGAAACACGGACCAAGG
F
R
F
R
GCGAATGGCTCATTAAATCAG
CTTGTTACGACTTTTACTTCC
GGCGCATTTATTAGATCAAAACCA
GCAAGCCCCGATCCCTGTC
F
R
F
R
F
AGGGTTCGATTCCGGAG
ACCGCGGCKGCTGGCACC
ACTTAAAGGAATTGACGG
CCGTCAATTCCTTTAAGT
CAGGTCTGTGATGCCC
All primers are 5′–3′. F, forward; R, reverse.
Modified from the original ZX-1 (1): ACCCGCTGAAYTTAAGCATAT; Y replaced with T.
a
1. Van der Auwera G, Chapelle S, De Wachter R (1994) Structure of the large ribosomal subunit RNA of Phytophthora megasperma, and phylogeny of the oomycetes. FEBS Lett 338:
133–136.
Table S3. GenBank accession numbers for each taxon and gene
GenBank accession
Taxon
Dolichomacrostomum uniporum (MTP LS 222)
Microstomum papillosum (MTP LS 146)
Bradynectes sterreri (MTP LS 180)
Gen. nov. 1, sp. nov. 1 (MTP LS 309)
Macrostomum sp. nov. 1 (MTP LS 302)
Macrostomum hystricinum marinum (MTP LS 278)
Macrostomum pusillum (Lignano) (MTP LS 112)
Macrostomum pusillum (Sylt) (MTP LS 132)
Macrostomum balticum (MTP LS 144)
Macrostomum spirale (MTP LS 227)
Macrostomum longituba (MTP LS 274)
Macrostomum clavituba (MTP LS 301)
Macrostomum gieysztori (MTP LS 264)
Macrostomum quiritium (MTP LS 102)
Macrostomum tuba (MTP LS 261)
Macrostomum finlandense (MTP LS 91)
Macrostomum kepneri (MTP LS 285)
Macrostomum lignano (MTP LS 244)
Macrostomum hystrix (MTP LS 68)
Macrostomum mystrophorum (MTP LS 64)
lsrDNA
ssrDNA
FJ715315
FJ715316
FJ715318
FJ715317
FJ715332
FJ715331
FJ715333
FJ715334
FJ715330
FJ715328
FJ715329
FJ715324
FJ715321
FJ715319
FJ715320
FJ715322
FJ715327
FJ715326
FJ715323
FJ715325
FJ715295
FJ715296
FJ715298
FJ715297
FJ715312
FJ715311
FJ715313
FJ715314
FJ715310
FJ715308
FJ715309
FJ715304
FJ715301
FJ715299
FJ715300
FJ715302
FJ715307
FJ715306
FJ715303
FJ715305
Species are listed in the order in which they appear in the tree. The MTP accession code identifies the
morphological documentation of each sequenced specimen (http://macrostomorpha.info). All sequences
are new for this study.
Schärer et al. www.pnas.org/cgi/content/short/1013892108
11 of 14
Movie S1. A copulating pair of the flatworm Macrostomum lignano. Note that one individual performs the postcopulatory sucking behavior, after which
a bundle of sperm shafts can be seen sticking out of the female genital opening.
Movie S1
Movie S2. A single sperm of the flatworm Macrostomum lignano. Note the highly motile feeler and shaft, which allow the sperm to perform complex
movements.
Movie S2
Schärer et al. www.pnas.org/cgi/content/short/1013892108
12 of 14
Movie S3. Anchored received sperm in a live specimen of the flatworm Macrostomum lignano. Note the thickened epithelium of the female antrum (i.e., the
translucent rim around the sperm) and the polarized nature of the sperm, most of which are anchored in the cellular valve (i.e., the part of the antrum
epithelium closest to the forming oocyte, which is the dark area on the right).
Movie S3
Movie S4. Detail of the anchored sperm of the specimen in Movie S3. Note the undulating sperm feelers, which are deeply embedded in the cellular valve.
Movie S4
Schärer et al. www.pnas.org/cgi/content/short/1013892108
13 of 14
Movie S5. Focusing through the parenchyma of a live specimen of the flatworm Macrostomum hystrix. Note the abundant hypodermically inseminated and
highly motile sperm.
Movie S5
Movie S6. Sperm of the flatworm Macrostomum hystrix. Note the highly motile feeler and shaft, and the lack of bristles and brush.
Movie S6
Schärer et al. www.pnas.org/cgi/content/short/1013892108
14 of 14