Download Unconventional T Cell Pleiotropy T Cells

Distinct Cytokine-Driven Responses of
Activated Blood γδ T Cells: Insights into
Unconventional T Cell Pleiotropy
This information is current as
of June 18, 2017.
David Vermijlen, Peter Ellis, Cordelia Langford, Anne
Klein, Rosel Engel, Katharina Willimann, Hassan Jomaa,
Adrian C. Hayday and Matthias Eberl
J Immunol 2007; 178:4304-4314; ;
doi: 10.4049/jimmunol.178.7.4304
http://www.jimmunol.org/content/178/7/4304
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2007/03/19/178.7.4304.DC1
This article cites 68 articles, 34 of which you can access for free at:
http://www.jimmunol.org/content/178/7/4304.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Supplementary
Material
The Journal of Immunology
Distinct Cytokine-Driven Responses of Activated Blood ␥␦
T Cells: Insights into Unconventional T Cell Pleiotropy1
David Vermijlen,*† Peter Ellis,‡ Cordelia Langford,‡ Anne Klein,§ Rosel Engel,§¶
Katharina Willimann,储 Hassan Jomaa,§¶ Adrian C. Hayday,2* and Matthias Eberl3§储
xtending the seminal realization that CD4⫹ T cell function is distinct according to whether IL-12 or IL-4 prevails during T cell priming, it is now appreciated that the
production of a plethora of effector molecules can be provoked in
CD4⫹ T cells according to the respective influence of the microenvironment. Thus, Th1 cells characterized by IL-2, IFN-␥, and
TNF-␣ trigger inflammatory T cell responses to intracellular infections; Th2 cells characterized by IL-4, IL-5, and IL-13 promote
humoral and eosinophilic responses, suited to attacks on large extracellular pathogens; Th17 cells characterized by IL-17 and
TNF-␣ regulate neutrophil differentiation and tissue-infiltration
that combats bacterial infections; regulatory T cells characterized
by IL-10 and TGF-␤ limit the scope of potentially pathologic immune responses; and follicular B-helper T (TFH)4 cells characterized
E
*Peter Gorer Department of Immunobiology, King’s College London, London,
United Kingdom; †Institute for Medical Immunology, Université Libre de Bruxelles
Gosselies, Belgium; ‡The Wellcome Trust Sanger Institute, Hinxton, Cambridge,
United Kingdom; §Biochemisches Institut, Infektiologie, Justus-Liebig-Universität
Giessen, Giessen, Germany; ¶Institut für Klinische Chemie und Pathobiochemie, Universitätsklinikum Giessen und Marburg, Giessen, Germany; and 储Institute of Cell
Biology, University of Bern, Bern, Switzerland
Received for publication August 16, 2006. Accepted for publication January 19, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by a Marie-Curie Intra-European Fellowship (to D.V.) and
by grants from The Wellcome Trust (to A.C.H.), the Deutsche Forschungsgemeinschaft (to H.J.), and the Else Kröner-Fresenius Stiftung (to M.E.).
2
Address correspondence and reprint requests to Dr. Adrian C. Hayday, Peter Gorer
Department of Immunobiology, Guy’s, King’s and St. Thomas’ Medical School, King’s
College London, London SE1 9RT, U.K. E-mail address: [email protected]
3
Current address: Department of Medical Biochemistry and Immunology, Cardiff
University School of Medicine, Cardiff CF14 4XN, U.K.
4
Abbreviations used in this paper: TFH cell, follicular B-helper-like T cell; GC, germinal center; HMB-PP, (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate; ␥c, common ␥-chain; DC, dendritic cell; FDC, follicular DC; LN, lymph node; LT, lymphotoxin; aRNA, antisense RNA.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
www.jimmunol.org
by IL-21 promote high-affinity B cell maturation in germinal
centers (GCs) (1, 2). These diverse effector functions profoundly
affect the complexion of the host’s response and dysregulation of
each of these responses can be associated with inflammatory, allergic, and/or autoimmune diseases. Such realizations have profoundly influenced how we think about the immune system. Nonetheless, they are largely limited to CD4⫹ ␣␤ T cells which are not
the only type of effector/regulatory T cell; rather, it is increasingly
appreciated that the immune response is a spatial and temporal
integration of distinct cell types that include conventional and unconventional T cells (3).
␥␦ T cells are the prototype of unconventional lymphocytes (4).
Serial analysis of gene expression in the mouse depicted a
“pseudomemory” or “activated-yet-resting” phenotype of tissueassociated ␥␦ T cells (5), and data in several species point to the
rapid and robust responses of ␥␦ T cells, providing a transitional
response between innate immunity provided by myeloid and epithelial cells, and adaptive immunity provided by conventional lymphocytes (4). For instance, human V␥9/V␦2 T cells compose
⬃0.5–5% of peripheral lymphocytes but may transiently expand to
occupy 50% of the peripheral T cell pool following infection by
microbial pathogens that produce the low m.w. compound, (E)-4hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), an intermediate of the alternative, nonmevalonate pathway of isoprenoid
biosynthesis (6).
There are compelling data that activated ␥␦ T cells play critical
roles in tumor surveillance, immunoregulation, and some aspects
of immunoprotection, particularly within tissues and during early
life (7). Accordingly, ␥␦-deficient animals show impairments in
each of these areas. Moreover, ␥␦ T cells share strong similarities
with other unconventional T cells (e.g., ␣␤ T cells expressing
CD8␣␣) that are similarly not restricted by classical MHC (8).
Therefore, an improved understanding of ␥␦ T ells is required if
we are to develop a fuller picture of functional integration within
the human immune system. Despite this, there has been scant
application of comprehensive molecular tools such as microarrays
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Human V␥9/V␦2 T cells comprise a small population of peripheral blood T cells that in many infectious diseases respond to the
microbial metabolite, (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), expanding to up to 50% of CD3ⴙ cells. This
“transitional response,” occurring temporally between the rapid innate and slower adaptive response, is widely viewed as proinflammatory and/or cytolytic. However, increasing evidence that different cytokines drive widely different effector functions in ␣␤
T cells provoked us to apply cDNA microarrays to explore the potential pleiotropy of HMB-PP-activated V␥9/V␦2 T cells. The
data and accompanying validations show that the related cytokines, IL-2, IL-4, or IL-21, each drive proliferation and comparable
CD69 up-regulation but induce distinct effector responses that differ from prototypic ␣␤ T cell responses. For example, the
Th1-like response to IL-2 also includes expression of IL-5 and IL-13 that conversely are not induced by IL-4. The data identify
specific molecules that may mediate ␥␦ T cell effects. Thus, IL-21 induces a lymphoid-homing phenotype and high, unexpected
expression of the follicular B cell-attracting chemokine CXCL13/BCA-1, suggesting a novel follicular B-helper-like T cell that may
play a hitherto underappreciated role in humoral immunity early in infection. Such broad plasticity emphasizes the capacity of
␥␦ T cells to influence the nature of the immune response to different challenges and has implications for the ongoing clinical
application of cytokines together with V␥9/V␦2 TCR agonists. The Journal of Immunology, 2007, 178: 4304 – 4314.
The Journal of Immunology
Materials and Methods
␥␦ T cell stimulation assays
PBMC were cultured as described (12). ␥␦ T cells, monocytes, or B cells
were depleted using TCR␥␦ microbeads (Miltenyi Biotec) or CD14-FITC
(RM052) and CD19-FITC Abs (J4.119) (Beckman Coulter), in combination with anti-FITC microbeads (Miltenyi Biotec). Depletion efficiencies
were 98.8 ⫾ 1.8% for ␥␦ T cells, 86.0 ⫾ 5.0% for monocytes, and 95.2 ⫾
0.7% for B cells. Positively selected populations for reconstitutions were
95.1 ⫾ 1.6% ␥␦⫹ and 97.4 ⫾ 0.5% CD14⫹. Synthetic HMB-PP was used
at 0.1–1.0 nM, recombinant human cytokines as follows: 100 U/ml IL-2
(Proleukin; Chiron); 10 ng/ml IL-4, IL-7, or IL-15 (Promocell); 10 ng/ml
IL-21 (Zymogenetics); 1000 U/ml IFN-␣2a (Roferon; Roche); and 100
U/ml IFN-␤1a (Rebif; Serono). These concentrations were chosen from
optimized titrations. Recombinant human IL-13 (Promocell); IL-17A, IL17B, IL-17C, IL-17E, and IL-17F; and IFN-␭1 and IFN-␭2 were tested at
1–100 ng/ml.
Flow cytometry
Cells were harvested after 18 h to 6 days of culture and were analyzed
on a four-color Epics XL flow cytometer supported with Expo32 ADC
(Beckman Coulter) (12). Abs used were CD3-PE-Texas Red (UCHT1),
V␥9-PC5 (Immu360), CD11a-PE (25.3), CD25-PE (B1.49.9), CD27-PE
(1A4CD27), CD45RO-PE (UCHL-1), CD54-FITC (84H10), CD62L-FITC
(DREG56), CD69-PE (TP1.55.3), CD94-PE (HP-3B1), CD244-PE (C1.7)
(Beckman Coulter); NKG2D-PE (1D11) (BD Biosciences); and KLRG1Alexa 488 (13A2) (22). For detection of intracellular proteins, brefeldin A
(Sigma-Aldrich) was added to cultures at 10 ␮g/ml 3 h before harvesting.
Surface-stained cells were labeled using the Fix & Perm kit (Caltag Laboratories) and IFN-␥-FITC (45.15), TNF-␣-PE (188), or CD152-PE
(BNI3) (Beckman Coulter).
Cell purification and RNA isolation
␥␦ T cells were purified from fresh or cultured PBMC using TCR␥␦ microbeads (Miltenyi Biotec), resulting in purities of 93–99% ␥␦⫹ cells (90 –
96% V␥9⫹). Alternatively, V␥9⫹CD3⫹ and CD8⫹CD3⫹ cells were sorted
to ⬎99% purity on a MoFlo machine (Cytomation), using CD3-PE-Texas
Red (UCHT1), V␥9-PC5 (Immu360), CD8␣␤-PE (2ST8.5H7) (Beckman
Coulter), and TCR␣␤-FITC Abs (T1089.1A-31) (BD Biosciences). In each
case, total RNA was isolated using the RNeasy kit combined with RNasefree DNase treatment (Qiagen).
Semiquantitative RT-PCR
RNA was reverse transcribed using oligo(dT) primers and Superscript III
reverse transcriptase (Promega). Serial dilutions of each cDNA were tested
for cyclophilin expression and normalized dilutions were selected. Twentymicroliter PCRs contained 0.25 ␮M primers, 250 ␮M dNTPs, 1.5–2.5 mM
MgCl2, and 0.75 U GoTaq polymerase (Promega). Genes were amplified
for 28 –35 cycles at 94°C for 30 s, 55– 63°C for 45 s, and 72°C for 60 s,
using a Techne TC-512 gradient cycler. Primer pairs were: cyclophilin, AA
AGCATACGGGTCCTGGCAT and CGAGTTGTCCACAGTCAGCAATG;
CXCL13, TGATCGAATTCAAATCTTGCCCCGTG and AAGCTTGAGT
TTGCCCCATCAGCTCC;GATA-3,CTGCAATGCCTGTGGGCTCandGA
CTGCAGGGACTCTCGCT; IL-4, CTCTCTCATGATCGTCTTTAGCCTT
TC and AACACAACTGAGAAGGAAACCTCTGC; IL-21, GGCAACAT
GGAGAGGATTGT and GTTGGGCCTTCTGAAAACAG; and IL-21R,
ACACCGATTACCTCCAGACG and CATCCATGTGGCAGGTGTAG.
Analyses were performed on three individual donors, in two independent
cultures each.
Real-time RT-PCR
Total RNA was reverse transcribed using random hexamers, with TaqMan
reagents (Applied Biosystems). Real-time PCRs were performed using
SYBR Green master mix, on a ABI Prism 7900HT sequence detection
system running under SDS2.2 (Applied Biosystems). Primer pairs were
designed using Primer Express 2.0 (Applied Biosystems): cyclophilin,
TGCTGGACCCAACACAAATG and TGCCATCCAACCACTCAGT
CT; CXCL13, CATCTCGACATCTCTGCTTCTCA and TGGACACATC
TACACCTCAAGCTT; IL-4, CACAAGCAGCTGATCCGATTC and AA
CGTACTCTGGTTGGCTTCCTT; and lymphotoxin (LT)-␣, TGTTGGCC
TCACACCTTCAG and TGCTGTGGGCAAGATGCA. Relative gene
quantification was performed in duplicate using the standard curve method.
Microarray analysis
Total RNA was quantified and the A260:280 ratio was checked using a
NanoDrop 1000A spectrophotometer. Two hundred nanograms of total
RNA (corresponding to 200,000 – 400,000 cells) was amplified by in vitro
transcription using the Amino Allyl MessageAmp II aRNA Amplification
kit (Ambion). In brief, RNA was reverse transcribed using a T7 Oligo(dT)
primer to generate first strand cDNA, containing a T7 promoter sequence.
After second-strand synthesis with DNA polymerase and RNase H, the
cDNA was purified and transcription performed using amino allyl-labeled
dUTPs to generate antisense RNA (aRNA). All steps were quantified using
a NanoDrop spectrophotometer, and nucleic acid integrity confirmed by
OD and gel electrophoresis, so that the comparability of RNA preparation
and processing was assured for each sample. Following aRNA purification,
the amino allyl UTP residues on the aRNA were coupled to either Cy3 or
Cy5 dye (Amersham Biosciences). The labeled aRNA was then hybridized
on Hver2.1.1 cDNA arrays containing ⬃15,000 spots (www.sanger.ac.uk/
Projects/Microarrays/informatics/hver2.1.1.shtml). In each case, dye-swap
hybridizations were performed. Arrays were scanned with a PerkinElmer
Scanarray Express Microarray Scanner using ScanArray software 3.0. Microarray data and procedures were deposited at ArrayExpress (www.ebi.
ac.uk/arrayexpress), under accession number E-MEXP-763.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
to fully assess the potential pleiotropy of ␥␦ T cell function in
different cytokine contexts (9 –12). Issues of particular importance
include whether or not ␥␦ T cell responses simply comply with the
prototypic responses of ␣␤ T cells, or whether yet further functional diversification is apparent (13). Such issues have been analyzed here via the application of high-quality cDNA microarrays
to human ␥␦ T cells stimulated by IL-2, IL-4, or IL-21.
We examined IL-2, IL-4, and IL-21 because they share the common ␥-chain (␥c) in their respective receptors, and yet each possesses distinct costimulatory activities as conventional T cell
growth factors (14). IL-2 is typically released by ␣␤ T cells following Th1 priming by IL-12-secreting dendritic cells (DCs) and
regulates T and NK cell growth and survival and the scale of an
ensuing Th1 response. IL-4 is released by activated ␣␤ T cells,
mast cells, and basophils under Th2 conditions and can directly
and indirectly promote humoral responses, including allergies.
And IL-21 is expressed predominantly by TFH cells (15), which are
pivotal in the selection of high-affinity GC centrocytes that have
undergone somatic hypermutation (3). IL-21 induces B lymphocyte-induced maturation protein-1 and the GC-associated transcription factor BCL-6 and promotes B cell differentiation into
Ab-secreting plasma cells (16). Consequently, IL-21R⫺/⫺ mice
have reduced IgG1 and IgG2b serum levels, whereas elevated
IL-21 levels are present in nonobese diabetic mice; in BXSBYaa mice, that are prone to a lupus-like disease; and in sanroque mice that carry a mutation in the RING-type E3 ubiquitin
ligase roquin, leading to spontaneous GC formation and hightiter autoantibodies (17–19).
A unique aspect of the present array analysis is that the cytokines were applied in the context of HMB-PP, which is readily
active in vitro at picomolar concentrations and thereby more potent
than any other natural compound, such as isopentenyl pyrophosphate (⬃104⫻), 3-formyl-1-butyl pyrophosphate (⬃105⫻), or alkylamines (106–108⫻); indeed, all biological and chemical indications are that HMB-PP is the most physiologic of all currently
identified activators of human V␥9/V␦2 T cells (20, 21). The data
obtained demonstrate that V␥9/V␦2 T cell functions are highly
pleiotropic, very much steered by the prevailing cytokine milieu.
Intriguingly however, each of the ␥␦ T cell responses shows seemingly unique features by comparison to the corresponding ␣␤ T
cell response. Additionally, the data offer a molecular basis for
previous reports that murine and human ␥␦ T cells can help B cell
maturation, by providing evidence that IL-21-stimulated V␥9/V␦2
T cells may exist as a distinct type of follicular T cell, similar to,
but with a distinct molecular signature, from recently characterized
CD4⫹TCR␣␤⫹ TFH cells. Thus, our studies unequivocally identify signatory profiles that characterize the pleiotropic ␥␦ T cell
compartment in human blood.
4305
4306
FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS
FIGURE 1. Flow cytometric analysis of activated ␥␦
T cells. PBMC were cultured in the absence (f) or presence (_) of HMB-PP, together with the cytokines indicated, and analyzed by flow cytometry. Cell proliferation was assessed by expansion of V␥9⫹CD3⫹ cells
within the CD3⫹ lymphocyte population (n ⫽ 12). Expression of CD69 on V␥9⫹ CD3⫹ cells was determined
after 18 h (n ⫽ 8), expression of ICAM-1 (n ⫽ 6), and
LFA-1 (n ⫽ 4) after 6 days.
CXCL10, CXCL13, and TRAIL in culture supernatants were detected with
human DuoSet ELISA developing kits (R&D Systems). IL-3, IL-5, IL-13,
GM-CSF, IFN-␥, TNF-␣, CCL2, and CCL3 were detected with a Beadlyte
Human 22-Plex multicytokine detection system (Upstate Biotechnology).
Immunohistochemistry
Paraffin-embedded gut follicles were pretreated by Streptomyces griseus
proteinase (Sigma-Aldrich) and incubated overnight at 4°C with primary
Abs against pan-␥␦-TCR (A20; Santa Cruz Biotechnology), CXCL13
(AF470; R&D Systems), or appropriate isotype controls. Subsequent detection and visualization of bound Abs was performed by the ABC method
as described (23).
Statistical analysis
Differential gene expression was analyzed using Limma (linear models for
microarray data; www.bioconductor.org). Analysis included background
correction with an offset value of 50, within array normalization, fitting a
linear model (lmfit), e-Bayes statistics, and adjustment for multiple testing
according to Benjamin and Hochberg. Differentially expressed genes were
FIGURE 2. IL-2-dependent gene
expression. Expression of IFN-␥ (n ⫽
3– 6) and TNF-␣ (n ⫽ 6) in V␥9⫹
CD3⫹ cells was analyzed by intracellular flow cytometry after 72 h. GMCSF (n ⫽ 4), CCL3 (n ⫽ 3), and
IL-13 (n ⫽ 4) were detected in 72 h
culture supernatants, IL-5 (n ⫽ 2) after 6 days. Solid and hatched bars as
in Fig. 1 legend.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
ELISA and Luminex analysis
The Journal of Immunology
4307
selected on the Benjamin and Hochberg-adjusted p value ( p ⬍ 0.05), and
ranked according to their M value. M ⫽ log2[Cy5/Cy3] represents the
differential ratio, with M ⫽ 1 corresponding to a Cy5:Cy3 ratio of 21 ⫽ 2;
M ⫽ 2 corresponding to 22 ⫽ 4; etc. M values for IL-2-enriched genes
appear positive in the IL-2 vs IL-4, and IL-2 vs IL-21 comparisons; hence,
IL-4- or IL-21-enriched genes have negative M values. A ⫽ 1⁄2 ⫻
(log2(Cy5) ⫹ log2(Cy3)) is a measurement of the average signal intensity.
All other statistical analyses were performed using two-tailed Student’s t
tests for paired data. Differences between samples with and without added
cytokine were considered significant as indicated in the figures: ⴱ, p ⬍
0.05. Data shown in bar diagrams represent means and SEs of the indicated
numbers of PBMC samples obtained from different donors.
Results
Selective expansion and activation of HMB-PP-specific V␥9/V␦2
T cells by ␥c cytokines
Microarrays identify different responses to different cytokines
By 72 h, HMB-PP plus IL-2 stimulated V␥9/V␦2 T cells are potent
producers of proinflammatory cytokines (25). Hence, this time
point was chosen to apply Hver2.1.1 microarrays containing
⬃15,000 cDNAs to compare V␥9/V␦2 T cells stimulated with
HMB-PP plus IL-2, IL-4, and IL-21, respectively. Additionally, a
comparison of activated and dividing V␥9/V␦2 T cells with fresh
resting cells was made from a second donor at 6 days, at which
time point, V␥9/V␦2 T cells proliferate extensively in the presence
of HMB-PP plus IL-2 (Fig. 1; Ref. 25). Differential gene expression was defined statistically using Limma bioinformatics software, by calculating log2-relative gene expression (M) and average
expression intensity (A) values. By this means, 513 differentially
expressed genes were identified in IL-2- vs IL-4-treated cells, and
328 differentially expressed genes defined IL-2 vs IL-21 treatment.
These numbers were comparable to each other, yet much lower
than those obtained comparing activated vs fresh V␥9/V␦2 T cells
(1924 genes).
Molecular characteristics of the V␥9/V␦2 T cell response
to IL-2
The molecular characterization of the V␥9/V␦2 T cell response to
HMB-PP plus IL-2 stimulation revealed a prototypic proinflammatory Th1-type phenotype, but with unexpected and distinct features. When comparing IL-2-stimulated, proliferating cells on day
6 with freshly isolated cells, there was up-regulation of core Th1type molecules such as IFN-␥ (M ⫽ ⫹3.25), LT-␣ (M ⫽ ⫹2.30),
TNF-␣ (M ⫽ ⫹2.26), CCL3/MIP-1␣ (M ⫽ ⫹2.11), and GM-CSF
(M ⫽ ⫹1.02). This was independently corroborated when HMBPP-treated cells from a different donor were compared after 72 h
FIGURE 3. IL-4-dependent gene expression. A, Expression of IL-4 and
LT-␣ mRNAs by ␥␦ T cells purified from PBMC after 72 h, as analyzed
by real-time RT-PCR. Expression levels were normalized to values in medium controls and represent mean values and SDs from duplicate experiments. B, Expression of IL-4 and GATA-3 mRNAs by ␥␦ T cells purified
from PBMC after 72 h. Semiquantitative RT-PCR data shown are representative of three blood donors. C, Surface expression of CD27 (n ⫽ 6 –7)
as analyzed by flow cytometry on day 6.
for the effects of IL-2, IL-4, and IL-21 (supplementary table I).5
The data were confirmed by a series of validations using the same
and different donors; protein data for IFN-␥, TNF-␣, GM-CSF,
CCL3/MIP-1-␣, and TRAIL (M ⫽ ⫹1.18) (Fig. 2 and data not
shown) are consistent with recent analyses of proinflammatory ␥␦
T cells (26, 27), and emphasize that IL-2-stimulated cells are considerably more proinflammatory than IL-4- or IL-21-stimulated
cells. Of note, the Hver2.1.1 system tended to underestimate differences, as with other microarrays.
To establish a more detailed comparison of genes induced in
human V␥9/V␦2 T cells and ␣␤ T cells under Th1 conditions
(28 –31), we noted that both cell types up-regulated oncostatin M
(M(IL-2 vs IL-4) ⫽ ⫹1.99), PMA-induced protein 1 (M ⫽ ⫹1.92),
suppressor of cytokine signaling 2 (M ⫽ ⫹1.47), CD66a/carcinoembryonic Ag-related cell adhesion molecule 1 (M ⫽ ⫹1.43),
CCR1 (M ⫽ ⫹1.31), CD150/signaling lymphocytic activation
molecule (M ⫽ ⫹1.10), granulysin (M ⫽ ⫹1.03), CCR5 (M ⫽
⫹0.97), and regulator of G protein signaling 16 (M ⫽ ⫹0.83). This
sharp and broad Th1 differentiation of V␥9/V␦2 T cells is striking
considering that the cultures were supplemented with synthetic
(LPS free) HMB-PP and IL-2 in the absence of any overt activators of DC; induction of monocyte differentiation toward immature
5
The online version of this article contains supplemental material.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Addition of HMB-PP to PBMC up-regulated the activation marker
CD69 on ⬎50% of V␥9/V␦2 T cells and this was further enhanced
by cotreatment with IL-2, IL-4, and IL-21 (Fig. 1), or by IFN-␣
and IFN-␤ (data not shown). Conversely, the HMB-PP-dependent
expansion of V␥9/V␦2 T cells over a 6-day period was promoted
only by the cytokines signaling via the ␥c-chain receptors: IL-2,
IL-4, and IL-21 (with IL-4 having a smaller but nevertheless significant effect) (Fig. 1) and IL-7 and IL-15 (data not shown). No
expansion was supported by type I IFNs (IFN-␣, IFN-␤), type III
IFNs (IFN-␭1 (IL-29), IFN-␭2 (IL-28A)), IL-13, or the IL-17 family members IL-17A, IL-17B, IL-17C, IL-17E (IL-25), and IL17F (data not shown). IL-2, IL-4, and IL-21 treatment also increased the percentage of V␥9/V␦2 T cells expressing LFA-1
(CD11a) and ICAM-1 (CD54) (Fig. 1), as well as NKG2D and
CD94 (data not shown), implying an enhanced capacity of expanding V␥9/V␦2 T cells to engage target cells (24). These data
emphasize the profound capacity of HMB-PP plus IL-2, IL-4, or
IL-21 to activate, expand, and differentiate human V␥9/V␦2
T cells.
4308
FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS
DCs and their subsequent maturation by activated ␥␦ cells is unlikely to occur in our PBMC cultures within 72 h (32). This indicates that a population of peripheral blood V␥9/V␦2 T cells is
precommitted to Th1-type differentiation upon signaling via the
TCR and CD25. However, unlike conventional Th1-type responses, V␥9/V␦2 T cells treated with HMB-PP plus IL-2 unexpectedly up-regulated the Th2 cytokines IL-13 (M(IL-2 vs
IL-4) ⫽ ⫹0.86) and IL-5 (Fig. 2). Neither was substantially
induced by IL-4 or IL-21, arguing against the idea that this was
simply a cytokine reactivation of Th2-like V␥9/V␦2 T cells.
Molecular characteristics of the V␥9/V␦2 T cell response to IL-4
The bulk of the qualitative response to TCR plus IL-4 stimulation is
shared by human V␥9/V␦2 and ␣␤ T cells, e.g., T cell factor 1
(M(IL-2 vs IL-4) ⫽ ⫺2.13), EBV-induced receptor 2 (M ⫽ ⫺1.75),
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. IL-21-dependent gene expression. A,
Surface expression of CD25 (n ⫽ 6), intracellular expression of CD152 (n ⫽ 6), and CXCL10 secretion into
the culture supernatants (n ⫽ 4 –9) were detected after
72 h. Surface expression of CD244 (n ⫽ 8 –11), KLRG1
(n ⫽ 3), and CD62L (n ⫽ 5) was measured after 6 days
(note that KLRG1 expression is depicted as mean fluorescence values as at baseline V␥9/V␦2 T cells were
already ⬃80% KLRG1⫹). Solid and hatched bars as in
Fig. 1 legend. B, Expression of IL-21 and IL-21R
mRNAs by ␥␦ T cells purified from PBMC after 72 h
in culture was analyzed by semiquantitative RT-PCR;
data shown are representative of three individual blood
donors (ctrl, whole PBMC stimulated with PHA).
T lymphocyte maturation-associated protein (M ⫽ ⫺1.27), XCL1/
lymphotactin (M ⫽ ⫺1.19), IL-10R␣ (M ⫽ ⫺0.88), and special
AT-rich sequence-binding protein 1 (M ⫽ ⫺0.79), that were described in previous studies of total human T cells polarized under
Th2 conditions (28 –31). Likewise, elevated expression of IL17BR (M ⫽ ⫺1.19), which was recently described on human CD4
T cells polarized under Th2 conditions may confer increased responsiveness to the Th2 favoring cytokine IL-17E (IL-25) (15, 33).
The reciprocal expression of LT-␣ and IL-4 illustrates the mutual
Th1-type and Th2-type responses of V␥9/V␦2 T cells to IL-2 and
IL-4, respectively, with IL-21 inducing neither such state (Fig.
3A). At the same time, while the Th2-specific transcription factor
GATA-3 was obviously up-regulated in IL-4-treated, HMB-PPactivated cells (M(IL-2 vs IL-4) ⫽ ⫺1.33), it was nonetheless
clearly detectable in IL-2-stimulated cells (Fig. 3B).
The Journal of Immunology
4309
Table I. Genes preferentially expressed in the presence of IL-21
M
Gene
⫺2.16 FMR-1
⫺2.12
⫺1.80
⫺1.50
⫺1.41
⫺0.95
⫺0.87
⫺0.87
⫺0.83
⫺0.81
⫺0.71
⫺0.71
⫺0.68
⫺0.66
⫺0.65
⫺0.64
⫺0.63
Fragile X mental retardation protein 1
Implication in GC Physiology and/or Lymphocyte Homing
Possible suppression of proinflammatory cytokines, similarly
to the fragile X-related protein FXR1P
CXCL13 (BCA-1) B cell-attracting chemokine
Produced by follicular stromal cells and TFH cells, defines the
GC by attracting CXCR5⫹ cells to the follicle
CXCL10 (IP-10)
IFN-␥-inducible protein, 10 kDa
Increased expression in GCs in comparison with mantle and
marginal zone
MafB
v-maf homolog B
TFH-associated as confirmed in microarray studies
TrkA
High-affinity NGF receptor
Expressed in paracortical zones but also inside follicles,
presumably by FDCs
Trps1
Trichorhinophalangeal syndrome I
TFH-associated as confirmed in microarray studies
SNARK
SNF1/AMP-activated protein kinase
TFH-associated as confirmed in microarray studies
CD266
TWEAK receptor (Fn14)
Suppression of proinflammatory cytokine expression upon
TNF-like weak inducer of apoptosis binding
DCNP1
Dendritic cell nuclear protein 1
Abundantly expressed in mature DCs and at a lower level in
immature DCs but not in monocytes and B cells
PD-L1 (B7-H1)
Programmed death-1 (PD-1) ligand 1 Expressed in GC; possibly involved in regulating affinity
maturation as PD-1⫺/⫺ mice develop lupus-like symptoms
Notch-1
Notch homolog 1, translocation-assoc. TFH-associated as confirmed in microarray studies
Granzyme K
Serine protease, tryptase II
TFH-associated as confirmed in microarray studies
CD244 (2B4)
Natural killer cell receptor
TFH-associated as confirmed in microarray studies
CXCR6
Chemokine receptor
May recognize CXCL16 on the follicle-associated epithelium
IL-21R
IL-21 receptor
TFH-associated as confirmed in microarray studies
Decysin
Disintegrin metalloproteinase
Strongly expressed in mature DCs, possibly involved in GC
reaction
Dectin-1
␤-glucan receptor
Abundant in paracortical and medullary regions but also
within follicles and around the GC
TGF-␤RII
TGF-␤ receptor type 2
In human tonsils mainly expressed by FDCs
Clusterin
Apolipoprotein J
Survival factor for GC B cells with an efficiency comparable
to CD40 agonists; marker for murine FDCs
USF1
Upstream transcription factor 1
Implicated in promoting expression of fragile X mental
retardation protein 1 (FMR-1)
CD226 (DNAM-1) DNAX accessory molecule 1
Drives migration of mature DCs via binding CD112 and
CD155 in the parafollicular T-cell region and around high
endothelial venules
Fc⑀RI
High-affinity IgE receptor
Expressed in tonsillar GCs with some staining in the mantle
zone
Plexin-B1
High-affinity semaphorin receptor
Expressed by FDCs, mature DCs, activated T cells; binds
CD100 on T and B cells in interfollicular areas and the GC
A parallel functional potential of TCR plus IL-4 activated ␣␤ T
cells and V␥9/V␦2 T cells was evident in specific genes that may
facilitate B cell help. Thus, while IL-2-treated V␥9/V␦2 T cells
lost expression of CD27, a TNFR family member that engages
CD70 on B and T cells, IL-4 up-regulated CD27 mRNA (M(IL-2
vs IL-4) ⫽ ⫺1.05) and its surface expression (Fig. 3C). There was
likewise IL-4-induced up-regulation of B cell maturation protein
(CD269) (M ⫽ ⫺1.05), that interacts with B cell-activating factor
belonging to the TNF family (BLyS, CD257) in the GC. However,
set against this backdrop, the lack of IL-5 and IL-13 production by
IL-4-treated, HMB-PP activated V␥9/V␦2 T cells (Fig. 2) is striking and consistent with similar results reported for V␥9/V␦2 T
cells treated with IL-4 in the presence of anti-IL-12 (11). Collectively, these data highlight a distinction between the Th2-type response of human peripheral blood ␥␦ T cells and that shown by
conventional ␣␤ T cells.
Molecular characteristics of the V␥9/V␦2 T cell response
to IL-21
The arrays revealed the V␥9/V␦2 T cell response to HMB-PP plus
IL-21 stimulation to combine a limited proinflammatory phenotype with additional potential to promote B cell maturation. Some
IL-21-induced effects were clearly shared with IL-2, e.g., surface
up-regulation of CD25 and KLRG1, intracellular accumulation of
CD152, and secretion of the chemokine CXCL10/IFN-␥-inducible
protein-10 (Fig. 4). In the case of the costimulatory receptor
CD244 (2B4), synergistic up-regulation by IL-21 and HMB-PP
Ref.
37
15, 34, 35
36
15, 35
38
15
15
39
40
41
35
15
15
42
15
43
44
45
46
47
48
49
50
signaling was particularly evident. However, there was a generally
reduced level of proinflammatory mediators induced by IL-21
compared with IL-2 (Fig. 2) despite the fact that these treatments
displayed similar array intensities for the master regulator of Th1
development, T-bet (A ⫽ 13.53), as confirmed by RT-PCR (data
not shown). There was similarly equivalent expression of the Tbet-related factor, eomesodermin (A ⫽ 10.81). In this context, the
microarray analysis revealed that several genes that may suppress
proinflammatory responses were preferentially expressed in the
presence of IL-21 (Table I), e.g., the translational repressor fragile
X mental retardation protein 1 (M(IL-2 vs IL-21) ⫽ ⫺2.16), and
the receptors for the TNF-like weak inducer of apoptosis
(TWEAK-R, CD266) (M ⫽ ⫺0.87), and for TGF-␤ (TGF-␤RII)
(M ⫽ ⫺0.71).
IL-21 selectively induces expression of CXCL13 and other
follicular molecules
Other aspects of the IL-21-induced phenotype were most evidently
shared with IL-4. For example, the sustained levels of the lymph
node (LN) homing receptor CD62L, and expression of the IL-21R
(M(IL-2 vs IL-21) ⫽ ⫺0.73), which was much greater in IL-21
compared with IL-4-treated cells. Thus, lymph-node homing V␥9/
V␦2 T cells may be particularly sensitive to IL-21 produced by
follicular TCR␣␤⫹ TFH cells, whereas they may not themselves
be TFH cells because they do not express IL-21 (Fig. 4B). Nonetheless, in addition to IL-21R and CD244 (M ⫽ ⫺0.74), other
signatures of TFH cells were apparent (15, 34, 35), e.g., MafB
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
⫺0.79
⫺0.78
⫺0.74
⫺0.74
⫺0.73
⫺0.72
Description
4310
FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS
(M(IL-2 vs IL-21) ⫽ ⫺1.50), Trps1 (M ⫽ ⫺0.95), SNF1/AMPactivated protein kinase (M ⫽ ⫺0.87), granzyme K (M ⫽ ⫺0.78),
and dectin-1 (M ⫽ ⫺0.71) (Table I).
Of note, the homeostatic B cell-attracting chemokine CXCL13/
BCA-1 was the second most differentially expressed gene in the
IL-2 vs IL-21 comparison (M ⫽ ⫺2.12) (Table I; Fig. 5A). This
was validated by PCR, and by detection of CXCL13 in culture
supernatants, in which assay IL-4 induced only a marginal increase
(Fig. 5, B–D). The amount of CXCL13 secreted by HMB-PP-stimulated PBMC depended on the IL-21 concentration, with 73 ⫾ 13,
190 ⫾ 76, 613 ⫾ 171, and 689 ⫾ 201 pg/ml CXCL13 detected in
the presence of none, 0.1, 1.0, and 10 ng/ml IL-21 respectively
(n ⫽ 3). At these IL-21 concentrations, no proinflammatory cytokines are induced (Ref. 25, and this study). Depletion from PBMC
of ␥␦ T cells, but not monocytes or B cells, abrogated the HMBPP/IL-21-dependent CXCL13 secretion, which could be restored
by reconstitution with purified ␥␦⫹ cells (Fig. 5E). Likewise,
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. IL-21-dependent expression of CXCL13. A, M/A plot of
IL-21-stimulated vs IL-2-stimulated
V␥9/V␦2 T cells. The locations of the
IL-2-induced genes encoding for
GM-CSF and LT-␣ and the IL-21-induced gene encoding for CXCL13 are
indicated. B and C, Expression of
CXCL13 mRNA by ␥␦ T cells purified from PBMC cultured for 72 h
in medium alone or with HMB-PP
and the cytokines indicated. Semiquantitative RT-PCR data shown
are representative of three blood donors; real-time data are mean values
and SDs from duplicate experiments. D, Detection of CXCL13
protein in the supernatant of PBMC
cultured for 72 h with and without
HMB-PP, in the presence of the cytokines indicated (n ⫽ 6 –9). E,
CXCL13 production by PBMC cultured for 72 h in medium alone or
with HMB-PP plus IL-21 after depletion of ␥␦ T cells, monocytes, or B
cells (n ⫽ 3). F, CXL13 production
by purified ␥␦ T cells in the absence
or presence of monocytes as feeder
cells after 72 h (n ⫽ 4). G, Inhibition
of the IL-21-induced ␥␦ T cell proliferation by IFN-␤. PBMC were cultured for 6 days with HMB-PP plus
IL-2 or HMB-PP plus IL-21 in the
absence or presence of IFN-␤ (n ⫽
3). H, Inhibition of the IL-21-dependent CXCL13 expression by
IFN-␤. PBMC were cultured for
72 h with HMB-PP plus IL-2 or
HMB-PP plus IL-21 in the absence
or presence of IFN-␤ (n ⫽ 5).
HMB-PP plus IL-21 stimulation of purified ␥␦⫹ cells evoked
CXCL13 expression, but much less than by total PBMC, showing
that a trans-effect of accessory cells such as monocytes is likely
required for maximal levels of secretion (Fig. 5F). IFN-␣ and
IFN-␤ (but not IFN-␭1 and IFN-␭2) selectively blocked IL-21driven proliferation and CXCL13 secretion (Fig. 5, G and H, and
data not shown).
The surprising finding that IL-21 induces CXCL13 secretion
and maintains CD62L expression by HMB-PP-activated V␥9/V␦2
T cells strongly suggests that such cells can play a role in lymphoid
follicles and in GC physiology. Although the CXCL13 levels harvested from our cultures were below the sensitivity threshold of
chemotactic assays with tonsillar B cells (data not shown), immunohistochemistry identified CXCL13-producing cells within clusters of ␥␦ T cells in a gut-derived lymphoid follicle (Fig. 6A).
Likewise, HMB-PP/IL-21-stimulated V␥9/V␦2 T cells also secreted abundant CXCR3 ligand, CXCL10/IP-10 (Table I; Fig. 4),
The Journal of Immunology
4311
which is preferentially expressed in the GC compared with the
mantle and marginal zone (36). In this light, the arrays revealed
that IL-21-treated HMB-PP-activated cells differentially expressed several specific genes associated with B cell follicles,
follicular DCs (FDCs), and/or the GC reaction, e.g., TrkA
(M(IL-2 vs IL-21) ⫽ ⫺1.41), DC nuclear protein 1 (DCNP1)
(M ⫽ ⫺0.83), PD-L1 (B7-H1) (M ⫽ ⫺0.81), CXCR6 (M ⫽
⫺0.74) decysin (M ⫽ ⫺0.72), clusterin (M ⫽ ⫺0.68), the adhesion molecule CD226 (DNAM-1) (M ⫽ ⫺0.65), Fc␧RI (M ⫽
⫺0.64), and plexin-B1 (M ⫽ ⫺0.63) (Table I).
Discussion
This study has used the most potent known biological activator of
V␥9/V␦2 T cells, HMB-PP, to provide clear and novel molecular
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 6. A role for ␥␦ T cells in regulating follicular B cell maturation. A, Immunohistochemical analysis of serial sections of an active gut follicle
from a patient with Yersinia ileitis, with ␥␦ T cells and CXCL13, respectively, stained in red. Colocalization of CXCL13-producing cells and ␥␦ T cells
is indicated by arrows. Note that a similar picture of the same section stained for ␥␦ T cells was already published earlier (23), but has been included here
for the sake of optimum comparison. B, Proposed interaction between ␥␦ T cells, B cells, and TFH cells in secondary lymphoid tissue. Expression of CCR7
by naive and central memory ␣␤ T cells permits entry to the LNs, and subsequent colocalization with CCR7⫹ DC in the T zone that is defined by the CCR7
ligands CCL19 and CCL21. T cell priming results in the generation of TFH cells expressing CXCR5, thereby conferring responsiveness to the B zonespecific chemokine CXCL13. After relocalization of TFH cells and CXCR5⫹ B cells to the follicles, mutual interaction through ICOS and CD40 with their
respective ligands induces plasma cell maturation on one hand, and gives rise to effector ␣␤ T cells on the other hand (see also Refs. 2 and 60). Upon
infection with microbial pathogens, peripheral ␥␦ T cells recognize HMB-PP at sites of inflammation and contribute to the local immune response by
secretion of proinflammatory cytokines and chemokines, and lysis of infected cells. Alternatively or additionally, they acquire a LN homing phenotype by
up-regulation of CCR7 and CD62L (Ref. 23 and this study), and HMB-PP released in the periphery may reach local LN through tissue drainage and act
on LN resident ␥␦ T cells. Data presented here show that ␥␦ T cells moving into the GCs will respond to TFH-derived IL-21 by producing CXCL13 and
CXCL10, thus contributing to the molecular definition of the B zone and aiding further recruitment of CXCR5⫹ B cells, TFH cells, and monocytes. HMB-PP
triggered ␥␦ T cells may also directly present microbial Ags to TFH cells at an early stage of infection (65).
4312
IL-21R expression (63), may help maintain the separation between
T and B zones.
IL-4 and IL-21 each induced in HMB-PP-specific V␥9/V␦2 T
cells distinct molecules associated with humoral immunity, suggesting complementary mechanisms of B cell help by activated ␥␦
T cells, that evoke the finding that IL-21R⫺/⫺IL-4R⫺/⫺ double
knockout mice exhibit substantially greater impairment of IgG and
IgE responses than do single knockout strains (17, 64). These data,
combined with the capacity of ␥␦ T cells to provide B cell help in
vitro as potently as do TFH cells (23, 59), justify including follicular B cell responses in the sequelae of infection-driven human ␥␦
T cell activation, as suggested in Fig. 6B. Such activities may
promote B cell responses outside the constraints of MHC restriction, and might be further enhanced by the capacity of V␥9/V␦2 T
cells to present Ag to naive ␣␤ T cells (65), albeit none of the
signatory genes (e.g., CD40, CD80, CD86, and HLA-DR) reportedly expressed on V␥9/V␦2 T-APCs was obviously up-regulated
in IL-4- or IL-21-treated cells.
Although the evidence of pleiotropy among ␥␦ T cells evokes
the increasing evidence for pleiotropy among ␣␤ T cells, the molecular rules may be different. For example, the unusual profile of
a cell population producing IFN-␥, IL-5, and IL-13, but no IL-4,
might result from the expression of T-bet and residual levels of
GATA-3 that we show are expressed in IL-2-treated cells. Nonetheless, it seems a priori surprising that IL-4-stimulated cells fail to
express IL-5 and IL-13 while maintaining high expression of
GATA-3. In sum, the transcriptional control mechanisms for ␥␦
cells need clarifying, especially considering that pharmacological
approaches are being considered to regulate some of the “master”
transcription factors, based almost entirely on data from ␣␤ T
cells. Additionally, an activated T cell that produces IFN-␥, IL-5,
and IL-13 may simultaneously promote eosinophilia, IgE-production, and inflammation, suggesting the prudence of re-examining
the involvement of human ␥␦ T cells in mixed Th1/Th2 pathologies such as asthma.
In sum, our data accentuate the highly pleiotropic nature of human V␥9/V␦2 T cells and show a broad and perhaps unanticipated
plasticity, as the same cell population may readily and rapidly
assume distinct Th1- and Th2-like effector functions, and/or potentially provide B cell help in secondary lymphoid tissues. This
gives great scope for these cells to bridge innate and acquired
immunity in a variety of contexts. The relevance of the in vitro
findings presented here extends to attempts to promote non-MHCrestricted antitumor efficacy by administration of V␥9/V␦2 TCR
agonists such as zoledronate, together with different cytokines and
cofactors (66). Although codelivery of a low dose of IL-2 appears
crucial for optimal cytotoxicity, excessive production of proinflammatory mediators may de facto promote tumor growth in some
scenarios (67). By contrast, the considered use of IL-21 in carcinoma trials (68) might actually diminish the proinflammatory
response.
Acknowledgments
We thank Armin Reichenberg and Martin Hintz for providing HMB-PP;
Donald Foster for IL-21; Patrick Oschmann for Roferon and Rebif; Austin
Gurney for IL-17s; Sergei Kotenko for IFN-␭s; and Hanspeter Pircher for
anti-KLRG1; Wayne Turnbull for the cell sorting; Marina Zafranskaya,
Stefanie Wagner, and Katy Wendt for their vital contribution; Ewald Beck
for his support; and Bernhard Moser, Andrew Roberts, and Dan Pennington for stimulating discussions.
Disclosures
The authors have no financial conflict of interest.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
definitions of the cells’ pleiotropy in vitro. Although there was
existing evidence that murine and human ␥␦ T cells could display
Th1- and Th2-like phenotypes in response to different stimuli (11,
51, 52), the array data and the accompanying validations present
unique features of such polarized responses of human peripheral
blood ␥␦ T cells. As examples, the proinflammatory response to
HMB-PP plus IL-2-mediated stimulation includes IL-5 and IL-13
that conversely are lacking from the Th2-like response of the same
cells to IL-4.
Although the arrays used here do not yet provide full genome
coverage, the data are already sufficient to demonstrate a broader
responsiveness of human ␥␦ T cells than previously reported. The
results seem to parallel the increasing effector/regulatory pleiotropy apparent for CD4⫹ ␣␤ T cells (1, 2). Given their rapid and
expansive responses in the context of ␥c cytokines, HMB-PP-activated ␥␦ T cells may profoundly influence the different functional
responses to qualitatively distinct challenges (3), which has been
termed “transitional immunity.” In this context, the data presented
here identify specific molecules that may facilitate ␥␦ T cell actions, that may prove useful biomarkers for particular types of
immune response, and that may provide a means to regulate particular immune functions.
Among the specific genes identified as differentially expressed
by ␥␦ T cells in the context of different cytokines, the genes associated with B cell help are perhaps some of the most striking.
There have been earlier reports that ␥␦ T cells can help B cells.
Thus, there is a strong association of ␥␦ T cells with GCs in
TCR␣⫺/⫺ and TCR␤⫺/⫺ mice (53, 54), there are tight clusters of
V␥9/V␦2 T cells in human gastrointestinal and mucosa-associated
GC (23), and in mice and humans there is an association of exaggerated ␥␦ T cell activity with high titers of class-switched, selfreactive Abs, independent of MHC-restricted ␣␤ T cells (55, 56).
However, there have heretofore been few clues as to the molecules
that may underpin ␥␦ T cell help of B cells. The present study
provides a set of strong candidates that may now be functionally
interrogated. Besides IL-4 itself (which is a potent B cell growth
and differentiation factor), IL-4-stimulated ␥␦ T cells differentially
expressed CD27 that may facilitate interaction with CD70⫹ cells,
including GC B cells, and/or T cells within and around the GC
(57). Indeed, recent data imply that CD27 expression on T cells as
well as on B cells contributes to GC formation (58). Also upregulated in IL-4-treated cells was B cell maturation protein, which
has been attributed a role in maintaining the survival of long-lived
plasma cells and promoting Ag presentation by B cells.
IL-21 shared with IL-4 the maintenance and/or enhancement of
CD62L expression that, together with the up-regulation of the
lymph node homing receptor CCR7 by activated V␥9/V␦2 T cells
(23), may permit them to enter lymphoid tissue (28), where the
cells’ expression of CXCR3 and/or CXCR5 may promote entry
into follicles (23, 59). In this context, the IL-21-stimulated upregulation of IL-21R suggests that follicle-entering ␥␦ T cells may
remain strongly IL-21-responsive, forming a functional interface
with TFH cells. IL-21-stimulated, HMB-PP- activated ␥␦ T cells
up-regulated CXCL10, implicated in monocyte and lymphocyte
trafficking into follicles (36). Moreover, their high expression of
CXCL13 was unanticipated as CXCL13 was heretofore attributed
primarily to follicular stromal cells, myeloid and plasmacytoid
DC, and TFH cells (60). CXCL13 is an important chemoattractant
to the follicles for CXCR5⫹ cells such as naive B cells and early
activated CD4⫹ T cells but mostly absent from extrafollicular
sites, including the T zones of spleen, LNs, and Peyer’s patches.
Interestingly, type I IFNs are reportedly enriched in the paracortex
over the follicles (61, 62), where conceivably their inhibition of ␥␦
T cell expression of CXCL13 (Fig. 5), perhaps by suppressing
FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS
The Journal of Immunology
4313
References
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
opment of human T helper cells using oligonucleotide arrays. Nat. Genet. 25:
96 –101.
Hamalainen, H., H. Zhou, W. Chou, H. Hashizume, R. Heller, and R. Lahesmaa.
2001. Distinct gene expression profiles of human type 1 and type 2 T helper cells.
Genome Biol. 2: Research 0022.1– 0022.11.
Kovanen, P. E., A. Rosenwald, J. Fu, E. M. Hurt, L. T. Lam, J. M. Giltnane,
G. Wright, L. M. Staudt, and W. J. Leonard. 2003. Analysis of ␥c-family cytokine
target genes: identification of dual-specificity phosphatase 5 (DUSP5) as a regulator of mitogen-activated protein kinase activity in interleukin-2 signaling.
J. Biol. Chem. 278: 5205–5213.
Lund, R., T. Aittokallio, O. Nevalainen, and R. Lahesmaa. 2003. Identification of
novel genes regulated by IL-12, IL-4, or TGF-␤ during the early polarization of
CD4⫹ lymphocytes. J. Immunol. 171: 5328 –5336.
Ismaili, J., V. Olislagers, R. Poupot, J. J. Fournié, and M. Goldman. 2002. Human
␥␦ T cells induce dendritic cell maturation. Clin. Immunol. 103: 296 –302.
Bosco, A., K. L. McKenna, C. J. Devitt, M. J. Firth, P. D. Sly, and P. G. Holt.
2006. Identification of novel Th2-associated genes in T memory responses to
allergens. J. Immunol. 176: 4766 – 4777.
Kim, C. H., H. W. Lim, J. R. Kim, L. Rott, P. Hillsamer, and E. C. Butcher. 2004.
Unique gene expression program of human germinal center T helper cells. Blood
104: 1952–1960.
Rasheed, A. U., H. P. Rahn, F. Sallusto, M. Lipp, and G. Müller. 2006. Follicular
B helper T cell activity is confined to CXCR5hiICOShi CD4 T cells and is independent of CD57 expression. Eur. J. Immunol. 36: 1892–1903.
Shen, Y., J. Iqbal, L. Xiao, R. C. Lynch, A. Rosenwald, L. M. Staudt, S. Sherman,
K. Dybkaer, G. Zhou, J. D. Eudy, et al. 2004. Distinct gene expression profiles
in different B-cell compartments in human peripheral lymphoid organs. BMC
Immunol. 5: 20.
Garnon, J., C. Lachance, S. di Marco, Z. Hel, D. Marion, M. C. Ruiz,
M. M. Newkirk, E. W. Khandjian, and D. Radzioch. 2005. Fragile X-related
protein FXR1P regulates proinflammatory cytokine tumor necrosis factor expression at the post-transcriptional level. J. Biol. Chem. 280: 5750 –5763.
Garcia-Suarez, O., J. Hannestad, I. Esteban, M. Martinez del Valle, F. J. Naves,
and J. A. Vega. 1997. Neurotrophin receptor-like protein immunoreactivity in
human lymph nodes. Anat. Rec. 249: 226 –232.
Maecker, H., E. Varfolomeev, F. Kischkel, D. Lawrence, H. LeBlanc, W. Lee,
S. Hurst, D. Danilenko, J. Li, E. Filvaroff, et al. 2005. TWEAK attenuates the
transition from innate to adaptive immunity. Cell 123: 931–944.
Masuda, M., S. Senju, S. Fujii Si, Y. Terasaki, M. Takeya, S. Hashimoto Si,
K. Matsushima, E. Yumoto, and Y. Nishimura. 2002. Identification and immunocytochemical analysis of DCNP1, a dendritic cell-associated nuclear protein.
Biochem. Biophys. Res. Commun. 290: 1022–1029.
Nishimura, H., M. Nose, H. Hiai, N. Minato, and T. Honjo. 1999. Development
of lupus-like autoimmune diseases by disruption of the PD-1 gene encoding an
ITIM motif-carrying immunoreceptor. Immunity 11: 141–151.
Hase, K., T. Murakami, H. Takatsu, T. Shimaoka, M. Iimura, K. Hamura,
K. Kawano, S. Ohshima, R. Chihara, K. Itoh, et al. 2006. The membrane-bound
chemokine CXCL16 expressed on follicle-associated epithelium and M cells mediates lympho-epithelial interaction in GALT. J. Immunol. 176: 43–51.
Mueller, C. G., I. Cremer, P. E. Paulet, S. Niida, N. Maeda, S. Lebeque,
W. H. Fridman, and C. Sautes-Fridman. 2001. Mannose receptor ligand-positive
cells express the metalloprotease decysin in the B cell follicle. J. Immunol. 167:
5052–5060.
Reid, D. M., M. Montoya, P. R. Taylor, P. Borrow, S. Gordon, G. D. Brown, and
S. Y. Wong. 2004. Expression of the ␤-glucan receptor, Dectin-1, on murine
leukocytes in situ correlates with its function in pathogen recognition and reveals
potential roles in leukocyte interactions. J. Leukocyte Biol. 76: 86 –94.
Yamada, K., M. Yamakawa, Y. Imai, and M. Tsukamoto. 1997. Expression of
cytokine receptors on follicular dendritic cells. Blood 90: 4832– 4841.
Huber, C., C. Thielen, H. Seeger, P. Schwarz, F. Montrasio, M. R. Wilson,
E. Heinen, Y. X. Fu, G. Miele, and A. Aguzzi. 2005. Lymphotoxin-␤ receptordependent genes in lymph node and follicular dendritic cell transcriptomes. J. Immunol. 174: 5526 –5536.
Kumari, D., and K. Usdin. 2001. Interaction of the transcription factors USF1,
USF2, and ␣-Pal/Nrf-1 with the FMR1 promoter: implications for fragile X mental retardation syndrome. J. Biol. Chem. 276: 4357– 4364.
Pende, D., R. Castriconi, P. Romagnani, G. M. Spaggiari, S. Marcenaro,
A. Dondero, E. Lazzeri, L. Lasagni, S. Martini, P. Rivera, et al. 2006. Expression
of the DNAM-1 ligands, Nectin-2 (CD112) and poliovirus receptor (CD155), on
dendritic cells: relevance for natural killer-dendritic cell interaction. Blood 107:
2030 –2036.
Kanowith-Klein, S., F. Hofman, and A. Saxon. 1988. Expression of Fc␧ receptors
and surface and cytoplasmic IgE on human fetal and adult lymphopoietic tissue.
Clin. Immunol. Immunopathol. 48: 214 –224.
Hall, K. T., L. Boumsell, J. L. Schultze, V. A. Boussiotis, D. M. Dorfman,
A. A. Cardoso, A. Bensussan, L. M. Nadler, and G. J. Freeman. 1996. Human
CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation. Proc. Natl. Acad. Sci. USA 93: 11780 –11785.
Ferrick, D. A., M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, and
H. Lepper. 1995. Differential production of interferon-␥ and interleukin-4 in response to Th1- and Th2-stimulating pathogens by ␥␦ T cells in vivo. Nature 373:
255–257.
Wen, L., D. F. Barber, W. Pao, F. S. Wong, M. J. Owen, and A. Hayday. 1998.
Primary ␥␦ cell clones can be defined phenotypically and functionally as Th1/Th2
cells and illustrate the association of CD4 with Th2 differentiation. J. Immunol.
160: 1965–1974.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
1. Stockinger, B., C. Bourgeois, and G. Kassiotis. 2006. CD4⫹ memory T cells:
functional differentiation and homeostasis. Immunol. Rev. 211: 39 – 48.
2. Vinuesa, C. G., S. G. Tangye, B. Moser, and C. R. Mackay. 2005. Follicular B
helper T cells in antibody responses and autoimmunity. Nat. Rev. Immunol. 5:
853– 865.
3. Pennington, D. J., D. Vermijlen, E. L. Wise, S. L. Clarke, R. E. Tigelaar, and
A. C. Hayday. 2005. The integration of conventional and unconventional T cells
that characterizes cell-mediated responses. Adv. Immunol. 87: 27–59.
4. Hayday, A. C. 2000. ␥␦ cells: a right time and a right place for a conserved third
way of protection. Annu. Rev. Immunol. 18: 975–1026.
5. Shires, J., E. Theodoridis, and A. C. Hayday. 2001. Biological insights into
TCR␥␦⫹ and TCR␣␤⫹ intraepithelial lymphocytes provided by serial analysis of
gene expression (SAGE). Immunity 15: 419 – 434.
6. Eberl, M., M. Hintz, A. Reichenberg, A. K. Kollas, J. Wiesner, and H. Jomaa.
2003. Microbial isoprenoid biosynthesis and human ␥␦ T cell activation. FEBS
Lett. 544: 4 –10.
7. Hayday, A., and R. Tigelaar. 2003. Immunoregulation in the tissues by ␥␦ T cells.
Nat. Rev. Immunol. 3: 233–242.
8. Pennington, D. J., B. Silva-Santos, J. Shires, E. Theodoridis, C. Pollitt,
E. L. Wise, R. E. Tigelaar, M. J. Owen, and A. C. Hayday. 2003. The interrelatedness and interdependence of mouse T cell receptor ␥␦⫹ and ␣␤⫹cells. Nat.
Immunol. 4: 991–998.
9. Boullier, S., Y. Poquet, T. Debord, J. J. Fournié, and M. L. Gougeon. 1999.
Regulation by cytokines (IL-12, IL-15, IL-4 and IL-10) of the V␥9V␦2 T cell
response to mycobacterial phosphoantigens in responder and anergic HIV-infected persons. Eur. J. Immunol. 29: 90 –99.
10. Cipriani, B., G. Borsellino, F. Poccia, R. Placido, D. Tramonti, S. Bach,
L. Battistini, and C. F. Brosnan. 2000. Activation of C-C ␤-chemokines in human
peripheral blood ␥␦ T cells by isopentenyl pyrophosphate and regulation by cytokines. Blood 95: 39 – 47.
11. Wesch, D., A. Glatzel, and D. Kabelitz. 2001. Differentiation of resting human
peripheral blood ␥␦ T cells toward Th1- or Th2-phenotype. Cell. Immunol. 212:
110 –117.
12. Eberl, M., R. Engel, E. Beck, and H. Jomaa. 2002. Differentiation of human ␥␦
T cells towards distinct memory phenotypes. Cell. Immunol. 218: 1– 6.
13. Lafont, V., S. Loisel, J. Liautard, S. Dudal, M. Sable-Teychene, J. P. Liautard,
and J. Favero. 2003. Specific signaling pathways triggered by IL-2 in human
V␥9V␦2 T cells: an amalgamation of NK and ␣␤ T cell signaling. J. Immunol.
171: 5225–5232.
14. Leonard, W. J., and R. Spolski. 2005. Interleukin-21: a modulator of lymphoid
proliferation, apoptosis and differentiation. Nat. Rev. Immunol. 5: 688 – 698.
15. Chtanova, T., S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and
C. R. Mackay. 2004. 2004. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide
help for B cells. J. Immunol. 173: 68 –78.
16. Ozaki, K., R. Spolski, R. Ettinger, H. P. Kim, G. Wang, C. F. Qi, P. Hwu,
D. J. Shaffer, S. Akilesh, D. C. Roopenian, et al. 2004. Regulation of B cell
differentiation and plasma cell generation by IL-21, a novel inducer of Blimp-1
and Bcl-6. J. Immunol. 173: 5361–5371.
17. Ozaki, K., R. Spolski, C. G. Feng, C. F. Qi, J. Cheng, A. Sher, H. C. Morse 3rd,
C. Liu, P. L. Schwartzberg, and W. J. Leonard. 2002. A critical role for IL-21 in
regulating immunoglobulin production. Science 298: 1630 –1634.
18. King, C., A. Ilic, K. Koelsch, and N. Sarvetnick. 2004. Homeostatic expansion of
T cells during immune insufficiency generates autoimmunity. Cell 117: 265–277.
19. Vinuesa, C. G., M. C. Cook, C. Angelucci, V. Athanasopoulos, L. Rui,
K. M. Hill, D. Yu, H. Domaschenz, B. Whittle, T. Lambe, et al. 2005. A RINGtype ubiquitin ligase family member required to repress follicular helper T cells
and autoimmunity. Nature 435: 452– 458.
20. Eberl, M., H. Jomaa, and A. C. Hayday. 2004. Integrated immune responses to
infection— cross-talk between human ␥␦ T cells and dendritic cells. Immunology
112: 364 –368.
21. Zhang, Y., Y. Song, F. Yin, E. Broderick, K. Siegel, A. Goddard, E. Nieves,
L. Pasa-Tolic, Y. Tanaka, H. Wang, et al. 2006. Structural studies of V␥2V␦2 T
cell phosphoantigens. Chem. Biol. 13: 985–992.
22. Eberl, M., R. Engel, S. Aberle, P. Fisch, H. Jomaa, and H. Pircher. 2005. Human
V␥9/V␦2 effector memory T cells express the killer cell lectin-like receptor G1
(KLRG1). J. Leukocyte Biol. 77: 67–70.
23. Brandes, M., K. Willimann, A. B. Lang, K. H. Nam, C. Jin, M. B. Brenner,
C. T. Morita, and B. Moser. 2003. Flexible migration program regulates ␥␦ T-cell
involvement in humoral immunity. Blood 102: 3693–3701.
24. Favier, B., E. Espinosa, J. Tabiasco, C. dos Santos, M. Bonneville, S. Valitutti,
and J. J. Fournié. 2003. Uncoupling between immunological synapse formation
and functional outcome in human ␥␦ T lymphocytes. J. Immunol. 171:
5027–5033.
25. Eberl, M., B. Altincicek, A. K. Kollas, S. Sanderbrand, U. Bahr, A. Reichenberg,
E. Beck, D. Foster, J. Wiesner, M. Hintz, and H. Jomaa. 2002. Accumulation of
a potent ␥␦ T-cell stimulator after deletion of the lytB gene in Escherichia coli.
Immunology 106: 200 –211.
26. Hedges, J. F., K. J. Lubick, and M. A. Jutila. 2005. ␥␦ T cells respond directly
to pathogen-associated molecular patterns. J. Immunol. 174: 6045– 6053.
27. Chen, L., M. T. Cencioni, D. F. Angelini, G. Borsellino, L. Battistini, and
C. F. Brosnan. 2005. Transcriptional profiling of ␥␦ T cells identifies a role for
vitamin D in the immunoregulation of the V␥9V␦2 response to phosphate-containing ligands. J. Immunol. 174: 6144 – 6152.
28. Rogge, L., E. Bianchi, M. Biffi, E. Bono, S. Y. Chang, H. Alexander, C. Santini,
G. Ferrari, L. Sinigaglia, M. Seiler, et al. 2000. Transcript imaging of the devel-
4314
61. Toellner, K. M., D. Scheel-Toellner, R. Sprenger, M. Duchrow, L. H. Trumper,
M. Ernst, H. D. Flad, and J. Gerdes. 1995. The human germinal centre cells,
follicular dendritic cells and germinal centre T cells produce B cell-stimulating
cytokines. Cytokine 7: 344 –354.
62. Brackenbury, L. S., B. V. Carr, Z. Stamataki, H. Prentice, E. A. Lefevre,
C. J. Howard, and B. Charleston. 2005. Identification of a cell population that
produces ␣/␤ interferon in vitro and in vivo in response to noncytopathic bovine
viral diarrhea virus. J. Virol. 79: 7738 –7744.
63. Strengell, M., I. Julkunen, and S. Matikainen. 2004. IFN-␣ regulates IL-21 and
IL-21R expression in human NK and T cells. J. Leukocyte Biol. 76: 416 – 422.
64. Wood, N., K. Bourque, D. D. Donaldson, M. Collins, D. Vercelli, S. J. Goldman,
and M. T. Kasaian. 2004. IL-21 effects on human IgE production in response to
IL-4 or IL-13. Cell. Immunol. 231: 133–145.
65. Brandes, M., K. Willimann, and B. Moser. 2005. Professional antigen-presentation function by human ␥␦ T cells. Science 309: 264 –268.
66. Dieli, F., N. Gebbia, F. Poccia, N. Caccamo, C. Montesano, F. Fulfaro, C. Arcara,
M. R. Valerio, S. Meraviglia, C. di Sano, et al. 2003. Induction of ␥␦ T-lymphocyte effector functions by bisphosphonate zoledronic acid in cancer patients in
vivo. Blood 102: 2310 –2311.
67. Girardi, M., E. Glusac, R. B. Filler, S. J. Roberts, I. Propperova, J. Lewis,
R. E. Tigelaar, and A. C. Hayday. 2003. The distinct contributions of murine T
cell receptor (TCR)␥␦⫹ and TCR␣␤⫹ T cells to different stages of chemically
induced skin cancer. J. Exp. Med. 198: 747–755.
68. Curti, B. D. 2006. Immunomodulatory and antitumor effects of interleukin-21 in
patients with renal cell carcinoma. Expert Rev. Anticancer Ther. 6: 905–909.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
53. Wen, L., W. Pao, F. S. Wong, Q. Peng, J. Craft, B. Zheng, G. Kelsoe, L. Dianda,
M. J. Owen, and A. C. Hayday. 1996. Germinal center formation, immunoglobulin class switching, and autoantibody production driven by “non ␣/␤” T cells.
J. Exp. Med. 183: 2271–2282.
54. Pao, W., L. Wen, A. L. Smith, A. Gulbranson-Judge, B. Zheng, G. Kelsoe,
I. C. MacLennan, M. J. Owen, and A. C. Hayday. 1996. ␥␦ T cell help of B cells
is induced by repeated parasitic infection, in the absence of other T cells. Curr.
Biol. 6: 1317–1325.
55. Rajagopalan, S., T. Zordan, G. C. Tsokos, and S. K. Datta. 1990. Pathogenic
anti-DNA autoantibody-inducing T helper cell lines from patients with active
lupus nephritis: isolation of CD4⫺8⫺ T helper cell lines that express the ␥␦ T-cell
antigen receptor. Proc. Natl. Acad. Sci. USA 87: 7020 –7024.
56. Wen, L., S. J. Roberts, J. L. Viney, F. S. Wong, C. Mallick, R. C. Findly, Q. Peng,
J. E. Craft, M. J. Owen, and A. C. Hayday. 1994. Immunoglobulin synthesis and
generalized autoimmunity in mice congenitally deficient in ␣␤⫹ T cells. Nature
369: 654 – 658.
57. Hintzen, R. Q., S. M. Lens, G. Koopman, S. T. Pals, H. Spits, and R. A. van Lier.
1994. CD70 represents the human ligand for CD27. Int. Immunol. 6: 477– 480.
58. Xiao, Y., J. Hendriks, P. Langerak, H. Jacobs, and J. Borst. 2004. CD27 is
acquired by primed B cells at the centroblast stage and promotes germinal center
formation. J. Immunol. 172: 7432–7441.
59. Caccamo, N., L. Battistini, M. Bonneville, F. Poccia, J. J. Fournié, S. Meraviglia,
G. Borsellino, R. A. Kroczek, C. La Mendola, E. Scotet, et al. 2006. CXCR5
identifies a subset of V␥9V␦2 T cells which secrete IL-4 and IL-10 and help B
cells for antibody production. J. Immunol. 177: 5290 –5295.
60. Ebert, L. M., P. Schaerli, and B. Moser. 2005. Chemokine-mediated control of T
cell traffic in lymphoid and peripheral tissues. Mol. Immunol. 42: 799 – 809.
FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS