Download MYCN-mediated overexpression of mitotic spindle regulatory genes

Cancer Letters 331 (2013) 35–45
Contents lists available at SciVerse ScienceDirect
Cancer Letters
journal homepage: www.elsevier.com/locate/canlet
Original Articles
MYCN-mediated overexpression of mitotic spindle regulatory genes
and loss of p53-p21 function jointly support the survival of tetraploid
neuroblastoma cells
Sina Gogolin a, Richa Batra b,1, Nathalie Harder b,1, Volker Ehemann c,1, Tobias Paffhausen a,1,
Nicolle Diessl b,2, Vitaliya Sagulenko a, Axel Benner d, Stephan Gade e, Ingo Nolte f, Karl Rohr b,
Rainer König b, Frank Westermann a,⇑
a
Division of Tumor Genetics, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany
Department of Bioinformatics and Functional Genomics, University of Heidelberg, BIOQUANT, IPMB and German Cancer Research Center (DKFZ), Im Neuenheimer Feld 267,
69120 Heidelberg, Germany
c
Department of Pathology, University of Heidelberg, Im Neuenheimer Feld 224, 69120 Heidelberg, Germany
d
Division of Biostatistics, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 580/581, 69120 Heidelberg, Germany
e
Division of Molecular Genetics, Cancer Genome Research, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany
f
Small Animal Clinic, University of Veterinary Medicine Hannover, Bünteweg 9, 30559 Hannover, Germany
b
a r t i c l e
i n f o
Article history:
Received 25 July 2012
Received in revised form 5 November 2012
Accepted 8 November 2012
Keywords:
p53
pRB
Genomic instability
Mitotic catastrophe
Aneuploidy specific lethality genes
a b s t r a c t
High-risk neuroblastomas often harbor structural chromosomal alterations, including amplified MYCN,
and usually have a near-di/tetraploid DNA index, but the mechanisms creating tetraploidy remain
unclear. Gene-expression analyses revealed that certain MYCN/MYC and p53/pRB-E2F target genes, especially regulating mitotic processes, are strongly expressed in near-di/tetraploid neuroblastomas. Using a
functional RNAi screening approach and live-cell imaging, we identified a group of genes, including
MAD2L1, which after knockdown induced mitotic-linked cell death in MYCN-amplified and TP53-mutated
neuroblastoma cells. We found that MYCN/MYC-mediated overactivation of the metaphase–anaphase
checkpoint synergizes with loss of p53-p21 function to prevent arrest or apoptosis of tetraploid neuroblastoma cells.
Ó 2012 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
Aneuploidy and chromosomal instability are hallmarks of most
if not all cancers and play an essential role in tumor formation and
progression [1]. Neuroblastoma, the most common solid extracranial tumor in early childhood, is characterized by contrasting clinical courses, ranging from low-risk to high-risk disease. To adjust
therapy and improve prognosis, markers have been identified, such
as loss of chromosome arm 1p/11q or MYCN amplification, that are
associated with an aggressive disease and poor overall survival [2–
5]. Several studies have further shown an association of tumor
ploidy and outcome in neuroblastoma [6–9]. Thus, near-diploid
⇑ Corresponding author. Tel.: +49 (0) 6221 423275; fax: +49 (0) 6221 423277.
E-mail address: [email protected] (F. Westermann).
These authors are contributed equally.
Current address: Department of Genomics and Proteomics Core Facility, High
Throughput Sequencing, German Cancer Research Center (DKFZ), Im Neuenheimer
Feld 580, 69120 Heidelberg, Germany.
1
2
0304-3835/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.canlet.2012.11.028
and near-tetraploid neuroblastomas are associated with poor outcome, whereas near-triploid/near-pentaploid tumors are associated with low-risk disease and may even undergo spontaneous
maturation or regression [10,11]. Near-triploid/near-pentaploid
neuroblastomas lack structural chromosomal alterations, whereas
near-diploid and near-tetraploid neuroblastomas are frequently
associated with structural chromosomal alterations, suggesting
that numerical, whole-chromosome aneuploidy and ploidy
changes associated with chromosomal instability may arise from
at least two different mechanisms.
To date, several models have been proposed about how aneuploidy might arise in cancer. One extensively investigated mechanism in recent years is the development of aneuploidy through a
tetraploid genetically unstable intermediate [12,13]. An association between unscheduled tetraploidy, cell transformation and tumor formation has been shown at least in mice [14]. The
appearance of tetraploid cells is characteristic especially for the
pre-malignant condition Barrett’s esophagus [15] and early stages
of cervical carcinogenesis [16] but can also be detected in several
36
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
other cancers independent of the tumor stage [17]. Tetraploidy can
arise via cell fusion, cytokinesis failure, endoreduplication or mitotic slippage. Prolonged activation of the metaphase–anaphase
checkpoint resulting from overexpressed metaphase–anaphase
checkpoint genes, such as Mad2 [18], has been shown to provoke
mitotic slippage associated with incomplete cytokinesis resulting
in tetraploidization [19]. The main function of the metaphase–anaphase checkpoint is to inhibit the anaphase-promoting complex or
cyclosome (APC/C) until the spindles have properly attached to all
kinetochores, thereby preventing chromosome mis-segregation.
Only one unattached kinetochore is sufficient to stop anaphase
by Mad2 activation, which subsequently forms complexes with
Cdc20, BubR1 and Bub3. These complexes prevent APC/C-mediated
ubiquitylation of securin and, consequentially, separase-mediated
cohesin degradation [20]. Deregulation of mitotic checkpoint
genes, including MAD2L1, either by overexpression, reduced
expression or mutation has been reported for many cancers,
including neuroblastoma [1,21,22].
Recently, it has been suggested that overactivation of the metaphase–anaphase checkpoint might trigger aneuploidy induction in
cells with a defective G1-S arrest as a consequence of non-functional pRB and p53-p21 [23]. Both the p53-p21 and pRB axes are
deregulated especially in relapse neuroblastomas and tumor-derived cell lines through genetic aberrations that include TP53
mutation and/or amplification of MDM2, CDK4 or CCND1 [24–26].
Furthermore, MYCN impairs the p53-p21 and pRB pathway
through transcriptional inhibition of p21 and upregulation of
MDM2 and CDK4, which are direct p53 and pRB inhibitors, respectively [27–30]. An association between tetraploidy and loss of p53
function has been described for Barrett’s esophagus [31] and, more
recently, for medulloblastoma [32]. Whether impaired p53-p21/
pRB-mediated checkpoints might further contribute to tetraploidy
in neuroblastoma cells and whether deregulation of the metaphase–anaphase checkpoint contributes to the development of
aneuploidy in neuroblastomas has not been investigated to date.
To address both points, we analyzed the expression of MYCN/
MYC, p53 and pRB-E2F target genes, which are primarily involved
in cell cycle regulation or neuronal differentiation, in association
with tumor DNA index and structural chromosomal aberrations
in a large cohort of primary neuroblastomas. We then used a functional siRNA screening approach combined with a live-cell imaging
microscopy-based readout in two neuroblastoma cell lines with
either low MYCN expression and functional p53 or amplified MYCN
and mutated TP53 to determine the consequences of metaphase–
anaphase checkpoint gene repression.
2. Material and methods
2.1. Tumor samples
Clinical data and tumor samples from 483 patients enrolled in the German Neuroblastoma Trial and diagnosed between 1998 and 2010 were used in this study.
Informed consent was collected within the trial protocol.
2.2. Cell culture
Cell lines were maintained at 37 °C and 5% CO2 DMEM (SK-N-BE(2)-C) or RPMI
(SH-EP and WAC2 [33,34]) supplemented with 10% FCS. SH-EP and SK-N-BE(2)-C
were stably transfected with the H2B-GFP expression vector using Lipofectamine
2000 (Invitrogen Ltd., Paisley, UK) as previously described [35], and were maintained in DMEM supplemented with 10% FCS and 1.5 mg/ml G418. SH-EP-MYCN
(TET21 N) cells stably expressing a tetracycline-regulatable MYCN transgene and a
p21CIP1 shRNA were cultured and induced as previously described [29,36].
2.3. Ploidy and cell cycle analysis
Native cryo-conserved tumor samples were minced with scissors in 2.1% citric
acid/0.5% Tween-20 [37,38]. Phosphate buffer (7.2 g Na2HPO4 2H2O in 100 ml distilled water, pH 8.0) containing 50 lg/ml 2,4 diamino-2-phenylindole (DAPI) was
used to stain DNA. High resolution flow cytometric analyses were performed on
the Galaxy pro flow cytometer (Partec, Münster, Germany) equipped with a mercury vapor lamp 100 W and DAPI filter. Data was acquired in the FCS-mode and histogram analyses were generated using the Multicycle program (Phoenix Flow
Systems, San Diego, CA). Each histogram included 30,000–100,000 cells to calculate
the DNA index and for cell cycle analysis. Human lymphocytes from healthy donors
were used as an internal standard to calibrate the diploid DNA index. The mean
coefficient of variation for diploid lymphocytes was 0.9. For cell cycle analysis, cells
were plated in 75 cm2 flasks, and 24 h later induced with doxycycline and/or treated with vincristine or doxorubicin.
2.4. Reverse transfection on cell arrays
Two different siRNAs (Ambion, Austin, Texas, USA) were used for knockdown of
G2/M regulatory genes chosen from the microarray analysis [28]. Two control siRNAs (Ambion) and mock-transfection were used as negative controls. Transfection
mixtures were prepared and one-chamber LabTeks (#155361, Thermo scientific
nunc, Langenselbold, Germany) were spotted using an automated system in duplicates for each siRNA and dried as previously described [39]. To create cell array,
60,000 SH-EP/H2B-GFP or 100,000 SK-N-BE(2)-C/H2B-GFP were seeded per chamber and incubated with 1.5 ml growth medium at 37 °C and 5% CO2. The experiment
was repeated four times for each cell line.
2.5. Image acquisition, image analysis
Live-cell imaging was performed 16 h after transfection for 5 days at an acquisition rate of 35–40 min using an automated wide-field fluorescence microscope
with 10 magnification as previously described [39]. Automatic segmentation
and tracking was performed for all images, and mitotic events were detected using
morphological features [40]. Images of cell nuclei were classified into interphase
(round/elliptical nuclei with smooth boundaries), apoptotic (small bright nuclear
fragments), mitotic (prometaphase, metaphase or anaphase nuclei) or clusters
(two or more nuclei grouped too closely to be identified as separate objects) using
Support Vector Machines (SVMs) in R with package e1071. Nuclei classified as artifacts (very low contrast) were discarded. The classification protocol was optimized
for both neuroblastoma cell lines, where the performance of the classifier was manually evaluated. Classification errors were automatically corrected by checking the
computed class sequences along the respective trajectories regarding their biological validity using a state transition model. The average classification accuracy for
SH-EP and SK-N-BE(2)-C nuclei were 90% and 79%, respectively. Automatic error
correction was only applied for SH-EP nuclei, since the tracking result for SK-NBE(2)-C nuclei was less reliable due to frequent unresolvable cell clusters.
2.6. Quantitative analysis of classified images
The classified time series were further processed to identify the consequences
of gene knockdown and to cluster genes with similar phenotype profiles. Our quantitative analysis included the following steps: (1) An adapted Z-Score normalization
was performed as described elsewhere [41] for each cell array, time point and phenotype class to account for edge effects and other spatial errors on the cell arrays.
(2) The time series for each gene was integrated in overlapping time windows for
each well and phenotype class, yielding 13 time windows per 120 h of imaging with
a single time window spanning 24 h including an 8 h overlap with the previous
time window. The integrated time series of each time window was designated
the ‘‘phenotype signal’’ for that time window. (3) The phenotype signals for each
gene (four replicates using two siRNA constructs per gene) were compared to the
phenotype signals to the phenotype signals of all other genes assayed using the
Wilcoxon rank-sum test to determine if the gene phenotype was higher or lower
than the overall population (significant if p-value 60.05). (4) For each gene, a ‘‘phenotype signature’’ was defined by the time window with the lowest p-value as computed above, and the first time window with a significant p-value. The ‘‘phenotype
signature’’ included all phenotype classes (interphase, apoptosis, mitosis). (5) For
further analysis, we only considered genes, which exhibited higher cell death, higher mitotic index and lower interphase counts than the overall population. (6) Genes
were clustered into ‘‘phenoclusters’’ based on their phenotype signatures. Euclidean
distances were computed, as similarity measure, for phenotype signatures of all
pairs of genes. Using this similarity measure, hierarchical clustering of genes was
performed using the R software package pvclust.
2.7. RNA interference
WAC2 (SH-EPMYCN) or parental SH-EP cells were stably transfected with the
doxycycline-inducible pcDNA6TR repressor following the manufacturer’s protocol
(Invitrogen). Specific shRNA fragments targeting MAD2L1 (AATACGGACTCACCTTGCTTG, Gen BankTM accession number NM_002358) or, as control, SCRAMBLE (AACAGTCGCGTTTGCGACTGG, Ambion) were cloned into the pTER+vector [42].
WAC2pcDNA6TR or SH-EPpcDNA6TR cells were stably transfected with the pTER+
vector harboring shMAD2L1 or shSCRAMBLE using Effectene (QIAGEN, Hilden, Germany). Zeocin-resistant clones were cultured in RPMI supplemented with 10%
37
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
FCS, and selected for with 7.5 lg/ml blasticidine and 50 lg/ml zeocin. WAC2shMAD2L1 or SH-EP-shMAD2L1 clones were assayed for efficient MAD2L1 downregulation (western blotting upon doxycycline addition (100 nM)).
not be rejected. (2) Implement a binary split in the DNA index. (3) Recursively repeate steps (1) and (2). For a general description of the methodology see Hothorn
et al. [50].
2.8. Protein expression
2.14. Gene expression analysis
Whole cell lysates were prepared as previously described [43]. 50 lg of protein
lysate was separated per lane on 12% SDS–PAGE. Blots were probed with antibodies
directed against hMAD2 (1:2000; #610679, BD Biosciences, Franklin Lakes, NJ,
USA), MYCN (1:1000; #sc-53993, Santa Cruz, CA, USA) and b-actin (1:5000;
#A5441, Sigma–Aldrich, St. Louis, Missouri, USA). HSR–peroxidase labeled antimouse antibody (1:1000; #115-035-003, Dianova, Hamburg, Germany) was used
as secondary antibody. Proteins were visualized using the ECL detection system
(Amersham/GE Healthcare, Freiburg, Germany) and a chemiluminescence reader
(VILBER Eberhardzell, Germany).
Differential expression of the 144 oligonucleotide probes from a previously
published gene expression-based classifier [47] was assessed for primary neuroblastomas from 133 patients out of the whole patient cohort and used for two-way
hierarchical cluster analysis as previously described [28].
3. Results
3.1. Tumor DNA index cut-off points 1.11 and 1.77 separate
neuroblastoma patients with different outcomes
2.9. Fluorescence in situ hybridization (FISH)
2.10. Indirect immunofluorescence microscopy
Cells were washed in PBS, then fixed in ice-cold methanol/acetone (1:1) onto
microscope slides for 7 min. Fixed cells were then directly used for indirect immunofluorescence microscopy or stored at 20 °C. Following fixation cells were
blocked in PBS-GSA (136.9 mM NaCL, 2.68 mM KCL, 0.01 M Na2HPO4, 1.76 mM KH2PO4, pH 7.4, 1% GSA) for 30 min, then incubated with primary human anti-centromere antibodies (CREST, 1:20) [46] in PBS-GSA for 60 min at ambient temperature
in a humidified chamber. Slides were washed several times with PBS, incubated
with a species-specific fluorescent secondary antibody (Alexa Fluor 488 mouse
anti-human, 1:1000; Molecular Probes Invitrogen) for 30 min at ambient temperature, then washed several more times with PBS, once with distilled H2O and once
with 100% ETOH. Slides were counterstained for 2 min with DAPI (0.25 lg/ml ddH2O; Sigma–Aldrich) and mounted in VECTASHIELD (Vector Laboratories, Inc., Burlingame, CA, USA). Immunofluorescence images were collected using a Zeiss ImagerZ.1
microscope and the Isis Metasystems, Version 5.0 software (MetaSystems, Altlussheim, Germany).
2.11. Pharmacological inhibition
Cell cultures were treated with 0.1 lg/ml doxorubicin (TOC-2252-M010, Biozol
Eching, Germany) and 0.05 lM vincristine (BML-T117-0005, Alexis Biochemicals,
Lörrach, Germany), where indicated.
To test the association of tumor ploidy with clinical and genetic
markers, we analyzed the DNA indices of 483 primary tumors from
patients enrolled in the German Neuroblastoma Trial (Supplementary Table 1) using flow cytometry. The frequency of tumor DNA
indices peaked primarily at 1.0 and 1.5, and to a lesser extent at
2.0 and 2.5 (Fig. 1), which each defined tumor subtypes in the
near-diploid, near-triploid, near-tetraploid and near-pentaploid
range, respectively. We further analyzed the biological relevance
of these subtypes by assessing their correlation with clinical outcome. A maximally selected log-rank statistic was used to analyze
the relationship between overall survival and tumor DNA index.
Using all 483 cases, we identified a DNA index cut-off value of
1.11 (maximally selected log-rank statistics, p < 0.001, Fig. 1) that
separates two patient subgroups with significantly different outcome. Intriguingly, a second DNA index cut-off value at 1.77 was
identified, when all near-diploid tumors with a DNA index 6 1.11
were excluded from the analysis (maximally selected log-rank statistics, p < 0.001, Supplementary Fig. 1), indicating that the group
of aneuploid tumors (DNA index > 1.11) consists of at least two distinct subtypes associated with significantly different patient outcomes. Using maximally selected log-rank statistics, we did not
find a third DNA index cut-off value that further separates the tumors in the higher aneuploid range (>1.77). We also applied classification and regression trees to evaluate the functional
dependency between the tumor cell DNA index and overall survival (Supplementary Fig. 2A). This confirmed the two DNA index
40
Centromeric regions of chromosomes 3, 6, 8 and 18 were localized with fluorescently labeled plasmids (chromosome 3: pAE0.68 – Cy3 (GE Healthcare), chromosome 6: pEDZ6 – Cy3.5, chromosome 8: pZ8.4 – FITC (Molecular Probes, Eugene,
Oregon, USA), and chromosome 18: 2Xba – DEAC (Molecular Probes)) as previously
described [44], and 4-color FISH analysis was performed as previously described
[45]. Images were analyzed using a Zeiss axiophot microscope and IPLap 10
software.
6
2.12. GO term enrichment/cluster analysis
4
20
3
Frequency
30
5
p=0.05
10
2
1
2.13. Statistics
0
0
To identify a model describing the relationship between survival and tumor cell
DNA index (tumor cell ploidy), the functional form of this relationship was tested
by maximally selected log-rank statistics as previously described [49]. Statistical
analyses were conducted using the R software package, version 2.12.1.
We also applied classification and regression trees to evaluate the functional
dependency between the tumor cell DNA index (tumor cell ploidy) and age, stage,
MYCN amplification and overall survival. Conditional inference trees were used to
estimate the regression relationship by binary recursive partitioning in a conditional inference framework. At each node of the tree multiplicity-adjusted
Monte-Carlo tests were applied using 10,000 random permutations. In order to split
a node the p-value of the corresponding Monte-Carlo test had to be smaller than
alpha = 5%. The algorithm works as follows: (1) Test the global null hypothesis of
independence between the DNA index and the response. Stop if this hypothesis can-
Standardized log-rank statistic
Oligo sequences of 144 probes from the custom Agilent gene expression array
[47] were mapped to the current version of the human genome (Genome Reference
Consortium GRCh37) using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). A total
of 123 probes had mapped perfect matches to confirmed transcripts. Gene ontology
(GO) term enrichment and annotation cluster analysis was performed using the DAVID Bioinformatics Database 6.7 [48]. The transcript IDs mapped to 115 unique DAVID IDs. GO terms were enriched with an ease score <0.001. The ‘‘highest’’stringency settings were chosen to generate functional groups with tightly associating genes for annotation cluster analysis.
1.11
1.0
1.5
1.77
2.11
2.0
2.5
3.0
DNA index
Fig. 1. Tumor near-di/tetraploidy correlates with poor outcome in neuroblastoma
patients. Overlay of a maximally selected log-rank statistic of overall survival and a
histogram of the DNA indices of 483 neuroblastomas. The DNA index cut-off points,
1.11 (⁄P = 1.155e 07) and 1.77, separate neuroblastoma patient subgroups with
significantly different outcome. Tumors with DNA indices between 1.0 and 1.11 and
between 1.77 and 2.11 (near-di/tetraploidy) were correlated with unfavorable
patient outcome. Tumors with DNA indices between 1.11 and 1.77 or >2.11 (neartri/pentaploidy) were correlated with favorable patient outcome.
38
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
cut-off values at 1.11 and 1.77 (p = 0.039 and p = 0.004, respectively) and revealed a third DNA index cut-off value at 2.11
(p = 0.032). Together, these analyses defined patients with favorable outcomes as having near-triploid tumors (57%) with DNA
indices between 1.11 and 1.77 or near-pentaploid (>2.11) tumors
(4%) and patients with poor outcomes as having near-diploid tumors (28%) with DNA indices between 1.0 and 1.11 or near-tetraploid tumors with DNA indices between 1.77 and 2.11 tumors
(11%) (Fig. 1). Furthermore, we evaluated a functional dependency
between the DNA index cut-off values and the clinical or genetic
markers, MYCN status, age at diagnosis >1.5 years, and stage 4,
showing a significant association of these markers of unfavorable
biology with near-di/tetraploidy subtypes (Supplementary
Fig. 2B–D, Table 1). This supports not only that tumor DNA index
is a prognostic marker for neuroblastoma patients, but also suggests that at least two distinct modes of mitotic failure result in
either near-di/tetraploid or near-tri/pentaploid neuroblastomas.
3.2. Mitotic regulatory genes are overexpressed in neuroblastomas
with unfavorable biology
Oncogenic mutations in pathways (e.g. MYC, pRB, p53) that regulate genomic stability may trigger aneuploidy and chromosomal
instability through the activation of transcriptional programs
[51]. However, aneuploidy itself may induce transcriptional responses because aneuploid cells need to develop specific adaptations in order to proliferate with their altered genomes. To get
insights into transcriptional changes associated with near-di/tetraploid and/or near-tri/pentaploid neuroblastomas, we analyzed
gene expression profiles from our primary neuroblastoma cohort
for expression of the 144 genes in a previously published gene
expression-based classifier that distinguishes high- from low-risk
neuroblastomas [47] and is enriched with MYCN/MYC target genes
and p53/pRB-E2F-regulatory genes [28,52]. Signature expression
profiles from 133 primary neuroblastomas from our patient cohort
were analyzed using a two-way hierarchical cluster analysis.
Expression of the 144-gene signature classified these 133 patients
into four distinct subgroups that were enriched with either neardi/tetraploid or near-tri/pentaploid tumors: Group I patients were
<1.5 years of age at diagnosis, had tumors with favorable prognostic markers, including tumor stage 1 or 2, near-tri/pentaploidy,
normal MYCN status and normal chromosome 1p/11q status, and
a favorable outcome. Patients in group II had tumors that were
characterized by near-di/tetraploidy, amplified MYCN, deletion or
imbalance of chromosome arm 1p and poor outcome. Group III patients had near-di/tetraploid, single-copy MYCN tumors with deletion or imbalance of chromosome arm 11q. Tumors from groups II
and III patients had similar expression profiles of the 144-gene
classifier with strong expression of direct MYCN/MYC and p53/
pRB-E2F target genes and low expression of neuronal differentiation genes. Gene expression profiles from group I tumors were reversed, with low expression of MYCN/MYC and p53/pRB-E2F target
genes and strong neuronal differentiation gene expressions. Patients in group IV had tumors that were characterized by favorable
clinical markers, near-tri/pentaploidy, normal 1p or 11q and normal MYCN status as well as favorable outcome, but presented an
intermediate phenotype between groups I and II/III regarding the
expression of the 144 genes of the gene expression-based classifier.
Expression levels of neuronal differentiation genes were similar to
tumors in group I, whereas expression of p53/pRB-E2F target genes
were similar to group II/III tumors, and MYCN/MYC target gene
expression was lower than in group II/III tumors (Fig. 2 and Supplementary Table 2).
We classified the genes making up the 144-gene expression
classifier according to their biological function using Gene Ontology (GO) term enrichment, then used annotation cluster analysis
to create larger functionally descriptive groups using the DAVID
Bioinformatics Database. Most genes in the 144-gene classifier
are involved in chromosome segregation, spindle organization,
microtubule-based processes, nuclear division or DNA replication.
These could be clustered together into one main group regulating
mitosis. A small subset of genes was involved in processes necessary for DNA repair and to respond to DNA damaging stimuli.
Annotation cluster analysis of significantly enriched cellular components showed that genes in the classifier were assigned functions associated with the kinetochore or centromeric region
(Supplementary Table 3). Both, results of the gene expression
and GO term enrichment analyses revealed that near-di/tetraploid
neuroblastomas possess functional expression signatures associated with mitotic checkpoint activation, which argues in favor of
a MYCN/MYC-induced mitotic stress response and checkpoint activation via suppressed p53 and pRB functionality in these tumors.
In contrast, near-tri/pentaploid neuroblastomas showed low
MYCN/MYC target gene activation and retained neuronal differentiation signatures. However, mitotic checkpoint activation controlled by p53 and pRB was variable (low in group I versus high
in group IV), which could argue for a weakening of p53 and pRB
functionality at least in a subset of favorable near-tri/pentaploid
tumors.
3.3. Loss of p53-p21 function is associated with tetraploidization in
neuroblastoma cells
Similar to the metaphase–anaphase checkpoint, the p53-p21
axis has an important role in limiting the expansion of aneuploid
human cells. Loss of p53-p21 has been shown to result in cycling
Table 1
Correlation of tumor ploidy and prognostic markers.
Tumor ploidy
Near-tri/pentaploidy (favorable)
Fisher’s exact test
Age in years
<1.5
P1.5
76
113
204
90
<0.001
Stagea
1, 2, 3, 4s
4
86
103
240
54
<0.001
Amplified MYCN
No
Yes
126
63
276
18
<0.001
88
86
220
52
<0.001
1p Deletion/imbalance
No
Yes
a
P
Near-di/tetraploidy (unfavorable)
INSS = International Neuroblastoma Staging System.
39
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
Outcome
MYCN
group I
group II
group III
group IV
Neuronal differentiation (e.g. NTRK1, CAMTA1) MYCN/
MYC
p53/pRB-E2F
1p Status
11q Status
Ploidy
Age
Stage
133 patients
p53/pRB-E2F target genes Array probe
A _23_P 415443
A _23_P 88331
A _32_P 62997
A _24_P 323598
A _23_P 138507
A _23_P 51085
A _23_P 115872
A _23_P 65757
A _24_P 297539
A _23_P 74349
A _23_P 7636
A _23_P 48669
A _23_P 104651
A _23_P 107421
A _23_P 49972
A _23_P 50096
A _23_P 28886
A _24_P 234196
A _23_P 401
A _24_P 96780
A _23_P 23303
A _23_P 10385
A _24_P 53519
A _23_P 254733
Hs8 7 5 0 7 .1
A _23_P 155765
A _23_P 131866
A _23_P 96325
A _24_P 413884
A _23_P 323751
A _23_P 122197
Hs2 3 9 6 0 .1
A _32_P 151800
A _23_P 71727
Hs7 9 0 7 8 .1 0
A _23_P 92441
A _23_P 133123
A _23_P 252740
A _23_P 87351
A _23_P 18196
Hs4 2 2 7 8 9 .1
A _23_P 373119
A _23_P 90612
Hs1 5 5 4 6 2 .1
A _23_P 88740
Hs2 4 7 6 3 .1
A _23_P 36076
A _23_P 35219
A _23_P 122 443
Gene sym bol
B RRN1
D LG7
PBK
ESC O2
CDC2
S p c2 5
C 1 0 o rf3
C C NB 2
UB E 2 C
CDCA1
P TTG 1
C D K N3
CDCA5
TK 1
CDC6
TYM S
P C NA
RRM 2
C E NP F
C E NP F
EXO1
RA M P
C HA F 1 A
M L F 1 IP
B RIP 1
HM G B 2
S TK 6
F L J2 0 1 0 5
C E NP A
C 2 0 o rf1 2 9
C C NB 1
C C NB 1
MGC 57827
CKS2
MA D 2L1
MA D 2L1
GAJ
DCC1
RRM 1
RF C 4
V RK 1
HM G 4 L
MCM6
MCM6
B M039
RA NB P 1
S S RP 1
NE K 2
HIS T1 H1 C
MYCN/MYC target genes Array probe
A _23_P 41280
A _23_P 21033
A _23_P 143958
A _23_P 17575
A _24_P 57367
A _23_P 114232
A _24_P 182182
A _32_P 98348
A _23_P 217609
A _23_P 126291
A _23_P 18422
A _23_P 78888
A _23_P 200507
Hs5 5 4 2 4 .1
A _23_P 58280
A _32_P 73903
Gene sym bol
P A IC S
GMPS
LOC 200916
A HC Y
A HC Y
P RD X 4
S LC 25A 5
ZNF 5 2 5
RP L 3 6 A
S NRP E
M RP L 3
FBL
HS P C 1 6 3
F L J1 0 1 5 1
NO L A 1
B X 119435
Fig. 2. Mitosis regulatory genes are strongly expressed targets of MYCN/MYC and p53/pRB-E2F signaling in unfavorable neuroblastomas. Two-way hierarchical cluster
analysis of the 144 genes in the previously published gene expression-based classifier in 133 primary neuroblastomas (blue = high expression, green = low expression). The
clinical covariates, patient outcome (black = death from disease, grey = progression/relapse, white = no event), MYCN status (black = amplified, white = non-amplified),
chromosome arm 1p or 11q status (black = deletion/imbalance, grey = not defined, white = normal), ploidy (black = near-di/tetraploidy, white = near-tri/pentaploidy), age at
diagnosis (white <1.5 years, black P1.5 years) and tumor stage using the International Neuroblastoma Staging System (black = 4, grey = 3, white = 1 or 2, yellow = 4s), were
added to the gene expression heatmap. Patients were classified into four groups (I-IV). The gene expression cluster of direct MYCN/MYC and p53/pRB-E2F target genes is
highlighted. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
4 N cells that underwent endoreduplication [53,54]. To investigate
whether loss of p53-p21 function favors the propagation of viable
tetraploid neuroblastoma cells, we analyzed the DNA index of SK-
N-BE(2)-C cells, which harbor both amplified MYCN and mutated
TP53. These cells are characterized by an impaired p53-p21/pRBmediated G1 arrest and low levels of apoptosis upon irradation-in-
40
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
duced DNA damage [55] and resistance to various chemotherapeutic drugs [56]. Flow cytometric analysis identified both diploid and
tetraploid cell clones in SK-N-BE(2)-C cell cultures. The tetraploid
cell clone expanded from 16% to 90% within nine rounds of passaging. DNA damage prior mitosis may increase tetraploidy in cells
with impaired cell cycle checkpoints as a consequence of non-functional p53-p21 signaling [57]. Treatment of SK-N-BE(2)-C cultures
with the DNA damage-inducing drug, doxorubicin, expanded the
tetraploid fraction to 80% in only four rounds of passaging, and
created an entirely tetraploid cell culture by passage 18. The diploid fraction was reduced accordingly in each passage after doxorubicin treatment (Table 2). To test the consequence of p21
inhibition at varying levels of MYCN on tumor cell ploidy, we used
the SH-EP-MYCN cell model, which stably express a tetracyclineregulatable MYCN transgene allowing MYCN induction by removal
of tetracycline from the culture medium [36]. Targeted MYCN
expression in these cells caused a transient down-regulation of
p21, which was compensated for over time (24 h) through p53
induction by MYCN [29]. To further abrogate p21 levels, we stably
transfected SH-EP-MYCN cells with a shRNA targeting p21CIP1, or
with scrambled shRNA as a control. Expression of the p21 protein
was consistently reduced to <10% whether MYCN was induced or
not in SH-EP-MYCN cells stably expressing p21CIP1 shRNA compared to the control cells (Supplementary Fig. 3). Repression of
p21CIP1 by shRNA resulted in tetraploidization of about 30% of
SH-EP-MYCN cells. Provoking DNA damage by using doxorubicin
treatment increased the tetraploid fraction to 76%, similar to
SK-N-BE(2)-C cells (Table 2), while targeted MYCN induction in
SH-EP-MYCN cells expressing scrambled shRNA control did not induce tetraploidization (Supplementary Fig. 4). Furthermore, enhanced MYCN expression did not significantly further increase
tetraploidization after shRNA-mediated p21 repression. These results indicate that an impaired p53-p21 axis is involved in tetraploidization of neuroblastoma cells, whereas transcriptional
repression of p21CIP1 by targeted MYCN induction is insufficient
to induce tetraploidization at least in MYCN-single-copy neuroblastoma cells.
3.4. Selective inhibition of mitotic checkpoint genes causes mitoticlinked cell death in MYCN-amplified and TP53-mutated
neuroblastoma cells
Mitotic regulatory genes are overexpressed in unfavorable neuroblastomas with suppressed p53 and pRB functionality. To test
whether an overactivated metaphase–anaphase checkpoint supports the survival of cells lacking functional p53-p21 signaling,
we performed a functional siRNA screen targeting mitotic regulatory genes controlled by MYCN/MYC and p53/pRB-E2F. We focused
on a set of 240 genes with significantly higher expression in neu-
roblastomas with unfavorable than favorable biology, which included
those
in
the
144
gene-expression
classifier
(Supplementary Table 4). Each candidate gene was silenced using
two different small interfering siRNAs. Two unrelated scrambled
siRNAs were used as negative controls. Screening was performed
in two neuroblastoma cell lines with different MYCN and TP53 genetic backgrounds stably expressing the H2B-GFP fluorescent chromatin marker to allow live-cell imaging microscopy-based
readout. SH-EP were used as the control since they harbor singlecopy MYCN and wild-type TP53. SK-N-BE(2)-C harbor both amplified MYCN and mutated TP53. Cells were classified as being in
interphase, mitosis or apoptosis during a 5-day culture period
using 24-h time windows with an 8-h overlap to the previous time
window. Genes were then clustered depending on the specific
RNAi-mediated knockdown phenotype, which were defined as follows: (1) interphase arrest, (2) mitotic arrest, (3) primary apoptosis, (4) mitotic-linked cell death (secondary apoptosis out of
mitotic arrest) and (5) mitotic slippage followed by interphase arrest and/or cell death (Fig. 3). Knockdown of 108 out of 240 genes
significantly induced a phenotype in both cell lines, while knockdown of 56 and 39 genes induced a phenotype in only SK-NBE(2)-C or SH-EP cells, respectively. Mitotic-linked cell death was
induced in SK-N-BE(2)-C cells via knockdown of a group of seven
genes that included MAD2L1, ANLN, NCD80, RAD51, DPH5, ECSIT
and SLC1A5, which are associated with metaphase–anaphase
checkpoint regulation, mitotic exit or DNA repair [58–61]. Knockdown of any of these genes except RAD51 induced mitotic or interphase arrest in SH-EP cells instead of mitotic-linked cell death
(Fig. 3). These results indicate that functional p53 compensates
for a non-functional metaphase–anaphase checkpoint. In line with
this, TP53 knockdown in SH-EP cells resulted in mitotic-linked cell
death (Fig. 3, blue box). These results demonstrate that deregulating distinct genes downstream of p53/pRB-E2F at the mitotic
checkpoint, and probably downstream of high MYCN activity, support the survival of MYCN-amplified neuroblastoma cells during
mitotic arrest and checkpoint activation.
3.5. MAD2L1 repression in the presence of vincristine induces
tetraploidization in neuroblastoma cells with functional p53-p21
Tetraplodization, however, was not only observed in neuroblastomas harboring mutated TP53 but also in primary tumors with
functional p53 but deregulated MYCN. We further investigated this
apparent interplay between deregulated MYCN and the metaphase–anaphase checkpoint in cells with functional p53-p21 in
the WAC2-neuroblastoma cell model, which stably expresses a
MYCN transgene driven by a CMV promoter in a wild-type TP53 genetic background. WAC2 cells are characterized by a near-diploid
DNA index and express high levels of MYCN protein [33,34], which
Table 2
Loss of p53–p21 functionality is associated with tetraploidization in neuroblastoma cells.
Untreated
SK-N-BE(2)-Ca
passage 7
passage 9
passage 13
passage 18
SH-EP-MYCNb
p21off + MYCNon
p21off + MYCNoff
*
Doxorubicin-treated
% Diploid
% Aneuploid
DI*
% Diploid
% Aneuploid
DI*
83.4 ± 1.0
69.8 ± 2.0
36.9 ± 1.8
9.2 ± 0.5
16.6 ± 1.0
30.2 ± 2.0
63.1 ± 1.8
90.8 ± 0.5
1.92
1.91
1.89
1.87
12.1 ± 3.1
24.4 ± 2.1
19.5 ± 13.7
-
87.9 ± 3.1
75.6 ± 2.1
80.5 ± 13.7
100.0 ± 0.0
2.00
1.99
1.97
2.00
66.1 ± 3.7
66.8 ± 3.3
33.9 ± 3.7
33.2 ± 3.3
1.93
1.92
21.1 ± 6.4
27.4 ± 8.0
78.9 ± 6.4
72.6 ± 8.0
1.98
1.97
DI = DNA index (SD < 0.02).
Mean ± SD of triplicates from one representative experiment.
b
Mean ± SD of triplicates from two independent experiments.
a
41
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
Height
0
5
10
Height
15
5
0
SK-N-BE(2)-C
10
15
SH-EP
#
**
*
interphase arrest
interphase arrest
*
**
mitotic arrest
primary apoptosis
***
primary apoptosis
mitotic-linked cell death
mitotic-linked cell death
cluster dendrogramm eith AU/BP values (%)
mitotic arrest
distance: euclicean
cluster method: centroid
mitotic-linked cell death:
gene symbol
full gene name
function
MAD2L1
mitotic arrest deficient-like 1
mitotic cell cycle checkpoint
ANLN
anillin, actin binding protein
septin ring assembly (regulation of exit from mitosis)
DPH5
DPH5 homolog (S. cerevisiae)
diphthine synthase activity
ECSIT
evolutionary conserved signaling intermediate
in Toll pathways
RAD51 homolog (S. cerevisiae)
cytoplasmic signaling in Toll-like and BMP signal
transduction pathways
mitotic recombination/DNA repair
NDC80 homolog, kinetochore complex
component (S. cerevisiae)
solute carrier family 1
(neutral amino acid transporter), member 5
mitotic checkpoint signaling
RAD51
NDC80
SLC1A5
neutral amino acid transmembrane transporter activity
Fig. 3. Mitotic-linked cell death after selective inhibition of metaphase–anaphase checkpoint genes in MYCN-amplified neuroblastoma cells. Genes were grouped according to
the phenotype after specific gene knockdown in SK-N-BE(2)-C/H2B-GFP (MYCN-amplified and TP53 inactivating mutation) and SH-EP/H2B-GFP (MYCN-single-copy and wildtype TP53) cells using hierarchical cluster analysis. ⁄Gene knockdown in this cluster revealed interphase arrest escape into mitotic arrest or vice versa. ⁄⁄Gene knockdown in
this cluster caused secondary cell death after interphase arrest. ⁄⁄⁄Gene knockdown in this cluster caused a mixture of mitotic-linked cell death, secondary apoptosis after
interphase arrest and mitotic slippage into interphase arrest followed by secondary apoptosis. # Knockdown of KIF11 caused primary apoptosis and knockdown of SIAH2
caused mitotic-linked cell death. (1) MYCN/MYC target gene and (2) E2F target gene, (NA) = neither MYCN/MYC nor E2F target gene. Phenoclusters were generated using
Euclidean distance as a dissimilarity measure. Values on branches are in percentages. P-values are shown for the approximate unbiased test (red) and bootstrap probabilities
(green). The group of seven genes that induced ‘‘mitotic-linked cell death’’ in SK-N-BE(2)-C but not in SH-EP cells is highlighted (red boxes). (For interpretation of the
references to color in this figure legend, the reader is referred to the web version of this article.)
42
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
A
WAC2shMAD2L1
SH-EPshMAD2L1
96%
58%
MAD2L1
MYCN
β-actin
doxycycline +
B
-
+
-
G0/G1
G2/M
S
2N
cells [%]
80
4N
2N
control
80
4N
2N
80
MAD2L1 expressed
+ vincristine
60
60
60
40
40
40
20
20
20
0
0
G0/1
2N
S
G2/M
4N
8N
MAD2L1 repressed
+ vincristine
0
G0/1
2N
8N
4N
S
G2/M
4N
G0/1
2N
8N
S
G2/M
4N
8N
C
2N
4N
8N
D
Fig. 4. MAD2L1 silencing after vincristine treatment induces tetraploidization in neuroblastoma cells with functional p53-p21. (A) Western blot showing MAD2L1 and MYCN
expression in whole-cell lysates from WAC2 and SH-EP cells stably transfected with shRNA targeting MAD2L1. (B) Flow cytometric analysis of cell cycle and ploidy in WAC2shMAD2L1 cell cultures 36 h after treatment. Curves are paired with bar-graph quantifications (below) for each treatment group. (C) 2-color FISH of WAC2-shMAD2L1 after
36 h of vincristine treatment and MAD2L1 shRNA induction using centromeric probes for chromosome 6 and 8 (pink and green, respectively) and counterstained with DAPI
(blue). Representative images from 250 interphases are shown. (D) Merged immunofluorescence images of WAC2-shMAD2L1 stained for centromers with CREST antibodies
(green) and DNA (blue) to visualize altered nuclear size after combined MAD2L1 silencing and vincristine treatment. (For interpretation of the references to color in this figure
legend, the reader is referred to the web version of this article.)
43
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
Activated aneuploid checkpoints
Impaired p53-p21-dependent
aneuploid checkpoint
high MYCN
high MYCN
*
p53
pRB
p21
p53
pRB
p21
metaphase-anaphase
checkpoint
activation
e.g. MAD2L1
metaphase-anaphase
checkpoint
activation
e.g. MAD2L1
near-diploid neuroblastomas
elevated cellular fitness
tetraploid neuroblastomas
elevated cellular fitness
*inactivating mutation
**
**MAD2L1 inhibition
reduces cellular fitness
Fig. 5. Schematic model describing the role of MYCN and aneuploidy checkpoints in the development of tetraploid neuroblastomas.
results in metaphase–anaphase checkpoint overactivation. The
parental SH-EP cell line, which is characterized by single-copy
MYCN, barely detectable MYCN levels and a lower metaphase–anaphase checkpoint activation status, was used as a control. To test
the effect of metaphase–anaphase checkpoint deregulation in a
functional p53-p21 background, we stably transfected the WAC2
and SH-EP cell lines with a doxycycline-inducible shRNA targeting
the metaphase–anaphase checkpoint regulator, MAD2L1. The SHEP-MYCN neuroblastoma cell model was not suitable for these
experiments because these cells already express a tetra-/doxycycline inducible system. MAD2L1 was effectively repressed upon
shMAD2L1 induction in both SH-EP and WAC2 cells, as demonstrated by western blotting (Fig. 4A). The cell proportions in different phases of the cell cycle were similar for SH-EP-shMAD2L1 and
WAC2-shMAD2L1 cells with or without MAD2L1 knockdown and to
control cells expressing scrambled shRNA. To mimic a weakened
p53-p21 checkpoint, we treated both cell lines with vincristine,
which disrupts microtubule formation and reduces nuclear accumulation of p53, consequently preventing the transcriptional activation of p21 [62]. Vincristine treatment resulted in G2/M arrest of
4 N cells in both WAC2-shMAD2L1 and SH-EP-shMAD2L1 cells
expressing MAD2L1 (Fig. 4B and Supplementary Fig. 5). Combined
inhibition of the p53-p21 axis (vincristine treatment) and the
metaphase–anaphase checkpoint (MAD2L1 silencing) resulted in
approximately 40% of the WAC2-shMAD2L1 cells being 8 N, indicative of cycling tetraploid cells (Fig. 4B and Supplementary
Fig. 5A). Only about 5% of SH-EP-shMAD2L1 cells were 8 N following combined vincristine treatment and MAD2L1 silencing (Supplementary Fig. 5B). These results strengthen our hypothesis that
deregulated MYCN is associated with tetraploidization when
p53-p21 signaling is weakened and the metaphase–anaphase
checkpoint unbalanced.
To further verify induction of tetraploidization in WAC2shMAD2L1 cells, centromeric regions of chromosome 6 and 8 were
labeled with fluorescent dyes (Cy3.5 and FITC, respectively) and 2color FISH was performed. In addition to cells with two signals for
each centromer, indicative of normal diploid cells, interphase nuclei with four or eight centromeric signals, indicative of cycling tetraploid cells, were also observed after MAD2L1 repression and
vincristine treatment in WAC2-shMAD2L1 cells (Fig. 4C). For complete confirmation, 4-color FISH for chromosome 3, 6, 8 and 18
centromeres was also performed, and at least 250 interphase nuclei were manually counted from WAC2-shMAD2L1 cell cultures
treated with vincristine and expressing MAD2L1 or not. The
numerical index of centromeric signals was used as a direct indicator for nuclear DNA content. The fraction of 8 N cells reached 8.7%
18 h after shMAD2L1 induction and vincristine treatment. After
36 h, the 8 N fraction had increased from 8.7% to 30.1% (Supplementary Table 5). Interphase nuclei of 8 N cells appeared strongly
enlarged with an asymmetrical shape in contrast to small, round
diploid cells (Fig. 4C and D). We also detected 3.5% 16 N cells
36 h after induction and treatment. Vincristine treatment alone resulted in 5.1% 8 N cells after 36 h of treatment (Supplementary Table 5). Immunofluorescence imaging using a CREST antibody that
unspecifically binds to centromeric regions further supported the
observation of polyploidization after MAD2L1 knockdown and vincristine treatment (Fig. 4D).
4. Discussion
In this study, we show that overactivation of the metaphase–
anaphase checkpoint acts as a pro-survival mechanism in the
development of tetraploid neuroblastoma cells lacking functional
p53-p21 signaling. Elevated expression of mitotic spindle regulatory genes has been shown to be associated with MYCN amplification and 1p loss in neuroblastomas [52,63,64]. This is consistent
with our gene expression analyses in primary neuroblastoma tumors, which further showed that overexpression of MYCN/MYC
and p53/pRB-E2F target genes, especially those involved in regulating mitotic processes, such as sister chromatid segregation, microtubule
organization
or
metaphase–anaphase
checkpoint
regulation, is associated with near-di/tetraploidy and poor outcome in neuroblastoma patients. One gene we identified in this regard was MAD2L1, which is a direct MYC and E2F-1 target [22,65].
This suggests that MYCN/MYC-mediated overactivation of the
metaphase–anaphase checkpoint might be causally involved in
the development of near-di/tetraploidy by initially provoking sustained mitotic arrest, as shown for Mad2 overexpression [66]. Cells
might escape this sustained arrest by mitotic slippage – an adaptation that consequently results in the failure of cytokinesis and tetraploidy [1]. Our observation that neuroblastoma cells lacking p53-
44
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
p21 function, either through TP53 mutation or mediated by
p21CIP1 knockdown, consist of diploid and tetraploid cell fractions
indicates that functional p53-p21-mediated checkpoints are required to arrest these cells [53,67] and to subsequently initiate cell
death or senescence programs [57]. Evidence that p53 and p21
inactivation is mainly involved in the origin of tetraploidy exists
in the mouse model p53-R172P equivalent to R175P in human,
which harbor an Arg-to-Pro TP53 mutation. The p53 in cells from
these mice is incapable of inducing apoptosis, but still activated
p21-mediated G1-S arrest [68]. Accordingly, these mice developed
tumors with a diploid DNA index. Crossing the TP53-mutant mice
into a p21 / background resulted in formation of aneuploid tumors. Some evidence exists for a potential association between tetraploidy and loss of p53-p21 functionality in neuroblastoma.
Additionally to SK-N-BE(2)-C cells, other neuroblastoma cell lines
harboring mutant TP53 are characterized by a near-tetraploid
DNA index, including LA-N-1, NMB and NB-6 [69–72]. Whole genome sequencing of primary neuroblastomas revealed that at least
some tetraploid tumors harbored TP53 mutations (unpublished
data). This genetic alteration, although frequent in many other cancers, occurs mainly in relapse neuroblastomas and is associated
with therapy resistance [55], suggesting a direct connection of
p53 functionality to neuroblastoma biology.
A direct connection between the p53-p21 axis, mitotic spindle
regulatory genes and tetraplodization was presented by Schvartzman, et al. using the same TP53-mutant and p21-deficient mice. He
showed that p21 is a direct negative Mad2 regulator and that normalization of Mad2 expression reduced the aneuploid cell fraction
in these murine tumors [73]. In cells lacking p53 and/or p21 function,
overactivation of metaphase–anaphase checkpoint members might,
therefore, facilitate the development and survival of tetraploid cells
(Fig. 5). We observed that tetraploid cell fractions increased after
several passages or drug-induced DNA damage in both the TP53-mutated neuroblastoma cell line and in neuroblastoma cells silenced for
p21CIP1 expression. Our siRNA screening approach also demonstrated that knockdown of genes involved in metaphase–anaphase
checkpoint regulation, including MAD2L1, induced mitotic-linked
cell death only in neuroblastoma cells lacking p53-p21 function as
a consequence of TP53 mutation. These results from various in vivo
and in vitro studies show that functional p53-p21 signaling is crucial
to control the expression of metaphase–anaphase checkpoint genes
and to inhibit the survival of tetraploid cells.
In summary, the results we present here reveal novel insights
into how genetic aberrations of the p53-p21 axis contribute to tetraploidy in neuroblastoma cells. These data enhance our understanding of how MYCN/MYC mediates aggressive behavior in
neuroblastomas. Since overactivation of the metaphase–anaphase
checkpoint supports the survival of tetraploid cells lacking p53p21 function, targeted inhibition of certain metaphase–anaphase
checkpoint members, such as MAD2L1, may provide a therapeutic
option for neuroblastomas harboring genomic alterations reducing
p53-p21 function.
Acknowledgments
We thank Geoffrey M. Wahl for providing the H2B-GFP expression vector, Frank Berthold, Barbara Hero and the German Neuroblastoma Study Group for providing clinical data, and Kathy
Astrahantseff for manuscript editing.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.canlet.2012.
11.028.
References
[1] B.A. Weaver, D.W. Cleveland, Does aneuploidy cause cancer?, Current Opinion
in Cell Biology 18 (2006) 658–667
[2] R. Spitz, B. Hero, T. Simon, F. Berthold, Loss in chromosome 11q identifies
tumors with increased risk for metastatic relapses in localized and 4S
neuroblastoma, Clinical Cancer Research 12 (2006) 3368–3373.
[3] E.F. Attiyeh, W.B. London, Y.P. Mosse, Q. Wang, C. Winter, D. Khazi, P.W.
McGrady, R.C. Seeger, A.T. Look, H. Shimada, G.M. Brodeur, S.L. Cohn, K.K.
Matthay, J.M. Maris, Chromosome 1p and 11q deletions and outcome in
neuroblastoma, New England Journal of Medicine 353 (2005) 2243–2253.
[4] G.M. Brodeur, R.C. Seeger, M. Schwab, H.E. Varmus, J.M. Bishop, Amplification
of N-myc in untreated human neuroblastomas correlates with advanced
disease stage, Science 224 (1984) 1121–1124.
[5] R.C. Seeger, G.M. Brodeur, H. Sather, A. Dalton, S.E. Siegel, K.Y. Wong, D.
Hammond, Association of multiple copies of the N-myc oncogene with rapid
progression of neuroblastomas, New England Journal of Medicine 313 (1985)
1111–1116.
[6] R. Ladenstein, I.M. Ambros, U. Potschger, G. Amann, C. Urban, F.M. Fink, K.
Schmitt, R. Jones, M. Slociak, F. Schilling, J. Ritter, F. Berthold, H. Gadner, P.F.
Ambros, Prognostic significance of DNA di-tetraploidy in neuroblastoma,
Medical and Pediatric Oncology 36 (2001) 83–92.
[7] R. Bagatell, P. Rumcheva, W.B. London, S.L. Cohn, A.T. Look, G.M. Brodeur, C.
Frantz, V. Joshi, P. Thorner, P.V. Rao, R. Castleberry, L.C. Bowman, Outcomes of
children with intermediate-risk neuroblastoma after treatment stratified by
MYCN status and tumor cell ploidy, Journal of Clinical Oncology 23 (2005)
8819–8827.
[8] R.E. George, W.B. London, S.L. Cohn, J.M. Maris, C. Kretschmar, L. Diller, G.M.
Brodeur, R.P. Castleberry, A.T. Look, Hyperdiploidy plus nonamplified MYCN
confers a favorable prognosis in children 12–18 months old with disseminated
neuroblastoma: a Pediatric Oncology Group study, Journal of Clinical Oncology
23 (2005) 6466–6473.
[9] J. Schneiderman, W.B. London, G.M. Brodeur, R.P. Castleberry, A.T. Look, S.L.
Cohn, Clinical significance of MYCN amplification and ploidy in favorable-stage
neuroblastoma: a report from the Children’s Oncology Group, Journal of
Clinical Oncology 26 (2008) 913–918.
[10] G.M. Brodeur, Neuroblastoma: biological insights into a clinical enigma,
Nature Reviews. Cancer 3 (2003) 203–216.
[11] F. Westermann, M. Schwab, Genetic parameters of neuroblastomas, Cancer
Letters 184 (2002) 127–147.
[12] N.J. Ganem, Z. Storchova, D. Pellman, Tetraploidy, aneuploidy and cancer,
Current Opinion in Genetics & Development 17 (2007) 157–162.
[13] Z. Storchova, D. Pellman, From polyploidy to aneuploidy, genome instability
and cancer, Nature Reviews 5 (2004) 45–54.
[14] T. Fujiwara, M. Bandi, M. Nitta, E.V. Ivanova, R.T. Bronson, D. Pellman,
Cytokinesis failure generating tetraploids promotes tumorigenesis in p53-null
cells, Nature 437 (2005) 1043–1047.
[15] M.T. Barrett, D. Pritchard, C. Palanca-Wessels, J. Anderson, B.J. Reid, P.S.
Rabinovitch, Molecular phenotype of spontaneously arising 4N (G2-tetraploid)
intermediates of neoplastic progression in Barrett’s esophagus, Cancer
Research 63 (2003) 4211–4217.
[16] A.J. Olaharski, R. Sotelo, G. Solorza-Luna, M.E. Gonsebatt, P. Guzman, A. Mohar,
D.A. Eastmond, Tetraploidy and chromosomal instability are early events
during cervical carcinogenesis, Carcinogenesis 27 (2006) 337–343.
[17] Z. Storchova, C. Kuffer, The consequences of tetraploidy and aneuploidy,
Journal of Cell Science 121 (2008) 3859–3866.
[18] R. Sotillo, E. Hernando, E. Diaz-Rodriguez, J. Teruya-Feldstein, C. Cordon-Cardo,
S.W. Lowe, R. Benezra, Mad2 overexpression promotes aneuploidy and
tumorigenesis in mice, Cancer Cell 11 (2007) 9–23.
[19] C.L. Rieder, H. Maiato, Stuck in division or passing through: what happens
when cells cannot satisfy the spindle assembly checkpoint, Developmental
Cell 7 (2004) 637–651.
[20] A. Musacchio, E.D. Salmon, The spindle-assembly checkpoint in space and
time, Nature Reviews 8 (2007) 379–393.
[21] A.J. Holland, D.W. Cleveland, Boveri revisited: chromosomal instability,
aneuploidy and tumorigenesis, Nature Reviews 10 (2009) 478–487.
[22] E. Hernando, Z. Nahle, G. Juan, E. Diaz-Rodriguez, M. Alaminos, M. Hemann, L.
Michel, V. Mittal, W. Gerald, R. Benezra, S.W. Lowe, C. Cordon-Cardo, Rb
inactivation promotes genomic instability by uncoupling cell cycle progression
from mitotic control, Nature 430 (2004) 797–802.
[23] M. Malumbres, Oncogene-induced mitotic stress: p53 and pRb get mad too,
Cancer Cell 19 (2011) 691–692.
[24] J. Carr-Wilkinson, K. O’Toole, K.M. Wood, C.C. Challen, A.G. Baker, J.R. Board, L.
Evans, M. Cole, N.K. Cheung, J. Boos, G. Kohler, I. Leuschner, A.D. Pearson, J.
Lunec, D.A. Tweddle, High Frequency of p53/MDM2/p14ARF Pathway
Abnormalities in Relapsed Neuroblastoma, Clinical Cancer Research 16
(2010) 1108–1118.
[25] J.J. Molenaar, M.E. Ebus, J. Koster, P. van Sluis, C.J. van Noesel, R. Versteeg, H.N.
Caron, Cyclin D1 and CDK4 activity contribute to the undifferentiated
phenotype in neuroblastoma, Cancer Research 68 (2008) 2599–2609.
[26] J.J. Molenaar, P. van Sluis, K. Boon, R. Versteeg, H.N. Caron, Rearrangements and
increased expression of cyclin D1 (CCND1) in neuroblastoma, Genes,
Chromosomes & Cancer 36 (2003) 242–249.
[27] A. Slack, Z. Chen, R. Tonelli, M. Pule, L. Hunt, A. Pession, J.M. Shohet, The p53
regulatory gene MDM2 is a direct transcriptional target of MYCN in
S. Gogolin et al. / Cancer Letters 331 (2013) 35–45
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
neuroblastoma, Proceedings of the National Academy of Sciences of the United
States of America 102 (2005) 731–736.
F. Westermann, D. Muth, A. Benner, T. Bauer, K.O. Henrich, A. Oberthuer, B.
Brors, T. Beissbarth, J. Vandesompele, F. Pattyn, B. Hero, R. Konig, M. Fischer, M.
Schwab, Distinct transcriptional MYCN/c-MYC activities are associated with
spontaneous regression or malignant progression in neuroblastomas, Genome
Biology 9 (2008) R150.
I. Eckerle, D. Muth, J. Batzler, K.O. Henrich, W. Lutz, M. Fischer, O. Witt, M.
Schwab, F. Westermann, Regulation of BIRC5 and its isoform BIRC5-2B in
neuroblastoma, Cancer Letters 285 (2009) 99–107.
J. Seoane, H.V. Le, J. Massague, Myc suppression of the p21(Cip1) Cdk inhibitor
influences the outcome of the p53 response to DNA damage, Nature 419
(2002) 729–734.
P.C. Galipeau, D.S. Cowan, C.A. Sanchez, M.T. Barrett, M.J. Emond, D.S. Levine,
P.S. Rabinovitch, B.J. Reid, 17p (p53) allelic losses, 4N (G2/tetraploid)
populations, and progression to aneuploidy in Barrett’s esophagus,
Proceedings of the National Academy of Sciences of the United States of
America 93 (1996) 7081–7084.
D.T. Jones, N. Jager, M. Kool, T. Zichner, B. Hutter, M. Sultan, Y.J. Cho, T.J. Pugh, V.
Hovestadt, A.M. Stutz, T. Rausch, H.J. Warnatz, M. Ryzhova, S. Bender, D. Sturm, S.
Pleier, H. Cin, E. Pfaff, L. Sieber, A. Wittmann, M. Remke, H. Witt, S. Hutter, T.
Tzaridis, J. Weischenfeldt, B. Raeder, M. Avci, V. Amstislavskiy, M. Zapatka, U.D.
Weber, Q. Wang, B. Lasitschka, C.C. Bartholomae, M. Schmidt, C. von Kalle, V. Ast,
C. Lawerenz, J. Eils, R. Kabbe, V. Benes, P. van Sluis, J. Koster, R. Volckmann, D.
Shih, M.J. Betts, R.B. Russell, S. Coco, G.P. Tonini, U. Schuller, V. Hans, N. Graf, Y.J.
Kim, C. Monoranu, W. Roggendorf, A. Unterberg, C. Herold-Mende, T. Milde, A.E.
Kulozik, A. von Deimling, O. Witt, E. Maass, J. Rossler, M. Ebinger, M.U.
Schuhmann, M.C. Fruhwald, M. Hasselblatt, N. Jabado, S. Rutkowski, A.O. von
Bueren, D. Williamson, S.C. Clifford, M.G. McCabe, V.P. Collins, S. Wolf, S.
Wiemann, H. Lehrach, B. Brors, W. Scheurlen, J. Felsberg, G. Reifenberger, P.A.
Northcott, M.D. Taylor, M. Meyerson, S.L. Pomeroy, M.L. Yaspo, J.O. Korbel, A.
Korshunov, R. Eils, S.M. Pfister, P. Lichter, Dissecting the genomic complexity
underlying medulloblastoma, Nature 488 (2012) 100–105.
L. Schweigerer, S. Breit, A. Wenzel, K. Tsunamoto, R. Ludwig, M. Schwab,
Augmented MYCN expression advances the malignant phenotype of human
neuroblastoma cells: evidence for induction of autocrine growth factor
activity, Cancer Research 50 (1990) 4411–4416.
L. Schweigerer, P. Scheurich, T. Fotsis, Enhanced MYCN oncogene expression in
human neuroblastoma cells results in increased susceptibility to growth
inhibition by TNF alpha, Biochemical and Biophysical Research
Communications 170 (1990) 1301–1307.
T. Kanda, K.F. Sullivan, G.M. Wahl, Histone-GFP fusion protein enables
sensitive analysis of chromosome dynamics in living mammalian cells,
Current Biology 8 (1998) 377–385.
W. Lutz, M. Stohr, J. Schurmann, A. Wenzel, A. Lohr, M. Schwab, Conditional
expression of N-myc in human neuroblastoma cells increases expression of
alpha-prothymosin and ornithine decarboxylase and accelerates progression
into S-phase early after mitogenic stimulation of quiescent cells, Oncogene 13
(1996) 803–812.
V. Ehemann, B. Hashemi, A. Lange, H.F. Otto, Flow cytometric DNA analysis and
chromosomal aberrations in malignant glioblastomas, Cancer Letters 138
(1999) 101–106.
V. Ehemann, J. Sykora, J. Vera-Delgado, A. Lange, H.F. Otto, Flow cytometric
detection of spontaneous apoptosis in human breast cancer using the TUNELtechnique, Cancer Letters 194 (2003) 125–131.
H. Erfle, B. Neumann, U. Liebel, P. Rogers, M. Held, T. Walter, J. Ellenberg, R.
Pepperkok, Reverse transfection on cell arrays for high content screening
microscopy, Nature Protocols 2 (2007) 392–399.
N. Harder, R. Batra, S. Gogolin, N. Diessl, R. Eils, F. Westermann, R. König, K.
Rohr, Large-scale tracking for cell migration and proliferation analysis and
experimental optimization of high-throughput screens, in: Proc. 6th Internat.
Workshop on Microscopic Image Analysis with Applications in Biology (MIAAB
‘11), 2011.
C. Brideau, B. Gunter, B. Pikounis, A. Liaw, Improved statistical methods for hit
selection in high-throughput screening, Journal of Biomolecular Screening 8
(2003) 634–647.
M. van de Wetering, I. Oving, V. Muncan, M.T. Pon Fong, H. Brantjes, D. van
Leenen, F.C. Holstege, T.R. Brummelkamp, R. Agami, H. Clevers, Specific
inhibition of gene expression using a stably integrated, inducible smallinterfering-RNA vector, EMBO Reports 4 (2003) 609–615.
E.A. Afanasyeva, P. Mestdagh, C. Kumps, J. Vandesompele, V. Ehemann, J.
Theissen, M. Fischer, M. Zapatka, B. Brors, L. Savelyeva, V. Sagulenko, F.
Speleman, M. Schwab, F. Westermann, MicroRNA miR-885-5p targets CDK2
and MCM5, activates p53 and inhibits proliferation and survival, Cell Death
and Differentiation 18 (2011) 974–984.
O. Henegariu, P. Bray-Ward, D.C. Ward, Custom fluorescent-nucleotide
synthesis as an alternative method for nucleic acid labeling, Nature
Biotechnology 18 (2000) 345–348.
L. Savelyeva, E. Sagulenko, J.G. Schmitt, M. Schwab, The neurobeachin gene
spans the common fragile site FRA13A, Human Genetics 118 (2006) 551–558.
P. Kett, B. Geiger, V. Ehemann, D. Komitowski, Three-dimensional analysis of
cell nucleus structures visualized by confocal scanning laser microscopy,
Journal of Microscience 167 (1992) 169–179.
A. Oberthuer, F. Berthold, P. Warnat, B. Hero, Y. Kahlert, R. Spitz, K. Ernestus, R.
Konig, S. Haas, R. Eils, M. Schwab, B. Brors, F. Westermann, M. Fischer,
Customized oligonucleotide microarray gene expression-based classification
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
[63]
[64]
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
[73]
45
of neuroblastoma patients outperforms current clinical risk stratification,
Journal of Clinical Oncology 24 (2006) 5070–5078.
W. Huang da, B.T. Sherman, R.A. Lempicki, Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources, Nature Protocols 4
(2009) 44–57.
K.O. Henrich, M. Fischer, D. Mertens, A. Benner, R. Wiedemeyer, B. Brors, A.
Oberthuer, F. Berthold, J.S. Wei, J. Khan, M. Schwab, F. Westermann, Reduced
expression of CAMTA1 correlates with adverse outcome in neuroblastoma
patients, Clinical Cancer Research 12 (2006) 131–138.
T. Hothorn, K. Hornik, A. Zeileis, Unbiased recursive partitioning: a conditional
inference framework, Journal of Computational and Graphical Statistics 15
(2006) 651–674.
D.J. Gordon, B. Resio, D. Pellman, Causes and consequences of aneuploidy in
cancer, Nature Reviews. Genetics 13 (2012) 189–203.
F. Westermann, K.O. Henrich, J.S. Wei, W. Lutz, M. Fischer, R. Konig, R.
Wiedemeyer, V. Ehemann, B. Brors, K. Ernestus, I. Leuschner, A. Benner, J. Khan,
M. Schwab, High Skp2 expression characterizes high-risk neuroblastomas
independent of MYCN status, Clinical Cancer Research 13 (2007) 4695–4703.
J.S. Lanni, T. Jacks, Characterization of the p53-dependent postmitotic
checkpoint following spindle disruption, Molecular and Cellular Biology 18
(1998) 1055–1064.
Z.A. Stewart, D. Mays, J.A. Pietenpol, Defective G1-S cell cycle checkpoint
function sensitizes cells to microtubule inhibitor-induced apoptosis, Cancer
Research 59 (1999) 3831–3837.
D.A. Tweddle, A.J. Malcolm, N. Bown, A.D. Pearson, J. Lunec, Evidence for the
development of p53 mutations after cytotoxic therapy in a neuroblastoma cell
line, Cancer Research 61 (2001) 8–13.
N. Keshelava, R.C. Seeger, S. Groshen, C.P. Reynolds, Drug resistance patterns of
human neuroblastoma cell lines derived from patients at different phases of
therapy, Cancer Research 58 (1998) 5396–5405.
M.V. Blagosklonny, Mitotic arrest and cell fate: why and how mitotic
inhibition of transcription drives mutually exclusive events, Cell Cycle
(Georgetown, Tex) 6 (2007) 70–74.
W.M. Zhao, G. Fang, Anillin is a substrate of anaphase-promoting complex/
cyclosome (APC/C) that controls spatial contractility of myosin during late
cytokinesis, Journal of Biological Chemistry 280 (2005) 33516–33524.
J.V. Shah, D.W. Cleveland, Waiting for anaphase: Mad2 and the spindle
assembly checkpoint, Cell 103 (2000) 997–1000.
S. Martin-Lluesma, V.M. Stucke, E.A. Nigg, Role of Hec1 in spindle checkpoint
signaling and kinetochore recruitment of Mad1/Mad2, Science 297 (2002)
2267–2270.
J. Thacker, The RAD51 gene family, genetic instability and cancer, Cancer
Letters 219 (2005) 125–135.
P. Giannakakou, D.L. Sackett, Y. Ward, K.R. Webster, M.V. Blagosklonny, T. Fojo,
P53 is associated with cellular microtubules and is transported to the nucleus
by dynein, Nature Cell Biology 2 (2000) 709–717.
W.F. Ooi, A. Re, V. Sidarovich, V. Canella, N. Arseni, V. Adami, G. Guarguaglini,
M. Giubettini, P. Scaruffi, S. Stigliani, P. Lavia, G.P. Tonini, A. Quattrone,
Segmental chromosome aberrations converge on overexpression of mitotic
spindle regulatory genes in high-risk neuroblastoma, Genes, Chromosomes &
Cancer (2012).
A.L. Krasnoselsky, C.C. Whiteford, J.S. Wei, S. Bilke, F. Westermann, Q.R. Chen, J.
Khan, Altered expression of cell cycle genes distinguishes aggressive
neuroblastoma, Oncogene 24 (2005) 1533–1541.
A. Menssen, A. Epanchintsev, D. Lodygin, N. Rezaei, P. Jung, B. Verdoodt, J.
Diebold, H. Hermeking, C-MYC delays prometaphase by direct transactivation
of MAD2 and BubR1: identification of mechanisms underlying c-MYC-induced
DNA damage and chromosomal instability, Cell Cycle (Georgetown, Tex) 6
(2007) 339–352.
G. Fang, H. Yu, M.W. Kirschner, The checkpoint protein MAD2 and the mitotic
regulator CDC20 form a ternary complex with the anaphase-promoting
complex to control anaphase initiation, Genes & Development 12 (1998)
1871–1883.
S.L. Thompson, D.A. Compton, Proliferation of aneuploid human cells is limited
by a p53-dependent mechanism, Journal of Cell Biology 188 (2010) 369–381.
J.A. Barboza, G. Liu, Z. Ju, A.K. El-Naggar, G. Lozano, P21 delays tumor onset by
preservation of chromosomal stability, Proceedings of the National Academy
of Sciences of the United States of America 103 (2006) 19842–19847.
D.A. Tweddle, A.D. Pearson, M. Haber, M.D. Norris, C. Xue, C. Flemming, J.
Lunec, The p53 pathway and its inactivation in neuroblastoma, Cancer Letters
197 (2003) 93–98.
G.M. Brodeur, A.A. Green, F.A. Hayes, K.J. Williams, D.L. Williams, A.A. Tsiatis,
Cytogenetic features of human neuroblastomas and cell lines, Cancer Research
41 (1981) 4678–4686.
R.C. Seeger, S.A. Rayner, A. Banerjee, H. Chung, W.E. Laug, H.B. Neustein, W.F.
Benedict, Morphology, growth, chromosomal pattern and fibrinolytic activity
of two new human neuroblastoma cell lines, Cancer Research 37 (1977) 1364–
1371.
A. Valent, J. Benard, B. Clausse, M. Barrois, D. Valteau-Couanet, M.J. TerrierLacombe, B. Spengler, A. Bernheim, In vivo elimination of acentric double
minutes containing amplified MYCN from neuroblastoma tumor cells through
the formation of micronuclei, American Journal of Pathology 158 (2001) 1579–
1584.
J.M. Schvartzman, P.H. Duijf, R. Sotillo, C. Coker, R. Benezra, Mad2 is a critical
mediator of the chromosome instability observed upon Rb and p53 pathway
inhibition, Cancer Cell 19 (2011) 701–714.