Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Dominance (genetics) wikipedia , lookup
Behavioural genetics wikipedia , lookup
Synthetic biology wikipedia , lookup
Hardy–Weinberg principle wikipedia , lookup
Population genetics wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Microevolution wikipedia , lookup
Heritability of IQ wikipedia , lookup
Lab 2 - Variation Lab Website • Laboratory notes, schedule, etc. now available on web. • Notes in pdf format. http://biology.queensu.ca/~brownjw/Biol206/Lab 2 Monday January 13, 2003 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Introduction To Variation Goals • Fundamental to comparative biology • Raw material and product of evolution (i.e. the stuff) • Traits include morphological, physiological, biochemical, behavioural, genetic, etc. • Enables researchers to answer many different kinds of questions • To appreciate the importance and uses of variation in biological investigations • To be able to distinguish different types of variation, and understand the distribution of variation across different scales * – What types are evolutionarily significant? • To become familiar with the various methods for assaying genetic variation – E.g. phylogenetic affinities, population history, migration, behavioural, mating systems, etc. 3 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 4 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 1 Genotype vs. Phenotype Genotype vs. Phenotype Genotype: Phenotype: • The detectable outward manifestations of a specific genotype • ‘Detectable’ how? • The genetic makeup of an individual • A representation of the alleles in an individual * • The nucleotide sequence of an individual’s DNA – Idea of phenotype has changed drastically over past 50 years TGCTACACGATAGAATGTATCT • E.g. morphological, protein, DNA? 5 6 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Genotype vs. Phenotype Genotype vs. Phenotype Phenotype: • Functional definition may be better: Æ – ‘Seen’ by natural (or unnatural) selection – Can be morphological, physiological, biochemical, behavioural, etc. Æ • E.g. size, resistance, fecundity, metabolic rate, etc. 7 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 8 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 2 Genotype vs. Phenotype Genotype Æ Phenotype • It is often easier to determine the relationship between genotype and phenotype when you consider one trait at a time (e.g. colour, etc.) • Trait is influenced by alleles at relevant genetic loci (= genotype) • Translation into phenotype is complicated by environmental and developmental conditions Phenotype: • Problems with the functional definition: – We may not be able to determine the functional role of many traits – Some traits are vestigial • E.g. eyes in cave fish, appendix in humans • Underlies idea of ‘phenotypic plasticity’ • May depend on fundamental processes – Different environmental conditions 9 10 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Genotype Æ Phenotype Discrete vs. Continuous Variation • Discrete (polymorphic) variation: • Number of loci influencing trait often determines relationship between genotype and phenotype – Can affect how fast trait will evolve – Determines appropriate analyses (e.g. statistics) – Often determines distribution of variation * – Usually controlled by few loci (1 or 2) – Individuals can be assigned to a small number of phenotypic categories • Consider a trait controlled by one locus: – If dominance is present, there will be two phenotypic classes (E.g. tall, short) – If codominant, there will be three classes 11 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 12 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 3 Discrete vs. Continuous Variation • Discrete (polymorphic) variation: – Usually controlled by few loci (1 or 2) – Individuals can be assigned to a small number of phenotypic categories • Consider a trait controlled by one locus: – If dominance is present, there will be two phenotypic classes (E.g. tall, short) – If codominant, there will be three classes 13 14 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Discrete vs. Continuous Variation Discrete vs. Continuous Variation • Continuous (polygenic) variation: – Also called ‘quantitative genetic control’ • Simple example – Mendel’s peas – Controlled by one locus – Smooth is dominant to wrinkled – Peas are either smooth (SS or Ss) or wrinkled (ss) – Controlled by many (> 3) loci – No discrete phenotypic classes – full range of phenotypic expression (E.g. human height) 15 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 16 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 4 Discrete vs. Continuous Variation • Continuous (polygenic) variation: • Additive model – each locus has an equal effect on the trait in question – However, may involve major gene control and modifier genes • Threshold model – requires a certain number of alleles to affect trait at all – results in a discontinuous distribution 17 18 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Additive Model Additive Model Individual #1 Individual #2 Individual #1 Individual #2 ++-+-+++-+ ++++++-+++ +-+--+-+--+-+---+-+ ++-+-+++-+ ++++++-+++ +-+--+-+--+-+---+-+ * + adds 5 grams to body size, - does nothing * + adds 5 grams to body size, - does nothing How much more does individual 1 weigh? 19 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 20 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 5 Discrete vs. Continuous Variation Major Gene Control • Continuous (polygenic) variation: • Additive model – each locus has an equal effect on the trait in question – However, may involve major gene control and modifier genes • Threshold model – requires a certain number of alleles to affect trait at all – results in a discontinuous distribution Individual #1 Individual #2 ++-+-+++-+ ++++++--++ +-+--+-+--+-+---+-+ * + adds 5 grams to body size, - does nothing + adds 50 grams to body size - other loci are “modifier genes” 21 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 22 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Discrete vs. Continuous Variation • Continuous (polygenic) variation: Body Size • Additive model – each locus has an equal effect on the trait in question – However, may involve major gene control and modifier genes • Threshold model – requires a certain number of alleles to affect trait at all Number of + alleles – results in a discontinuous distribution 23 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 24 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 6 Discrete vs. Continuous Variation • Distinguishing between polymorphic and polygenic traits Body Size – Complicated by genotype by environment interactions – Introduces ‘random noise’ into phenotype • E.g. a polymorphic trait may appear polygenic Number of + alleles 25 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Discrete vs. Continuous Variation Levels Of Variation *Know this COLD! Phenotypic variation Polymorphic Polygenic Genotypic variation Discrete 26 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 • Variation (both phenotypic and genotypic) can occur at different scales Continuous – Individual Æ Population Æ Species USUALLY - Modifiers - Thresholds - Supergenes - Environmental variance • The distribution of variation across these different scales has importance for both the process of evolution and the types of questions we can ask USUALLY 27 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 28 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 7 Variation Within Individuals Variation Among Individuals Within Populations • Phenotypic: • This is the level at which evolution operates * – ‘Developmental variation’ - has no genetic basis • Genotypic: – Only if phenotypic variation comes about because of underlying genetic variation • Amount of variation present can indicate mating system, population history, etc. – Heterozygotes have ‘allelic variation’ – Important for both fitness and measuring migration – E.g. selfing vs. outcrossing 29 30 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 Variation Among Populations Within A Species Frequencies • Defining a ‘population’ can often be tricky – But ignore this for now • Question: Are populations genetically identical? • Must be able to calculate allele and genotype frequencies (simple proportions) for populations and species – Diverging evolutionary forces tend to cause population differentiation, while homogenizing forces tend to counter this • May indicate species history, migration, etc. Allele Frequency = # Ax alleles Total # of all alleles Genotype Frequency = # AxAy individuals Total # of all individuals 31 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 32 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 8 Next Week • Quiz #1 on Lab #2 material * * * • Read lab manual before you come to lab next week – Mating Systems • Very important/difficult topic • Will be tested directly on this (Quizzes/Exams) 33 Biology 206 Lab #2 – Variation Joseph W. Brown - January 13, 2003 9