Download slg mock midterm – for practice only

PASS MOCK EXAM
– FOR PRACTICE ONLY –
Course: BIOL 1103
Facilitator: Jillian Rohonczy
Dates and locations of mock exam take-up: December 8th 1pm – 3pm in SC 103 & December 14th 1pm – 3pm in SC
103
It is most beneficial to you to write this mock midterm UNDER EXAM CONDITIONS. This means:
• Complete the midterm in ___ hour(s).
• Work on your own.
• Keep your notes and textbook closed.
• Attempt every question.
After the time limit, go back over your work with a different colour or on a separate piece of paper and
try to do the questions you are unsure of. Record your ideas in the margins to remind yourself of what
you were thinking when you take it up at PASS.
The purpose of this mock exam is to give you practice answering questions in a timed setting and to
help you to gauge which aspects of the course content you know well and which are in need of further
development and review. Use this mock exam as a learning tool in preparing for the actual exam.
Please note:

Come to the PASS session with your mock exam complete. There, you can work with other
students to review your work.

Often, there is not enough time to review the entire exam in the PASS session. Decide which
questions you most want to review – the Facilitator may ask students to vote on which
questions they want to discuss.

Facilitators do not bring copies of the mock exam to the session. Please print out and complete
the exam before you attend.
 Facilitators do not produce or distribute an answer key for mock exams. Facilitators help
students to work together to compare and assess the answers they have. If you are not able to
attend the PASS session, you can work alone or with others in the class.
Good Luck writing the Mock Exam!!
DISCLAIMER: PASS handouts are designed as a study aid only for use in PASS workshops. Handouts may
contain errors, intentional or otherwise. It is up to the student to verify the information contained within.
1. What is one way that cells are able to decrease their membrane fluidity?
a. By increasing the level of cholesterol in the membrane
b. By increasing the number of unsaturated fats in the membrane
c. By increasing the number of phospholipids in the membranes
d. By increasing the number of saturated fats in the membrane
e. By increasing the number of proteins in the membrane
2. In the following reaction, the carbon molecule of glucose is ___________ to form carbon dioxide and the
oxygen molecule is ________ to form water.
C6H12O6 + 6 O2
a.
b.
c.
d.
e.
6 CO2 + 6 H2O + Energy
oxidized, reduced
reduced, oxidized
oxidized, oxidized
reduced, reduced
This is not an oxidation-reduction reaction.
3. A genetically modified blue peach has the genotype BB, the autosomal dominant recessive peaches are
purple. Another gene in the peach turns it white when autosomal recessive. What is this interaction known
as?
a. Pleiotropy
b. Epistasis
c. Aneuploidy
d. Incomplete Dominance
e. Codominance
4. Which off the following can easily diffuse across the membrane?
a. Glucose
b. Hydrogen ions
c. Methane
d. Potassium ions
e. Sucrose
5. What is the final product of the Calvin cycle?
a. Biphosphoglycerate
b. Pyruvate
c. Carbon dioxide
d. Glyceraldehyde phosphate
e. Oxaloacetate
6. According to the second law of thermodynamics:
a. The total amount of energy in a closed system remains constant
b. The disorder in a system tends to increase
c. The total amount of energy in the universe remains constant
d. The total amount of energy in the universe increases over time
e. The disorder in a system tends to decrease
7. What is the driving force of facilitated diffusion?
a. A concentration gradient
b. ATP
c. Sucrose
d. GDP
e. Hydrophilic interactions
8. Which of the following polymer and linkage pairs are properly match?
a. Nucleic acids – phosphodiester bonds
b. Polypeptide – glycosidic linkage
c. Polysaccharide – peptide bond
d. Nucleic acids – ester linkages
e. Polypeptide – ester linkages
9. If the G of a chemical reaction is positive what can one conclude about the reaction?
a. It is exergonic
b. It is catabolic
c. It is endergonic
d. It is in equilibrium
e. It results in the release of energy
10. A gene that normally encodes for a protein that is 50,000 g/mol in mass is exposed to a harmful reagent.
After it is transcribed into a protein, it is found that the protein is 18,000 g/mol in mass. What kind of
mutation likely occurred?
a. Missense mutation
b. Frameshift mutation
c. Nonsense mutation
d. Silencing mutation
e. Discontinuous mutation
11. Which of the following is a benefit of compartmentalization?
a. The isolation of potentially harmful products
b. Organelles decrease quantity of membrane as a function of volume
c. Allows cells to divide at a faster rate
d. Simplification of metabolism
e. Both a) and d) are correct
12. Which of the following describes a group of related genes in a prokaryote’s DNA?
a. Enhancer
b. Inducer
c. Promoter
d. Operon
e. Nucleus
13. What type of bond forms between complementary base pairs?
a. Ionic bonds
b. Hydrogen bonds
c. Covalent bonds
d. Disulfide bonds
e. Peptide bonds
14. Rachel and Ross just got married. Ross was married once before and had albino child. Rachel has an albino
sister. Neither Ross, Rachel, nor any of their parents are albinos. Calculate the probability that Ross and
Rachel will have an albino child. Albinism is an autosomal recessive disorder.
a. 1/2
b. 1/4
c. 1/6
d. 2/3
15. How many different types of gametes could be produced through independent assortment by an individual
with a genotype AA Bb Cc DD Ee?
a. 5
b. 6
c. 8
d. 16
e. 64
16. Which of the following best describes the disease in the above pedigree?
a. X-linked dominant
b. X-link recessive
c. Autosomal dominant
d. Autosomal recessive
e. Y-link
17. What is the genotype of the first generation male?
a. HH
b. Hh
c. Hh
d. XhY
e. Either a or b
18. When can non-disjunction occur during Meiosis?
a. Prophase 1
b. Anaphase 1
c. Anaphase 2
d. Telophase 1
e. Both b and c
19. In a cross between a white-eyed female fruit fly and red-eyed male, what percent of the female offspring
will have white eyes? (White eyes are X-linked, recessive)
a. 100%
b. 75%
c. 50%
d. 25%
e. 0%
20. A female Drosophila of unknown genotype was crossed with a white-eyed male fly, of genotype
(w =
white eye allele is recessive, w+= red-eye allele is dominant.) Half of the male and half of the female
offspring were red-eyed, and half of the male and half of the female offspring were white-eyed. What was
the genotype of the female fly?
a. Xw Y
b. Xw Xw
c. Xw+ Xw
d. Xw+ Xw+
e. Xw+ Y
21. Hemophilia in humans is due to an X-chromosome mutation. What will be the results of mating between a
normal (non-carrier) female and a hemophiliac male?
a. 50% of sons are hemophiliacs, 50% of daughters are hemophiliacs
b. 100% of sons are hemophiliacs
c. 100% of daughters are hemophiliacs
d. 50% of sons are normal, 50% of sons are hemophiliacs and 100% of daughters are carriers
e. 100% of daughters are carriers, 100% of boys are normal
22. 19. A _________ reaction occurs when a disaccharide is formed from two monosaccharides.
a. Dehydration
b. Oxidation
c. Hydrolysis
d. Reduction
e. Hydrophilic interaction
23. Where do genetic differences in prokaryotes arise from?
a. Crossing-over during prophase 1
b. Mutations that arise during DNA replication
c. Through the independent assortment of chromosomes during meiosis
d. Recombination through the processes of transformation, transduction or transformation
e. Both c and d are correct
24. A white flower (rr) is crossed with a red flower (Rr), the F1 generation is 50% pink and 50% white. What is
this pattern of inheritance called?
a. Codominance
b. Epistasis
c. Incomplete dominance
d. Polygenic inheritance
e. Pleiotropy
25. Which of the following pathways involves the splitting of a water molecule?
a. Calvin Cycle
b. Non-cyclic electron transport
c. Cycli electron transport
d. Kreb’s cycle
e. Light-independent reactions
26. Peroxisomes….
a. Contain hydrolytic enzymes
b. Fuse with food vacuoles and digests the molecules
c. Contain enzymes that transfer hydrogen from various substrates to oxygen
d. Participate in DNA replication
e. Both a and b are correct
27. During which phase of mitosis does the nuclear envelope fragment?
a. Prophase
b. Prometaphase
c. Metaphase
d. Anaphase
e. Telophase
28. When during the cell cycle is cyclin concentration highest?
a. End of mitosis
b. Early G1
c. Late G1 / early S
d. Late S / early G2
e. Beginning of mitosis
29. The dominant P allele of a gene that controls colour in pea flowers produces flowers with a purple colour;
plants homozygous for a recessive p allele of this gene have white flowers. If a Pp plant and a Pp plant were
crossed, what would be the expected phenotypic ratios of the offspring?
a. 2 purple: 2 white
b. 1 purple : 3 white
c. 3 purple: 1 white
d. 3 white: 1 purple
e. 4 purple: 0 white
30. Which of the following consists of DNA wrapped around histone proteins?
a. Metaphase chromosome
b. Nucleosome
c. DNA double helix
d. Looped domains
e. 30 nm chromatin fibre
31. Which of the following statements describes the concept of “semi-conservative” DNA replication?
a. The two parental strands reassociate after acting as templates for new strands, thus restoring the
parental double helix.
b. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA.
c. The two strands of the parental molecule separate, and each functions as a template for synthesis of a
new, complementary strand.
d. DNA Polymerase III carries out synthesis by extending from the RNA primer (5’ to 3’)
e. That the lagging strand of DNA is synthesized in short fragments called Okazaki fragments.
Used the following information to answer questions 32 through 34 The following sequence represents a non-transcribed
strand of a gene. The transcription initiation sequence is at the first underline T. There are introns present in between,
but not including the first underlined C and second underlined T and another between but not including the underlined
A and third underlined T.
5’- GGCTTUTGTGGTATGTCATACAATTGGGCGGAGGATTTCCACATTTGTGGAGGGGTAGGCATGCC
GGTTAAAGGCCCTTAGAGTTAT – 3’
32. What would the transcribed mRNA strand leaving the nucleus look like?
a. 5’ - G UGGUGUUAUUGAUAGAUGGGGAGGUGUUACACUCUA AAAAAAAA - 3’
b. 3’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 5’
c. 5’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 3’
d. 5’ – TGTGGTATGTCATACTGTGGAGGGGTATAGAGTTAT – 3’
e. 5’ – G UGUGGAUAGCAUGCCUUAAGUCCAUGCCUUAGCGUAU AAAAAAA – 3’
33. What would the translated protein sequence of the above mRNA strand look like? (genetic code on last
page)
a. Met - Ser – Ser –Tyr – Gly – Val – His
b. Met – Ser - Tyr – Cys – Gly – Gly – Val
c. Gly – Cys – Met – Ser – Tyr – Cys – Gly – Gly – Val
d. Gly – Ser – His – Val – Leu – Ile – Val
e. Val – Gly – Leu – Trp – Cys – Ser – Gly – Gly – Val
34. If the underlined A was replaced with a C what would the resulting mutation be?
a. No mutation would occur
b. Frameshift
c. Nonsense
d. Silent
e. Missense
35. The tortoiseshell coat present on some female cats is the result of?
a. Incomplete dominance
b. Polygenic inheritance
c. X-inactivation
d. Y-inactivation
e. Codominance
36. In the fruit fly, the dominant and recessive traits for body colour and wing size are as follows:
Character
Body Colour
Wing Size
Wild Type / Dominant Type
Mutant / Recessive Trait
Grey (b+)
Normal (vg+)
Black (b)
Vestigial (b+)
The genes encoding body colour and wing size are linked. A wild-type fruit fly, heterozygous for grey body colour
and normal wings, was mated with a black fruit fly with vestigial wings. The distribution of the offspring is as
follows: 437 black with normal wings, 852 grey with normal wings, 263 grey with vestigial wings and 548 black
with vestigial wings.
What is the recombination frequency between the genes for the body colour and wing size?
a. 10%
b. 20%
c. 50%
d. 100%
e. There is no recombination
37. How many centimorgans away from each other are the above loci?
a. 25
b. 50
c. 100
d. 150
e. 200
38. A human female "carrier" who is heterozygous for the recessive, sex-linked trait red color blindness, marries
a normal male. What proportion of their female progeny will show the trait?
a.
b.
c.
d.
e.
1/4
1/2
0
All
¾
39. What is the purpose of fermentation in the absence of oxygen?
a. To regenerate NAD+ from NADH, allowing for glycolysis to continue
b. To regenerate FAD from FADH2, allowing for glycolysis to continue
c. To generate the proton gradient for ATP synthesis
d. To oxidize pyruvate
e. To generate alcohol for alcoholic beverages
40. The trp operon is a ____________ operon and its default state is ___________.
a. Inducible, expression
b. Inducible, repressed
c. Repressible, repressed
d. Repressible, expression
e. Oxidizable, expression
41. Which of the following joins two Okazaki fragments together by forming a phosphodiester bond?
a. Ligase
b. DNA Polymerase III
c. Helicase
d. Topoisomerase
e. DNA Polymerase I
42. Why do sex linked disorders predominantly affect males?
a. Because sex-linked disorders are created by dominant alleles
b. Because a recessive X allele will always be expressed in a male
c. Because sex-linked disorders are encoded on the Y chromosome
d. Because the Y chromosome is smaller than the X chromosome and is more likely to experiment
mutations
e. Sex linked disorders affect women and men in equal proportions
43. Which of the following prevents the leakage of ions or molecules between adjacent cells?
a. Desmosomes
b. Plasmodesmata
c. Tight junctions
d. Gap junctions
e. All of the above
44. Two unlinked loci affect mouse hair colour. AA or Aa mice are agouti. Mice with genotype aa are albino
because all pigment produced is blocked, regardless of the phenotype at the second locus. At the second
locus, the B allele (agouti coat) is dominant to the b allele (black coat). What would the result of a cross
between two agouti mice with the genotype AaBb?
a. 8 agouti: 4 black : 4 albino
b. 9 agouti: 3 black : 4 albino
c. 3 agouti : 9 black : 4 albino
d. 4 agouti : 8 black : 4 albino
e. 9 agouti: 4 black : 3 albino
45. Which of the following statements is true about polyploidy?
a. It alters the genetic balance.
b. It does not really alter the genetic balance.
c. Occurs when an organism had more than the diploid (2n) set of chromosomes
d. a and c are both correct
e. b and c are both correct
46. If you have a plant with blue flowers and round seeds, Bb Rr, crossed with a plant with white flowers and
round seeds, bb Rr, what is the probability of getting a plant with blue flowers and wrinkled seeds?
a. 1/8
b. 1/4
c. 1/2
d. 3/4
e. 1/16
47. Which of the following is a source of genetic variability in meiosis?
a. Independent Assortment
b. Transformation
c. Recombination
d. Fertilization
e. a, c and d are correct
48. What is required to regenerate RuBP in phase 3 of the Calvin Cycle?
a. 1 G3P, 9 ATP, 6 NADPH
b. 5 G3P, 3 ATP
c. 5 G3P, 9 ATP, 6 NADPH
d. 1 G3P, 3 ATP
e. 6 G3P, 3 ATP
49. A plant that is heterozygous for the dominant “purple” colour is crossed with a plant that is recessive for the
“white” colour. 150 plants in the F1 generation are purple. Approximately how many plants in the F1
generation are expected to be white?
a. 150
b. 25
c. 50
d. 0
e. More information is required to answer the question
50. Which of the following statements about meiosis 1 is false?
a. During anaphase 1 homologous chromosomes are pulled to opposite poles
b. During prophase 1 chromosomes condense
c. Synapsis occurs during prophase 1
d. Separation of the cytoplasm occurs during anaphase 1
e. No replication occurs after meiosis 1
51. You have a purple, tall plant with yellow, round seed, Pp TT Yr Rr crossed with a white, dwarf plant with
yellow, wrinkled seeds, pp tt Yy rr. What is the probability of getting a purple tall plant with yellow wrinkled
seeds?
a. 1/4
b. 3/8
c. 3/16
d. 1/2
e. 0
52. DNA Methylation adds –CH3 to ________.
a. Cytosine
b. Adenine
c. Cysteine
d. Guanine
e. Uracil
53. Which of the following bridges the enhancer and the promoter?
a. Activators
b. Co-Activators
c. Repressors
d. General transcription factors
e. Enhancer
54. During the metabolism of one molecule of glucose, how many molecules of NADH are produced?
a. 2
b. 4
c. 6
d. 8
e. 10
55. Which of the following can Inosine pair with?
a. Uracil
b. Guanine, Adenine or Uracil
c. Tyrosine, Uracil or Adenine
d. Cytosine, Adenine or Uracil
e. Guanine or Cytosine
56. Which of the following is true about recombination frequency?
a. Genes that are closer together have a higher rate of recombination
b. Genes that are further apart have a higher rate of recombination
c. All genes recombine at the same frequency
d. All of the above
e. None of the above
57. What did the Frye-Edidin experiment demonstrate?
a. The membrane proteins are unable to move within the plane of the plasma membrane.
b. That some membrane proteins move sideways within the plane of the plasma membrane.
c. That phospholipids can “flip-flop” across the plasma membrane.
d. That phospholipids cannot move sideways within the plane of the plasma membrane.
e. None of the above.
58. Red green colour blindness is a recessive, X-linked condition. A normal daughter of a man with red green
colour blindness marries a man who is normal for the train. If the couple has two sons, what is the
probability that both sons will be born with red green colour blindness?
a. 1/4
b. 1/2
c. 1/16
d. 1/32
e. 0
59. Which level of protein structure describes the three dimensional structure of an entire polypeptide chain?
a. Primary structure
b. Secondary structure
c. Tertiary Structure
d. Quaternary Structure
e. All of the above
60. Which of the following statements is true of the lac operon?
a. It operates when glucose is present but only if there is an absence of lactose
b. It operates when lactose is present but only if there is an absence of glucose
c. Expression will occur when an inducer binds to the repressor protein
d. a and c are both true
e. b and c are both true
1. W
h
a
t
d
i
d
t
h
e
F
r
y
e
E
d
i
d
i
n
e
x
p
e
r
i
m
e
n
t
d
e
m
o
n
s
t
r
a
t