Download View PDF

Small Interference RNA Targeting vascular endothelial growth factor
gene effectively attenuates retinal neovascularization in mice Model
Kong Yi-chun, Sun Bei, Zhao Kan-xing, Han Mei and Wang Yu-chuan
Key words:RNA inteference;VEGF;PEDF;retinal neovascularization
Abstract:
Background. The mechanism of retinal neovascularization is not understood
completely.Many growth factor are involved in the
process of retinal
neovascularization, such as vascular endothelial growth factor(VEGF),pigment
epithelium-deprived factor(PEDF), which are the represents of angiogenic and
antiangiogenic molecules respectively.Oxygen induced retinopathy(OIR) is a useful
model to investigate retinal neovascularization. The present study was to investigate
the feasibility of small interference RNA (siRNA) targeting VEGF gene in attenuating
oxygen induced retinopathy(OIR) by regulating VEGF to PEDF ratio(VEGF/PEDF).
Methods. In vitro, cultured EOMA cells were transfected with VEGF-siRNA
(psi-HITM/EGFP/VEGF siRNA)and Lipofectamine 2000 for 24 h, 48 h, and 72 h
respectively,. Expression of VEGF mRNA was evaluated by real time PCR and the
level of VEGF protein was analysed by Western blot. In vivo, OIR model mice were
established, mice(C57BL/6J) received intravitreal injection of 1 μL of mixture of
psi-HITM/EGFP/VEGF siRNA and Lipofectamine 2000. Expressions of retinal VEGF
and PEDF protein were measured by Western blot, retinal neovascularization was
observed by Fluorescein angiography and quantified.
Results. In vitro psi-HITM/EGFP/VEGF siRNA treatment significantly reduced VEGF
mRNA and protein expression. In vivo, with decreased VEGF and VEGF-PEDF ratio,
significant attenuation of neovascular tufts, avascular regions, tortuous and dilated
blood vessels were observed in the interference animals.
Conclusion. VEGF plays a important role in OIR, and transfection of VEGF-siRNA
can effectively downregulate VEGF expression in vivo, accompanied by
downregulation of VEGF-PEDF ratio, simultaneously attenuation of retinal
neovascularization was observed. These findings suggest that VEGF/PEDF may serve
as a potential target in the treatment of retinal neovascularization and RNA interfering
targeting VEGF expression represents a possible therapeutic strategy.
Tianjin Eye hospital, Tianjin Key Lab of Ophthalmology and Visual Science, Tianjin Eye Institute, Clinical
college of ophthalmology Tianjin Medical University.TianJin,300020,China. (Kong Yi-Chun, Zhao Kan-Xing,
Han Mei and Wang Yu-chuan)
Key Laboratory of Hormones and Development(Ministry of Health)Metabolic Diseases Hospital & Tianjin
Institute of Endocrinology Tianjin Medical University.TianJin,300070,China.( Sun Bei)
Correspondence to:Dr.. Kong Yi-Chun, Tianjin Eye hospital, Tianjin Key Lab of Ophthalmology and Visual
Science,
Tianjin
Eye
Institute,
Clinical
college
of
ophthalmology
University.TianJin,300020,China(Email:[email protected])
This study was supported by the scientific fund of TianJin Health Bureau(NO.2011KY31)
Tianjin
Medical
Many ocular disease such as retinopathy of prematurity (ROP), age-related
macular degeneration and Proliferative diabetic retinopathy are characterized by
retinal neovascularization. Neovascularization can lead to retinal detachment and in
final loss of vision. It is a major cause of blindness in industrialized countries. It has
been a hot topic for ophthalmologist to inhibit retinal neovascularization effectively.
One of the mechanisms of neovascularization is disorder of balance between
angiogenic stimulators and inhibitors. Of these factors, vascular endothelial growth
factor(VEGF) is a key factor. It might be a possible method to inhibit retinal
neovascularization by block VEGF expression.
In this study we show the suppression of retinal neovascularization via
knockdown of VEGF protein expression using RNA interference in vitro and in vivo.
Materials and methods
siRNA design and transfection:
Based on principle of siRNA by Elbashir et al [1], siRNA sequence of mouse
VEGF cDNA (GenBank NM_009505) was designed and chemically synthesized by
GeneCopoeia,MD. This siRNA consisted a sense strand: 5′TGCTGTGAAGATGTACTCTATCTCGTGTTTTGGCCACTGACTGACACGAGA
TAGTACATCTTCA -3′ and an antisense strand: 5′CCTGTGAAGATGTACTATCTCGTGTCAGTCAGTGGCCAAAACC-3′.
Sequences identified were BLASTed against the GenBank database.
EOMA cells purchased from Amercian Type Cultured Collection(ATCC). On
the day before transfection, Cells were seeded in a 24-well plate and placed in
antibiotics deprived DMEM supplemented with 15% (v/v) FBS. When the cells
showed 70% confluence, transfection were performed .LipofectamineTM 2000
(Invitrogen) and plasmid were diluted by 50ul serum-free DMEM. For the
transfection, cells were incubated with 50nM plasmid, either psi-HITM/EGFP or
psi-HITM/EGFP/VEGF siRNA, and 1ul of the LipofectamineTM for 6 h at 37°C.
3 groups were established in the experiment: A: blank control group(no
interference);B: negative control group(transfected with psi-HITM/EGFP) and C:
siRNA group(transfected with psi-HITM/EGFP/VEGF siRNA).
Cells were collected 24,48,72 h after transfection and analyzed based on the
intensity of EGFP monitored with a Nikon Eclipse TE2000-U immunofluorescent
microscope and recorded with a CCD digital camera attached to the microscope.
Real time RT-PCR for VEGF mRNA of cells:
After 24,48,72h transfection respectively, cells were washed with PBS twice,
total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen,
Carlsbad, CA) according to the manufacturer's protocol. cDNA was synthesized using
the cDNA Synthesis Kit (TaKaRa, Japan). Real-time PCR reactions with SYBR
Green qPCR Kit (TaKaRa, Japan) were performed with VEGF-specific primers: Fw-
CAGAAACACGACAAACCCATC and RVTAAGCCACTCACACACACAGCC.The cycling parameters were at 94°C for 30sec,
then 35 cycles at 94°C for 10 sec, at 58°C for 10 sec, and at 72°C for 15 sec. The
cycle threshold (Ct) indicates the fractional cycle number at which the PCR product
was first detected above a fixed threshold. Changes in the expression of target genes
were calculated with the 2−ΔΔCt method, where ΔΔCt = [Ct (target sample) − Ct
(β-actin sample)] − [Ct (target calibrator) − Ct (β-actin calibrator)].
Western blot analysis for VEGF expression in cells:
After 24,48,72h transfection respectively, cultured cell were collected. The
protein expression of VEGF was determined by western blot assay as previously
described [2]. In brief, total protein was extracted and 30ug protein from each sample
was separated on a 10% SDS-PAGE gel(Bio-Rad) and electrophoretically transferred
to nitrocellulose membrane(Amersham) at 120V, 2h.Membranes were blocked with
5% nonfat dry milk at 4℃ overnight and probed with primary antibody:
anti-VEGF(1:500 Santa Cruz) or anti-β-actin(1:1000 Sigma) at 37℃ for 2h, followed
by IgG-HRP conjugated secondary goat anti-rabbit antibody(BioLabs).The bands
were visualized by chemiluminescent reagent(ECL, PIERCE).Density of bands was
quantified by Bandscan 5 software and normalized to that of the β-actin band..
Animals and Oxygen Induced Retinopathy:
Neonated CB57BL/6J mice were obtained from animal institute, Chinese
Academy of Medical Sciences . Experiments were performed in accordance with the
ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the
Guideline for Care and Use of Laboratory Animals by Tianjin medical university,
China.
Neovascularization was induced as described by Smith et al.[3]. Briefly, 64
newborn CB57BL/6J mice were randomly assigned to experimental and normal
groups(A).Normal group mice(16 mice) were raised in room air throughout the period.
At postnatal day 7(p7), mice in the experimental group were exposed to hyperoxia
(75% O2) for 5 days (p 7-12) and then returned to room air to induce retinal
neovascularization.
At p12, experimental group were equally divided into 3 subgroups: blank
control(B); negative control: psi-HITM/EGFP treated (C)and VEGF siRNA
group(D).No interference performed in normal and blank control; In other two
groups:0.5ul psi-HITM/EGFP and 0.5ul lipofectomine were injected intravitreously in
one eye of each mouse, contralateral eye was co-injected with 0.5ul psi-HITM/EGFP/
VEGF siRNA and 0.5ul lipofectamine.
Intravitreal injections were performed at 11 o’clock,0.5 mm away from the
corneal limbus of the eyes using a 10 ul Hamilton syringe fitted with a 33 G needle.
Mice were chosen randomly in each group at P17:4 mice for retinal angiography,
4 mice for section and stained with hematoxylin eosin, 8 mice for Western Blot.
Retinal angiography with high molecular weight fluorescein:
Animals were anesthetized and perfused with fluorescein via retro-orbital
injection of 2.5 mg/50ul of FITC-dextran (MW 2 × 106 Sigma-Aldrich, St. Louis, MO)
as described previously.[4] The animals were immediately killed. The eyes were
enucleated and fixed with 4% paraformaldehyde in PBS for 1h. The retina was then
separated from the eyecup. 4 incisions were made to the retina, which was
flat-mounted on a gelatin-coated slide. The vasculature was then examined under a
fluorescent microscope (Nikon Eclipse TE20000-U, Nikon, Japan).
Quantification of neovascularization:
The eyes of mice from each group at p17 were enucleated, fixed with 10%
formaldehyde, 6-μm-thick sections were made through the cornea parallel to the optic
disc, and then stained with hematoxylin and eosin. The nuclei of vascular cells on the
vitreal side of the retina were counted under a light microscope in a masked study.
Ten sagittal sections from each eye were examined, and cell numbers were averaged
in each group of animals. The average number of preretinal vascular nuclei was
compared.
Western Blot analysis for VEGF and PEDF expression in retina:
Retinas of mice each group were isolated, lysed, and centrifuged. The protein
expression of VEGF,PEDF was determined by western blot assay as experiment in
vitro. 50ug protein measured by BCA assay (BCATM kit,PIERCE) from each sample
was separated on a 10% SDS-PAGE gel(Bio-Rad). After protein transferred to
nitrocellulose membrane(Amersham) ,membranes were probed with primary antibody:
anti-VEGF(1:500 Santa Cruz),anti-PEDF(1:500 Santa Cruz) , anti-β-actin(1:1000
Sigma) at 37℃ for 2h, followed by IgG-HRP conjugated secondary goat anti-rabbit
antibody(BioLabs). Density of bands was normalized to that of the β-actin band.
Statistical Analyses:
Results are expressed as mean ± SD. Statistical analysis of the data was
performed by SPSS11.5 .To compare multiple sets of data, one-way ANOVA test was
used. For paired data sets, LSD-t test was used. P < 0.05 was considered statistically
significant.
Results
In vitro efficacy of VEGF siRNA:
GFP fluorescence showed plasmid psi-HITM/EGFP/VEGF siRNA were
successfully transfected into EOMA cells (Fig.1A).To demonstrate the levels of
inhibition after transfection, cells were collected and RT-PCR analysis was performed.
Real time PCR analysis clearly demonstrated that VEGF expression was significantly
reduced by VEGF-specific siRNA but was not affected by treatment without siRNA
and there was no difference between blank control and negative control (P>0.05)
VEGF mRNA 24h post-transfection in siRNA treated cells and blank control
was0.211±0.002 and 0.312±0.004, respectively, mRNA was inhibited by 21.1%.After
48 h and 72h transfection, VEGF mRNA was inhibited by69.8 % and80.4 %
respectively.( Fig.1B)
As shown in Fig.1C, 24,48,72h post-siRNA transfection, VEGF protein level of
cells was0.717±0.033 , 0.633±0.014 , and 0.266±0.022,respectively.At the same time
point, VEGF expression in blank control was 0.868±0.025, 0.884±0.022 and
0.906±0.028,respectively.VEGF level was significantly lower in cells treated with
VEGF-specific siRNA(P=0.01,0.01,0.00).
The results demonstrated that VEGF siRNA was an effective sequence to
inhibit target gene and the capability of interference gradually increased in 72h after
transfection.
Retinal neovascularization in mice
As shown by fluorescein angiography in flat-mounted retinas(Fig.2 upper
panel), the mice raised in room air formed superficial and deep vascular layers in the
retina. A mature capillary network that extended from the optic disc to the periphery
filled in the entire retina.
The typical retinal neovascularization was observed in blank control and
negative control group (only psi-HITM/EGFP treatment), including neovascular tufts,
avascular regions, tortuous and dilated blood vessels.
The mice treated with siRNA developed light retinal neovascularization:
tortuous blood vessels and central non perfused retina area decreased, normal retinal
vasculature reappeared.
The results showed that retinal neovascularization was inhibited by VEGF
siRNA.
Quantification of retinal neovascularization in mice
There was no vascular cell nuclei broke through ILM in normal group, average
vascular cell was not significantly different between blank control group and negative
control group:60.37±6.78 and 59.89±6.56 respectively. siRNA group showed less
neovascularization, with 10.85±1.26 preretinal cells per section.(Fig.2 lower panel)
Changes in retinal VEGF,PEDF:
At P17,in relative hypoxia condition(blank control), retinal VEGF reached the
level that was 5.74 fold more than normal mice, but retinal PEDF level was decreased
by 75%.After siRNA treatment, retinal VEGF level reduced by 68% compared with
blank control, but retinal PEDF level changed reversed, which elevated by 2.29
fold(Fig.3).After siRNA application, an apparently decreased VEGF-to-PEDF
ratio(ratio=0.58) was observed, which almost returned to normal(ratio=0.18).
Nevertheless VEGF-to-PEDF ratio was markedly increased (ratio=4.19) without
siRNA treated, meanwhile more severe retinal neovascularization occurred .
Discussion
RNA interference(RNAi) is a nature mechanism exist widely in mammal. It
belongs to post-transcriptional gene silence that has been used to suppress gene
expression thus reduce their protein product. RNAi is now being exploited as a
powerful tool for inhibit genetics and shows great promise for therapeutic
applications[5][6]. This method has been successfully used to silence VEGF gene
expression in many models [7][8][9] .
Development of retinal neovascularization depends on the interaction of several
signaling events influenced by a fine balance of angiogenic agonists and antagonists.
Of many factors, two important factors are VEGF and PEDF. VEGF has long been
considered as a key angiogenic factor [10][11] and PEDF is a major angiogenic inhibitor
in the eye[12][13][14]. Thus, we used the VEGF-to-PEDF ratio as representative of the
balance between angiogenic stimulators and inhibitors to understand the mechanism
of retinal neovascularization.
In this study, siRNA were injected intravitreally during the development of
neovascularization. The results clearly indicated that, using this experimental
approach, siRNA which shown to exert specificity and potency in vitro, VEGF
expression as measured by Western blot was reduced. More importantly, treatment
with VEGF-specific siRNA greatly attenuated the neovascular response suggesting
that VEGF play a key role in the regulation of retinal neovascularization. After siRNA
treatment, VEGF-PEDF ratio ranged from 4.19 to 0.58 which approximated normal
level(ratio=0.18) .It is likely that the return the balance VEGF-PEDF ratio contributed
to the reduced neovascular response. Retinal neovascularization is mediated, at least
in part by VEGF-PEDF ratio[15][16]. It is supported by the experimental results that:1)
overexpression
of
VEGF/PEDF
in
vivo
led
to
occurrence
of
[2]
neovascularization ;and2)inhibition of VEGF-PEDF ratio significantly decreased the
extent of retinal neovascularization in this study.Although it is a effective method to
decrease active vascular features by anti-VEGF agents[17][18],some drawback also was
observed[19][20].
But there is no exact idea why VEGF siRNA lead to increased expression of
PEDF protein. It is supposed that decreased expression of VEGF caused by siRNA
attenuate retinal neovascularization; with avascular regions disappear, PEDF
expression increased; rebalance of VEGF-PEDF ratio progressively reduce retinal
neovascularization.
In summary, although the mechanism of retinal neovascularization is not
completely understood, The results of this study demonstrate that restoring the
balance of VEGF/PEDF by inhibition of VEGF expression with siRNA can attenuate
retinal neovascularization. Thus it is clear that a delicate balance between angiogenic
stimulator and inhibitor plays a key role in regulating retinal angiogenesis. Our study
reveals that siRNA to silencing VEGF may be a promising avenue for the treatment of
retinal neovascularization.
Acknowledgements: This work was finished in Tianjin Institute of
Endocrinology (Tianjin Medical University) and Tianjin Key Lab of Ophthalmology
and Visual Science (Tianjin eye hospital). The author acknowledges the assistance of
all teachers worked in labs.
REFERENCE
1.Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of
21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature.
2001;411:494–498.
2. Kong YC, Han M, Zhao KX. Expression of vascular endothelial growth factor and
pigment epithelium derived factor in mouse oxygen-induced retinopathy and its
significance. Zhonghua Yan Ke Za Zhi. 2008 Aug;44(8):734-40.chinese.
3.Smith LE, Wesolowski E, McLellan A, Kostyk SK, D'Amato R, Sullivan R, et al.
Oxygen-induced retinopathy in the mouse. Invest Ophthalmol Vis Sci.
1994;35:101–11.
4. Li S, Li T, Luo Y, Yu H, Sun Y, Zhou H et al. Retro-orbital injection of
FITC-dextran is an effective and economical method for observing mouse retinal
vessels.Mol Vis. 2011;17:3566-73.
5.Okamura K, Lai EC. Endogenous small interfering RNAs in animals. Nature
Reviews Molecular Cell Biology. 2008;9(9):673–678.
6.Lochmatter D, Mullis PE.RNA interference in mammalian cell systems.Horm Res
Paediatr. 2011;75(1):63-9.
7. Chang JH, Garg NK, Lunde E, Han KY, Jain S, Azar DT.Corneal
neovascularization: an anti-VEGF therapy review.Surv Ophthalmol. 2012
Sep;57(5):415-29.
8. Zhou HB, Yin YF, Hu Y, Li X, Zou LY, Li YJ, et al.Suppression of vascular
endothelial growth factor via siRNA interference modulates the biological behavior of
human nasopharyngeal carcinoma cells.Jpn J Radiol. 2011 Nov;29(9):615-22.
9.He XW, Yu X, Liu T, Yu SY, Chen DJ.Vector-based RNA interference against
vascular endothelial growth factor-C inhibits tumor lymphangiogenesis and growth of
colorectal cancer in vivo in mice. Chin Med J (Engl). 2008 Mar 5;121(5):439-44.
10.Kuiper EJ, Van Nieuwenhoven FA, de Smet MD, van Meurs JC, Tanck MW,
Oliver N,et al.The angio-fibrotic switch of VEGF and CTGF in proliferative diabetic
retinopathy.PLoS One. 2008 Jul 16; 3(7):e2675
11.Budd SJ, Thompson H, Hartnett ME. Association of Retinal Vascular Endothelial
Growth Factor With Avascular Retina in a Rat Model of Retinopathy of Prematurity.
Arch Ophthalmol. 2010;128:1014–21.
12.Haurigot V, Villacampa P, Ribera A, Bosch A, Ramos D, Ruberte J,et al.Long-term
retinal PEDF overexpression prevents neovascularization in a murine adult model of
retinopathy. PLoS One. 2012;7(7):e41511.
13.Kozulin P, Natoli R, O'Brien KM, Madigan MC, Provis JM.Differential expression
of anti-angiogenic factors and guidance genes in the developing macula. Mol Vis.
2009; 15:45-59.
14.Zhou XY, Liao Q, Pu YM, Tang YQ, Gong X, Li J,et al.Ultrasound-mediated
microbubble delivery of pigment epithelium-derived factor gene into retina inhibits
choroidal neovascularization. Chin Med J (Engl). 2009 Nov 20;122(22):2711-7.
15.Zheng B, Li T, Chen H, Xu X, Zheng Z..Correlation between ficolin-3 and
vascular endothelial growth factor-to-pigment epithelium-derived factor ratio in the
vitreous of eyes with proliferative diabetic retinopathy. Am J Ophthalmol. 2011
Dec;152(6):1039-43.
16.Pons M, Marin-Castaño ME.Nicotine increases the VEGF/PEDF ratio in retinal
pigment epithelium: a possible mechanism for CNV in passive smokers with AMD.
Invest Ophthalmol Vis Sci. 2011 Jun 1;52(6):3842-53.
17. Mintz-Hittner HA, Kuffel RR. Jr. Intravitreal injection of bevacizumab (avastin)
for treatment of stage 3 retinopathy of prematurity in zone I or posterior zone II.
Retina. 2008;28:831–8.
18.Chang JH, Garg NK, Lunde E, Han KY, Jain S, Azar DT.Corneal
neovascularization: an anti-VEGF therapy.Surv Ophthalmol. 2012 57(5):415-29.
19. Jang SY, Choi KS, Lee SJ. Delayed-onset retinal detachment after an intravitreal
injection of ranibizumab for zone 1 plus retinopathy of prematurity. Journal of
American Association for Pediatric Ophthalmology and Strabismus. 2010;14:457–9.
20. Spaide RF, Fisher YL. Intravitreal bevacizumab (Avastin) treatment of
proliferative diabetic retinopathy complicated by vitreous hemorrhage. Retina 2006
26: 275–278.
A
VEGF mRNA level
BB
Figure 1. Inhibition of VEGF production by VEGF-specific siRNA in EOMA
cells 24h,48h,72h after transfection respectively. A) EGFP fluorescence in
EOMA cells after transfection (X40). B) relative VEGF mRNA expression
measured by real time PCR(β-actin as control). C) relative VEGF expression
measured by Western Blot(β-actin as control)
1.control 2.24h after transfection 3.48h after transfection
4.72h after
transfection
Normal
siRNA treatment
blank control(OIR)
Figure.2 Quantification of retinal neovascularization in C57BL/6J mice.
Upper panel : representative retinal angiographs in mice(×40): compared to
normal retina, neovascular tufts, avascular regions, tortuous and dilated blood
vessels were observed in OIR(blank control).(red arrow), after siRNA were
injected,abnormal vessels diminished.(yellow arrow).
lower panel: representative retinal sections of mice(×40):compared to retina
in OIR(blank control), vascular cell nuclei broke through ILM reduced.(blue
arrow)
relative VEGF expression
①
A
B
C
D
relative PEDF expression
②
Figure.3 Retinal VEGF ,PEDF levels in retina.
①:relative VEGF expression
②: relative PEDF expression
A: normal , B: blank control,C: negative control,D: VEGF siRNA treatment