Download Inner ear and kidney anomalies caused by IAP

 1999 Oxford University Press
Human Molecular Genetics, 1999, Vol. 8, No. 4
645–653
Inner ear and kidney anomalies caused by IAP
insertion in an intron of the Eya1 gene in a mouse
model of BOR syndrome
Kenneth R. Johnson*, Susan A. Cook, Lawrence C. Erway1, Angela N. Matthews3,
L. Phillip Sanford2, Nancy E. Paradies2 and Rick A. Friedman3
The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, USA, 1University of Cincinnati, Cincinnati, OH
45221, USA, 2Children’s Hospital Medical Center, Cincinnati, OH 45267, USA and 3House Ear Institute, Los
Angeles, CA 90057, USA
Received November 18, 1998; Revised and Accepted January 17, 1999
A spontaneous mutation causing deafness and circling behavior was discovered in a C3H/HeJ colony of
mice at the Jackson Laboratory. Pathological analysis
of mutant mice revealed gross morphological abnormalities of the inner ear, and also dysmorphic or missing kidneys. The deafness and abnormal behavior
were shown to be inherited as an autosomal recessive
trait and mapped to mouse chromosome 1 near the
position of the Eya1 gene. The human homolog of this
gene, EYA1, has been shown to underly branchio-otorenal (BOR) syndrome, an autosomal dominant disorder characterized by hearing loss with associated
branchial and renal anomalies. Molecular analysis of
the Eya1 gene in mutant mice revealed the insertion of
an intracisternal A particle (IAP) element in intron 7.
The presence of the IAP insertion was associated with
reduced expression of the normal Eya1 message and
formation of additional aberrant transcripts. The hypomorphic nature of the mutation may explain its recessive inheritance, if protein levels in homozygotes, but
not heterozygotes, are below a critical threshold
needed for normal developmental function. The new
mouse mutation is designated Eya1 bor to denote its
similarity to human BOR syndrome, and will provide a
valuable model for studying mutant gene expression
and etiology.
INTRODUCTION
Hearing loss is the most common sensory deficit in humans and
affects ∼1 in 2000 live births (1). Tremendous progress has been
made during the last 5 years in mapping and cloning of genes
responsible for both syndromic and non-syndromic hereditary
hearing loss (2,3). The mouse is an excellent animal model for the
DDBJ/EMBL/GenBank accession nos AF097544–AF097546
study of these human conditions because the anatomy, function
and hereditary abnormalities of the inner ear have been shown to
be similar in both humans and mice (4,5). Genetic and molecular
analyses of mouse deafness mutations have aided the discovery
of genes that underly several human hearing loss syndromes. For
example, the mouse shaker-1 mutation (sh1) was shown to be a
mutation of Myo7a (6), and the homologous gene in humans
subsequently was shown to be responsible for both dominant
(DFNA11) and recessive (DFNB2) forms of non-syndromic
deafness (7,8), as well as for Usher syndrome type 1B (9).
Recently, the mouse shaker-2 mutation (sh2) was shown to be a
mutation of Myo15 (10), and the homologous gene in humans to
be responsible for DFNB3 (11).
In mice, mutations affecting the vestibular system of the inner
ear often result in a characteristic circling or head-bobbing
phenotype; many of these mutations also affect the cochlea and
cause deafness (4). As part of our research program at the Jackson
Laboratory to identify genes causing deafness, we have been
selecting and studying mutant mice that exhibit behavior
characteristic of vestibular dysfunction. Pathological analysis of
one such circling mutant revealed gross morphological abnormalities of the inner ear and also dysmorphic or missing kidneys.
Here, we describe the inner ear and kidney pathology of these
mutant mice and our genetic mapping results that place the new
mutation on proximal chromosome 1, near the position of the
Eya1 gene (12). The human homolog of this gene, EYA1, has been
shown to underly branchio-oto-renal (BOR) syndrome, an
autosomal dominant disorder characterized by hearing loss with
associated branchial and renal anomalies (13). Because of the
coincident map position and the mutation’s phenotypic similarity
to human BOR syndrome, we considered Eya1 to be a likely
candidate gene for the new mouse mutation and undertook a
molecular analysis of this gene in mutant mice. We show that
Eya1 mRNA expression is altered in mice homozygous for the
new mutation as compared with their normal, co-isogenic
littermates, and demonstrate that this altered expression is caused
by the spontaneous insertion of an intracisternal A particle (IAP)
element into intron 7 of the Eya1 gene.
*To whom correspondence should be addressed. Tel: +1 207 288 6228; Fax: +1 207 288 6149; Email: [email protected]
646
Human Molecular Genetics, 1999, Vol. 8, No. 4
RESULTS
Mice with circling and head-bobbing behavior were discovered
in a C3H/HeJ colony at the Jackson Laboratory. The abnormal
behavior was shown to be inherited as an autosomal recessive
trait. Affected male homozygotes would sometimes breed;
females did not. Auditory-evoked brainstem response (ABR)
threshold measurements demonstrated that homozygous mutant
mice are deaf (no evoked response to sound pressure levels >95
dB) at the earliest testable age (3–4 weeks), but heterozygotes
hear normally. Mice homozygous for the mutation were also
characterized by absent or dysmorphic kidneys.
The adult inner ears of the mutant mice displayed a number of
morphogenetic abnormalities (Fig. 1). Whole-mount preparations revealed subtle abnormalities of the pars superior, or
vestibular portion of the inner ear. Specifically, the lateral
semicircular canal, the last to appear developmentally, is
foreshortened, with a much narrower diameter than that of the
wild-type (not shown). Several of the postnatal inner ears studied
also revealed an incomplete common crus, the region of the
joined non-ampullated ends of the superior and posterior
semicircular canals (not shown). The abnormalities of the pars
inferior, or cochlear portion of the inner ear, were the most severe
and constant. All but the most basal one-quarter of the cochlea
was absent in the adult mutant inner ear (Fig. 1a and b).
Histological analysis demonstrated the rudimentary basal portion
of the mutant cochlea with a spiral ligament and no overlying stria
vascularis. Additionally, there was complete absence of the organ
of Corti, or sensory epithelium, in the mutant (Fig. 1c and d). No
abnormalities of the pharyngeal pouches were noted.
The kidney phenotype seen in post-wean mutants showed
variable expressivity, ranging from bilaterally normal kidneys to
unilateral absence (Fig. 2). Most often, bilateral deficiencies were
observed, with the left kidney being more severely affected than
the right. Even in cases of severe hypoplasia, the cellular
morphology of mutant kidneys was very similar to that of
heterozygotes and wild-type controls. However, functional stress
in mutant kidneys was indicated by plasma urea nitrogen values
which corresponded to the degree of kidney deficiency. The
reduced function of mutant kidneys, therefore, is most likely
caused by an insufficiency in the number of nephrons rather than
to structural defects at the cellular level. Plasma urea nitrogen
values ranged from 26 to 56 mg/dl (mean ± SEM = 36.0 ± 8.1,
n = 13) in mutant mice compared with 18–28 mg/dl for sibling
controls (mean ± SEM = 23.4 ± 3.0, n = 14). Student’s one-tailed
t-test indicated that the mutant urea nitrogen levels were
significantly elevated (P = 0.01). Matings between mutationcarrying mice produced small litter sizes and fewer than expected
numbers of affected mice, suggesting that homozygosity for the
mutation may sometimes cause perinatal lethality, perhaps
because of occasional bilateral kidney agenesis or severe bilateral
hypoplasia.
To map the new mutation genetically, an intercross was made
between F1 hybrids produced from matings between homozygous mutant mice and mice from the wild-derived inbred strain
CAST/Ei. Intercross progeny with obvious vestibular dysfunction were typed for polymorphic markers dispersed throughout
the genome. Linkage was found with markers on chromosome 1.
The haplotypes of 58 affected intercross progeny (116 tested
meioses) were examined to establish gene order and interlocus
recombination distances. No recombination was observed be-
tween the new mutation and the markers D1Mit68, D1Mit4 or
D1Mit52, and ∼7% recombination (8/116) was observed between
this cluster and D1Mit71. These results placed the mutation ∼10
cM from the chromosome 1 centromere, near the recently
mapped Eya1 gene (12).
DNA sequence comparisons of RT–PCR products covering the
protein-coding region of the Eya1 cDNA (nucleotides 153–1926;
12) failed to reveal any differences between mutant and control
mice; however, a gross alteration of the Eya1 gene in affected
mice compared with wild-type controls was detected by Southern
blot analysis (Fig. 3). Genomic DNA from affected homozygous
mice, heterozygotes and +/+ control mice hybridized with a 1.6
kb Eya1 cDNA probe revealed differences in banding patterns
with five restriction enzymes. The mutant fragment sizes were
larger than control fragments in EcoRI and PvuII digests and
smaller than controls in PstI, MspI and BglII digests, suggesting
that the mutation was a sizeable (3–5 kb) genomic insertion or
deletion within the Eya1 gene.
The overall size and exon–intron structure of the mouse Eya1
gene appeared similar to that described for the human EYA1 gene
(14). Because of its large size (the human EYA1 gene consists of
16 coding exons and extends over 156 kb), the region of the Eya1
gene containing the mutation was narrowed by sequential
hybridization of Southern blots with probes from increasingly
restricted portions of the Eya1 cDNA (Fig. 3). The site of the
mutation was thus refined to a 3 kb genomic region containing
exon 8.
To compare DNA sequences in the mutated region of the Eya1
gene, genomic clones were identified by screening phage libraries
from both mutant and wild-type mice with a 106 bp exon 8 probe.
Restriction site mapping was then used to localize the mutation
to intron 7 (Fig. 4), and ∼3500 nucleotides of DNA from that
region were sequenced (GenBank accession no. AF097544).
PCR amplification with various combinations of primers designed from this sequence further narrowed the region of
mutation to a 300 bp interval; primers spanning this interval failed
to amplify a product with mutant genomic DNA. Sequence
analysis of the mutant DNA clone in this region revealed an
insertion, ∼1480 bp upstream from the 3′ splice acceptor
sequence of exon 8. A BLAST search of GenBank DNA
sequences identified the insertion as an IAP transposon; 32
matches had alignment scores >200, including those IAP
elements causing pale ear (ep) and agouti (A) mutations.
The IAP insertion was in the same transcriptional orientation as
the Eya1 gene. The single mutant genomic clone did not contain
the 5′ end of the IAP element; therefore, the DNA sequence of the
cloned 3′ long terminal repeat (LTR) together with the Eya1
intron sequence 5′ to the IAP insertion site were used to amplify
the uncloned 5′ LTR junction fragment from mutant genomic
DNA. Sequence analysis of this PCR product revealed that the 5′
and 3′ LTR sequences were identical and that the IAP element
was flanked by a 6 bp direct repeat (GGTAGG), a characteristic
of retrotransposition. The nucleotide sequences of the IAP
junctions with intron 7 of the Eya1 gene have been deposited in
GenBank under accession nos AF097545 (5′LTR) and AF097546
(3′ LTR).
Northern blot analysis of total RNA from adult skeletal muscle
hybridized with a 1.6 kb Eya1 cDNA probe showed an ∼50%
reduction in the level of wild-type message in homozygous
mutant mice compared with +/+ controls (Fig. 5a). Furthermore,
in RNA from mutant mice, two transcripts of ∼7 and 10 kb were
647
Human
Genetics,
1999,
8, No.
NucleicMolecular
Acids Research,
1994,
Vol. Vol.
22, No.
1 4
647
Figure 1. Effect of the Eya1 mutation on adult inner ear morphology. Cleared whole-mount preparations (a and b) compared at equal magnification, and histological
sections (c and d, 80× magnification, and e and f, 200× magnification) of inner ears from C3H/Hej +/+ control (a, c and e) and C3H/HeJ-Eya1 bor/Eya1 bor mutant (b,
d and f) mice. Asterisks indicate the distinct interscalar septi of a normal cochlea (a); arrowheads designate a normal cochlea in the +/+ control (a) and its absence
in the mutant inner ear (b). The stria vascularis (small arrow) and organ of Corti (large arrow) shown in the +/+ control (e) are absent in the mutant inner ear (f). sl
designates the spiral ligament (e and f).
seen in addition to the 4 kb wild-type message. Additional
transcripts were also seen in RNA from eye and brain tissue of
mutant mice (data not shown); however, Eya1 expression is much
reduced and more difficult to quantify in these tissues compared
with skeletal muscle expression. RT–PCR analysis with primers
flanking exon 8 also produced additional products from mutant
RNA, larger in size than the product expected from the wild-type
Eya1 transcript (Fig. 5b).
648
Human Molecular Genetics, 1999, Vol. 8, No. 4
Figure 2. Effect of the Eya1 mutation on adult kidney morphology. Top center: autopsy of a 4-month-old male mutant showing complete absence of the left kidney.
The right kidney, indicated by an arrow, shows normal morphology. The intestinal tract was excised intentionally and the left ureter is partially obscured by the pancreas.
Both testes were present. Bottom panels: the right kidney from a 7.5-month-old female +/? control (a, d and g) is compared with the left (b, e and h) and right (c, f
and i) kidneys of a 7.5-month-old female sibling mutant: kidney whole-mounts 10× (a, b and c); longitudinal sections, 10×, H&E stained (d, e and f); and cortex sections,
bar = 100 µm, PAS (g, h and i). Although hypoplasia is obvious in both mutant kidneys, their cellular morphology is similar to that of the control kidney. However,
functional stress is indicated by elevated plasma urea nitrogen (32 mg/dl for the mutant versus 18 mg/dl for control).
649
Human
Genetics,
1999,
8, No.
NucleicMolecular
Acids Research,
1994,
Vol. Vol.
22, No.
1 4
649
Figure 3. Southern blot analysis of the Eya1 mutation. Genomic DNA from C3H/HeJ controls (+/+; lanes marked +), heterozygotes (+/Eya1 bor; lanes marked H)
and homozygous mutant mice (Eya1 bor/Eya1 bor; lanes marked M) were digested with EcoRI, PstI, PvuII, MspI and BglII and hybridized with three Eya1 cDNA probes:
(a) exons 1–13 (nucleotides 1–1600), (b) exons 5–10 (nucleotides 592–1277) and (c) exon 8 (nucleotides 992–1097). Exon numbering corresponds to Abdelhak et
al. (13) and nucleotide numbering to Xu et al. (12). The same fragment polymorphisms were detected with all three probes. The mutant fragment sizes were larger
in EcoRI and PvuII digests and smaller in PstI, MspI and BglII digests.
DISCUSSION
Both the new mouse mutation and human BOR syndrome are
caused by alterations of homologs of the Drosophila eyes absent
gene (mouse Eya1, human EYA1). These disorders are consistent
with the role of this gene in early embryonic development. BOR
syndrome is characterized by developmental anomalies of the
branchial arches (pre-auricular pits, branchial cysts, outer and
middle ear malformations), the inner ear (absent or undeveloped
cochlea and semicircular canals) and the kidneys (kidney
hypoplasia to bilateral agenesis) (13,15). The prominent features
of the mouse Eya1 mutation, including cochlear and kidney
hypoplasia, are strikingly similar to those of BOR syndrome.
The reduced, but still present, expression of normal Eya1
transcripts in affected homozygotes is evidence that the mouse
mutation is hypomorphic, which may explain its recessive nature
compared with the dominant inheritance of human BOR syndrome. The ∼50% level of Eya1 expression observed in
homozygous mutant mice (Fig. 5) might be below a critical
physiological threshold necessary for normal function, but the
expression level in heterozygous mice may be high enough to
allow normal development. The EYA1 mutations reported for
human BOR syndrome alter protein-coding sequences in exons
or disrupt splice sites (13,14,16), and thus are likely to be more
severe than the insertional disruption of an intron reported here
for the mouse. Consequently, human heterozygotes may have
gene expression levels similar to those of homozygous mice. The
additional transcripts produced by the mouse mutation are
unlikely to cause a gain of function or have dominant-negative
effects because no phenotypic abnormalities were seen in
heterozygotes even though aberrant transcripts were detected in
these mice.
The mouse genome contains ∼2000 copies of retroviral-like
IAPs (17). IAP retrotranspositions have been shown to underly
several inherited mutations in the mouse, including agouti, A
(18); pale ear, ep (19); vibrator, Pitpn vb (20); Lamb3 (21); reeler,
Reln rl (22); albino, Tyrc (23); fused, Axin Fu (24); and β-glucuronidase, Gus mps-2J (25). IAP element insertions into non-coding
introns have been shown to cause reduced expression and/or
formation of chimeric transcripts in the Pitpn vb (20), Axin Fu (24)
and Gus mps–2J (25) mutations, similar to our findings for the
Eya1 bor mutation. It is thought that IAP element insertions
introduce cryptic splice and polyadenylation sites that disrupt
normal transcript processing or stability and consequently reduce
gene expression. In the Eya1 bor mutation, the junction of the 6 bp
direct repeat with the 5′ LTR of the IAP created a consensus 5′
splice site (AGGTGTG; Fig. 4c), which, along with two LTR
polyadenylation sites, may contribute to the aberrant RNA
expression observed in northern blots and RT–PCR (Fig. 5).
The DNA sequence of the Eya1 IAP LTR (Fig. 4) indicates that
the U3 region was derived from the LS-type and the R-region
from the T-type of IAP elements; this composite LTR structure is
characteristic of other IAP insertions causing germline mutations,
most of which have occurred in the C3H/He inbred strain (25).
The Eya1 IAP LTR sequence is very similar to the LTRs of other
IAP elements isolated from C3H/He mice. It is identical to the
LTR of the IAP causing the pale ear mutation (GenBank
AF003867), except that 30 bp are deleted at the position indicated
in Figure 4, possibly the result of unequal crossing-over in this
region of imperfect CT-rich repeats.
650
Human Molecular Genetics, 1999, Vol. 8, No. 4
Figure 4. Structure and sequence of the Eya1 gene in the region of IAP insertion. (a) Gene structure and site of IAP insertion, ∼1480 bp upstream of exon 8. Exons
are indicated by black rectangles. Landmark restriction sites and PCR primers (shown as arrowheads indicating direction) are shown at their approximate locations.
(b) DNA sequence of IAP LTRs flanked by the 6 bp direct repeat sequence GGTAGG, underlined. The start of each LTR is indicated above the sequence. A 30 bp
deletion (compared with the pale ear IAP LTR, GenBank accession no. AF003867) in the CT-rich region of the LTRs is indicated by three asterisks. A consensus 5′
splice site, shown in bold, is created by the junction of the 5′ LTR with the 6 bp direct repeat. (c) PCR genotyping of mice. Two forward primers, one specific to the
IAP insertion (IAPF1) and the other specific to the 5′-flanking region of intron 7 (gF5), were combined with one reverse primer specific to the 3′-flanking region of
intron 7 (gR5). In combination, the three primers distinguish +/+ (lane 1), +/Eya1 bor (lane 2) and Eya1 bor/Eya1 bor(lane 3) genotypes. Primers IAPF1 and gR5 amplify
mutant DNA (160 bp product) but not wild-type DNA, whereas primers gF5 and gR5 amplify wild-type (285 bp product) but not mutant DNA.
In summary, we believe that retrotransposition of an IAP
element into intron 7 of the Eya1 gene is responsible for the
phenotype of the new mouse mutation for the following reasons.
(i) The inner ear and kidney abnormalities of mutant mice are
similar to the characteristic traits of human BOR syndrome,
known to be caused by mutations of the human EYA1 gene. (ii)
The new mouse mutation and the Eya1 gene co-segregated in 116
tested meioses from the linkage cross. (iii) Northern blot and
RT–PCR analyses showed that Eya1 gene expression is altered in
mutant mice compared with controls. (iv) Southern blot and DNA
sequence analysis revealed that an IAP element was present in
intron 7 of the Eya1 gene of mutant mice but not in co-isogenic
controls. (v) PCR genotyping (Fig. 4c) has confirmed that all
mutant mice are homozygous for this IAP element insertion. (vi)
Other inherited mouse mutations have been shown to be caused
by similar IAP element insertions into introns.
This new mouse model will permit studies of Eya1 gene
expression and etiology not possible in humans with BOR
syndrome. For example, linkage backcross mice homozygous for
the Eya1 mutation, with varying genetic backgrounds derived from
parental C3H/HeJ and CAST/Ei genomes, displayed variable
phenotypes for both inner ears and kidneys. Analysis of such
genetically well-defined mice will permit identification of genes that
modify the phenotypic manifestation of the Eya1 mutation and may
provide insight into causes of the incomplete penetrance and variable
expressivity characteristic of human BOR syndrome (15). The
mouse mutation also provides a means to study mutant Eya1 gene
expression during embryonic development. Other developmental
control genes such as Pax2 are also known to contribute to inner ear
and kidney patterning (26). Studies can now be undertaken to
examine the role of Eya1 in molecular pathways leading to these
common morphogenetic events.
MATERIALS AND METHODS
Genetic mapping
PCR primer pairs (MapPairs) for microsatellite markers distributed throughout the mouse genome were purchased from
Research Genetics (Huntsville, AL) and typing was performed as
651
Human
Genetics,
1999,
8, No.
NucleicMolecular
Acids Research,
1994,
Vol. Vol.
22, No.
1 4
651
gent Hearing Systems, Miami, FL) was used to obtain ABR
thresholds for clicks and for pure-tone pips at 8, 16 and 32 kHz,
as described previously (29).
Genomic DNA and RNA, and cDNA preparation
Figure 5. RNA expression analyses of mutant Eya1. (a) Northern blot analysis.
Total cellular RNA extracted from skeletal muscle of wild-type C3H/HeJ (lane
marked +) and homozygous mutant mice (lane marked M) was hybridized with
a 1.6 kb Eya1 cDNA probe (exons 1–13). Relative optical density measurements were 1300 and 730 for the normal 4 kb Eya1 transcript from wild-type
and mutant mice, respectively. The densities of the additional 7 and 10 kb
transcripts in mutant mice were 420 and 120, respectively. Density measurements for the two Actb transcripts indicated that equal quantities of RNA were
loaded in each lane. Migration positions for 28S and 18S rRNAs are shown on
the left. (b) RT–PCR analysis. cDNA prepared from skeletal muscle RNA from
one control (lane marked +) and three mutant (lanes marked M) mice was used
as PCR template with primers amplifying the exon 5–8 region (nucleotides
592–1097) (12) of the Eya1 cDNA.
previously described (27), except that PCR reactions were carried
out for 30 cycles and products were separated on 3% agarose gels
(Metaphor; FMC BioProducts, Rockland, ME) and visualized by
ethidium bromide staining. Gene order, determined by minimizing the number of obligate cross-over events, and recombination
frequency estimates were calculated with the aid of the Map
Manager computer program (28).
Histological and clinical analyses
Adult inner ears were harvested after transcardial perfusion with
1% paraformaldehyde, 1% glutaraldehyde in phosphate buffer,
pH 7.2. For light microscopy, inner ears were dissected and
post-fixed in buffered 4% OsO4, dehydrated in ethanol and
propylene oxide, and embedded in SPURR resin (Polysciences,
Warrington, PA). Semithin sections (1–2 µm) were cut with a
diamond knife and stained with 0.5% toluidine blue in 0.5%
sodium borate.
Kidneys were fixed in Bouin’s, halved longitudinally and
embedded in paraffin. Sections (5 µm) were then stained with
hematoxylin and eosin (H&E) or periodic acid–Schiff (PAS).
Plasma was obtained by retro-orbital sinus bleed, and urea
nitrogen values were assessed by Affiliated Laboratories (Bangor, ME).
ABR threshold determinations
Mice were tested at the University of Cincinnati for ABR
thresholds. A computer-assisted evoked potential system (Intelli-
Genomic DNA was prepared from mouse spleens by standard
phenol–chloroform extraction and ethanol precipitation methods.
Total RNA was purified from mouse brain, eye and skeletal
muscle tissues with TRIzol reagent, according to the manufacturer’s protocol (Gibco BRL, Gaithersburg, MD). DNA and RNA
concentrations were estimated by spectrophotometric measurements of absorbance. cDNA was prepared from total RNA from
adult mouse skeletal muscle with the SuperScript Preamplification System for First Strand cDNA Synthesis (Gibco BRL).
Southern and northern blots
Blotting, probe labeling and hybridization procedures used for
both Southern and northern blots were as previously described
(30). A 1.6 kb fragment of the mouse Eya1 cDNA, containing
most of the protein-coding sequence, was used as a probe for
initial Southern and northern blot analyses. Additional probes for
Southern analysis were produced by PCR amplification with the
primers described below. For northern analysis, 15 µg of total
RNA was loaded per lane on a 0.8% agarose gel with 2.2 M
formaldehyde, electrophoresed in 1× MOPS buffer at 2 V/cm for
4 h, vacuum blotted in 10× SSC onto a positively charged nylon
membrane, and UV cross-linked. For quantitative estimation of
transcript abundance, densitometry measurements were made on
developed X-ray film using the Computing Densitometer and
ImageQuant software from Molecular Dynamics (Sunnyvale,
CA).
Genomic clones
The wild-type Eya1 clone was isolated by standard filter
hybridization screening methods from a commercially available
lambda phage library prepared with 129/SvJ mouse genomic
DNA (Lambda FIX II; Stratagene, La Jolla, CA). The mutant
Eya1 clone was isolated from a custom-made phage library
(Lambda FIX II) prepared with genomic DNA from homozygous
mutant mice.
PCR primers
PCR primers used to amplify portions of the mouse Eya1 cDNA
for sequence comparisons and as probes for Southern blot
analysis are given in Table 1. Primers used for sequence
comparisons of genomic DNA are given in Table 2; their
approximate positions are shown in Figure 4a. Primers ex8F and
ex8R were used to amplify the genomic region around exon 8
(nucleotides 992–1097). Primers gF5 and IAPR1 were used to
amplify the junction of intron 7 with the IAP 5′ LTR. Primers gF5
and gR5 were used to amplify wild-type, but not mutant DNA.
Primers IAPF1 and gR5 were used to amplify mutant, but not
wild-type DNA. All three primers (gF5, IAPF1 and gR5) were
used simultaneously to distinguish genotypes (Fig. 4c).
652
Human Molecular Genetics, 1999, Vol. 8, No. 4
Table 1. Primers used for cDNA sequence comparisons between mutant and control
Forward primer
Reverse primer
Amplified nucleotides
EYA1F1
EYA1R4
153–833
ATGGAAATGCAGGATCTAAC
TGTGCGTACTGACCCTGGCC
EYA1F3
EYA1R6
GGAAAGTGGATTGTCACAGT
AAAAATAGATGTGTGTCTGC
EYA1F5
EYA1R8
CGTCGAGGTTCAGATGGGAA
CTATTGGAAACACAATTCCT
592–1277
1036–1720
EYA1F7
CON1R
GATCTACAACACCTACAAAA
CAGGTACTCTAATTCCAAGG
1478–1926
All primers are presented in the 5′→3′ orientation. An ‘F’ signifies a forward primer and an ‘R’ a reverse primer according to the Eya1 direction of transcription.
Nucleotide numbering corresponds to the mouse Eya1 cDNA sequence reported by Xu et al. (1997), GenBank accession no. U61110.
Table 2. Primers used for analysis of Eya1 genomic DNA
Primer
Sequence
ex8F
ACAGTCCTTCCACACCCATT
ex8R
GGAGGGGAGGGATTATTGTT
gR2
CCAGGGAGCCTGATATTTGA
gR4
TCTTCCTCACTGTGATCTTGTTG
gR6
CAGAAAAATTGATGAAACTGGAGA
gR7
GTCTCCACCATGGCTTCAAT
gF1
TGCTGAGTCCTGGTGATCTG
gF2
TAGTCCCCATGTGCTTCCAT
gF3
TAGGGCTCTTCCCAAAGCTG
gF5
TCTCCAGTTTCATCAATTTTTCTG
gR5
CAGATCACCAGGACTCAGCA
IAPR1
CAGACCAGAATCTTCTGCGA
IAPF1
TCGCAGAAGATTCTGGTCTG
Cycle Sequencing method. The same primers used for PCR
amplification were also used for cycle sequencing.
ACKNOWLEDGEMENTS
We thank Dr Richard Maas (Harvard Medical School, Boston,
MA) for his generous gift of the Eya1 cDNA clone and for sharing
primer sequence information. We thank personnel of the the
Jackson Laboratory (TJL) Microchemistry Service for rapid and
high quality DNA sequencing (Amy Lambert and Doug McMinimy) and library screening and clone purification (Kevin
Johnson). We thank Emma Lou Cardell (University of
Cincinnati) and Rod Bronson (TJL) for their histological
expertise. We also thank Patsy Nishina and Babette Gwynn (TJL)
for their careful review of this manuscript. This study was
supported by National Institutes of Health grants GM46697,
RR01183, CA34196, DC00119, and contract DC62108.
REFERENCES
For explanation, see Table 1. Primer positions are indicated in Figure 4a.
PCR reactions
The following reaction conditions were used for PCR amplifications: 20–50 ng of template DNA, 50 mM KCl, 10 mM Tris–HCl,
0.01% Triton X-100, 2.25 mM MgCl2, 100 nM of each primer,
100 µM of each of four deoxyribonucleoside triphosphates and
0.5 U of Taq DNA polymerase. Amplification consisted of one
cycle of denaturation at 94C for 3 min followed by 35 cycles,
each consisting of 94C for 15 s denaturation, 60C for 2 min of
annealing and 72C for 2 min of extension. After the 35 cycles,
the final product was extended for 7 min at 72C. PCR reaction
products were separated on 2.5% Metaphor agarose gels, stained
with ethidium bromide and visualized with UV light.
DNA sequencing
PCR-amplified products from cDNA and genomic DNA templates were excised from gels and purified with QIAquick Gel
Extraction kit (Qiagen, Valencia, CA). DNA was sequenced
using an Applied Biosystems 373A DNA Sequencer (Perkin
Elmer, Norwalk, CT) and an optimized DyeDeoxy Terminator
1. Morton, N.E. (1991) Genetic epidemiology of hearing loss. Ann. NY Acad.
Sci., 630, 16–31.
2. Kalatzis, V. and Petit, C. (1998) The fundamental and medical impacts of
recent progress in research on hereditary hearing loss. Hum. Mol. Genet., 7,
1589–1597.
3. Van Camp, G. and Smith, R.J. (1998) Hereditary Hearing Loss Homepage.
http://dnalab-www.uia.ac.be/dnalab/hhh
4. Brown, S.D. and Steel, K.P. (1994) Genetic deafness—progress with mouse
models. Hum. Mol. Genet., 3, 1453–1456.
5. Steel, K.P. (1995) Inherited hearing defects in mice. Annu. Rev. Genet., 29,
675–701.
6. Gibson, F., Walsh, J., Mburu, P., Varela, A., Brown, K.A., Antonio, M.,
Beisel, K.W., Steel, K.P. and Brown, S.D.M. (1995) A type VII myosin
encoded by the mouse deafness gene shaker-1. Nature, 374, 62–64.
7. Liu, X.Z., Walsh, J., Tamagawa, Y., Kitamura, K., Nishizawa, M., Steel, K.P.
and Brown, S.D. (1997) Autosomal dominant non-syndromic deafness
caused by a mutation in the myosin VIIA gene. Nature Genet., 17, 268–269.
8. Liu, X.Z., Walsh, J., Mburu, P., Kendrick-Jones, J., Cope, M.J., Steel, K.P. and
Brown, S.D. (1997) Mutations in the myosin VIIA gene cause non-syndromic recessive deafness. Nature Genet., 16, 188–190.
9. Weil, D., Blanchard, S., Kaplan, J., Guilford, P., Gibson, F., Walsh, J., Mburu,
P., Varela, A., Levilliers, J., Weston, M.D. et al. (1995) Defective myosin
VIIA gene responsible for Usher syndrome type 1B. Nature, 374, 60–61.
10. Probst, F.J., Fridell, R.A., Raphael, Y., Saunders, T.L., Wang, A., Liang, Y.,
Morell, R.J., Touchman, J.W., Lyons, R.H., Noben-Trauth, K., Friedman,
T.B. and Camper, S.A. (1998) Correction of deafness in shaker-2 mice by an
unconventional myosin in a BAC transgene. Science, 280, 1444–1447.
653
Human
Genetics,
1999,
8, No.
NucleicMolecular
Acids Research,
1994,
Vol. Vol.
22, No.
1 4
11. Wang, A., Liang, Y., Fridell, R.A., Probst, F.J., Wilcox, E.R., Touchman, J.W.,
Morton, C.C., Morell, R.J., Noben-Trauth, K., Camper, S.A. and Friedman,
T.B. (1998) Association of unconventional myosin MYO15 mutations with
human nonsyndromic deafness DFNB3. Science, 280, 1447–1451.
12. Xu, P.-X., Woo, I., Her, H., Beier, D.R. and Maas, R.L. (1997) Mouse Eya
homologues of the Drosophila eyes absent gene require Pax6 for expression
in lens and nasal placode. Development, 124, 219–231.
13. Abdelhak, S., Kalatzis, V., Heilig, R., Compain, S., Samson, D., Vincent, C.,
Weil, D., Cruaud, C., Sahly, I., Leibovici, M., Bitner-Glindzicz, M., Francis,
M., Lacombe, D., Vigneron, J., Charachon, R., Boven, K., Bedbeder, P., Van
Regemorter, N., Weissenbach, J. and Petit, C. (1997) A human homologue of
the Drosophila eyes absent gene underlied branchio-oto-renal (BOR)
syndrome and identifies a novel gene family. Nature Genet., 15, 157–164.
14. Abdelhak, S., Kalatzis, V., Heilig, R., Compain, S., Samson, D., Vincent, C.,
Levi-Acobas, F., Cruaud, C., Le Merrer, M., Mathieu, M., Konig, R.,
Vigneron, J., Weissenbach, J., Petit, C. and Weil, D. (1997) Clustering of
mutations responsible for branchio-oto-renal (BOR) syndrome in the eyes
absent homologous region (eyaHR) of EYA1. Hum. Mol. Genet., 6,
2247–2255.
15. OMIM (1998) Online Mendelian Inheritance in Man (OMIM) (Baltimore,
MD: Center for Medical Genetics, Johns Hopkins University URL:
http://www3.ncbi. nlm. nih. gov/omim/ ).
16. Kumar, S., Kimberling, W.J., Weston, M.D., Schaefer, B.G., Berg, M.A.,
Marres, H.A. and Cremers, C.W. (1998) Identification of three novel
mutations in human EYA1 protein associated with branchio-oto-renal
syndrome. Hum. Mutat., 11, 443–449.
17. Kuff, E.L. and Lueders, K.K. (1988) The intracisternal A-particle gene
family: structure and functional aspects. Adv. Cancer Res., 51, 183–276.
18. Duhl, D.M., Vrieling, H., Miller, K.A., Wolff, G.L. and Barsh, G.S. (1994)
Neomorphic agouti mutations in obese yellow mice. Nature Genet., 8, 59–64.
19. Gardner, J.M., Wildenberg, S.C., Keiper, N.M., Novak, E.K., Rusiniak, M.E.,
Swank, R.T., Puri, N., Figner, J.N., Hagiwara, N., Lehman, A.L., Gales, T.L.,
Bayer, M.E., King, R.A. and Brilliant, M.H. (1997) The mouse pale ear (ep)
mutation is the homologue of human Hermansky–Pudlak syndrome. Proc.
Natl Acad. Sci. USA, 94, 9238–9243.
653
20. Hamilton, B.A., Smith, D.J., Mueller, K.L., Kerrebrock, A.W., Bronson, R.T.,
van Berkel, V., Daly, M.J., Kruglyak, L., Reeve, M.P., Nemhauser, J.L.,
Hawkins, T.L., Rubin, E.M. and Lander, E.S. (1997) The vibrator mutation
causes neurodegeneration via reduced expression of PITPa: positional
complementation cloning and extragenic suppression. Neuron, 18, 711–722.
21. Kuster, J.E., Guarnieri, M.H., Ault, J.G., Flaherty, L. and Swiatek, P.J. (1997)
IAP insertion in the murine LamB3 gene results in junctional epidermolysis
bullosa. Mamm. Genome, 8, 673–681.
22. Royaux, I., Bernier, B., Montgomery, J.C., Flaherty, L. and Goffinet, A.M.
(1997) Relnrl-Alb2, an allele of reeler isolated from a chlorambucil screen, is
due to an IAP insertion with exon skipping. Genomics, 42, 479–482.
23. Wu, M., Rinchik, E.M., Wilkinson, E. and Johnson, D.K. (1997) Inherited
somatic mosaicism caused by an intracisternal A particle insertion in the
mouse tyrosinase gene. Proc. Natl Acad. Sci. USA, 94, 890–894.
24. Vasicek, T.J., Zeng, L., Guan, X.-J., Zhang, T., Costantini, F. and Tilghman,
S.M. (1997) Two dominant mutations in the mouse Fused gene are the result
of transposon insertions. Genetics, 147, 777–786.
25. Gwynn, B., Lueders, K., Sands, M.S. and Birkenmeier, E.H. (1998)
Intracisternal A-particle element transposition into the murine beta-glucuronidase gene correlates with loss of enzyme activity: a new model for
beta-glucuronidase deficiency in the C3H mouse. Mol. Cell. Biol., 18,
6474–6481.
26. Torres, N., Gomezpardo, E. and Gruss, P. (1996) Pax2 contributes to inner ear
patterning and optic nerve trajectory. Development, 122, 3381–3391.
27. Dietrich, W., Katz, H., Lincoln, S.E., Shin, H.-S., Friedman, J., Dracopoli,
N.C. and Lander, E.S. (1992) A genetic map of the mouse suitable for typing
intraspecific crosses. Genetics, 131, 423–447.
28. Manly, K.F. (1993) A Macintosh program for storage and analysis of
experimental genetic mapping data. Mamm. Genome, 4, 303–313.
29. Erway, L.C., Willott, J.F., Archer, J.R. and Harrison, D.E. (1993) Genetics of
age-related hearing loss in mice: I. Inbred and F1 hybrid strains. Hear. Res.,
65, 125–132.
30. Johnson, K.R., Cook, S.A. and Davisson, M.T. (1992) Chromosomal
localization of the murine gene and two related sequences encoding
high-mobility-group I and Y proteins. Genomics, 12, 503–509.