Download Role of photosynthesis and analysis of key enzymes involved in

Journal of Experimental Botany, Vol. 61, No. 13, pp. 3675–3688, 2010
doi:10.1093/jxb/erq187 Advance Access publication 30 June, 2010
RESEARCH PAPER
Role of photosynthesis and analysis of key enzymes involved
in primary metabolism throughout the lifespan of the tobacco
flower
Gabriela Leticia Müller, Marı́a Fabiana Drincovich, Carlos Santiago Andreo* and Marı́a Valeria Lara
Centro de Estudios Fotosintéticos y Bioquı́micos. Facultad de Ciencias Bioquı́micas y Farmacéuticas. Suipacha 531. Rosario (2000).
Argentina
* To whom correspondence should be addressed: E-mail: [email protected]
Received 15 April 2010; Revised 28 May 2010; Accepted 1 June 2010
Abstract
Although the physiological and economical relevance of flowers is recognized, their primary metabolism during
development has not been characterized, especially combining protein, transcript, and activity levels of the different
enzymes involved. In this work, the functional characterization of the photosynthetic apparatus, pigment profiles,
and the main primary metabolic pathways were analysed in tobacco sepals and petals at different developmental
stages. The results indicate that the corolla photosynthetic apparatus is functional and capable of fixing CO2; with
its photosynthetic activity mainly involved in pigment biosynthesis. The particular pattern of expression, across the
tobacco flower lifespan, of several proteins involved in respiration and primary metabolism, indicate that petal
carbon metabolism is highest at the anthesis stage; while some enzymes are activated at the later stages, along
with senescence. The first signs of corolla senescence in attached flowers are observed after anthesis; however,
molecular data suggest that senescence is already onset at this stage. Feeding experiments to detached flowers at
anthesis indicate that sugars, but not photosynthetic activity of the corolla, are capable of delaying the senescence
process. On the other hand, photosynthetic activity and CO2 fixation is active in sepals, where high expression levels
of particular enzymes were detected. Sepals remained green and did not show signs of senescence in all the flower
developmental stages analysed. Overall, the data presented contribute to an understanding of the metabolic
processes operating during tobacco flower development, and identify key enzymes involved in the different stages.
Key words: Flower, metabolism, photosynthesis, tobacco.
Introduction
The petal, which is one of the two non-reproductive
organs of the flower, serves to protect the floral reproductive organs and to attract pollinators ensuring pollination
and fertilization. The maintenance of petals is costly in
terms of respiratory energy, nutrients, and water loss
(Stead et al., 2006). Carbohydrates are usually produced
by photosynthesis in the green source tissues and transported to the flowers buds, and the distribution among the
various floral organs depends on the phase of developmental stage (Clément et al., 1996). On the other hand, some
reports indicate that photosynthesis in floral organs is
important in reducing the cost of reproduction (Aschan
and Pfanz, 2003); however, the flowers per se have been
largely ignored in photosynthesis research. There are only
a few cases in which the photosynthesis of corollas has
been reported, and even in those, studies were conducted
Abbreviations: DCMU, 3-(3,4-dichlorophenyl)-1,1-dimethylurea; AOX, alternative oxidase; F0, basal fluorescence; COX, cytochrome c oxidase; ef, elongation factor;
ETC, electron transport chain; FBPase, fructose-1,6-bisphosphatase; G6P-DH, glucose-6-P dehydrogenase; il, isocitrate lyase; MDH, malate dehydrogenase; Fm,
maximum fluorescence; MS, Murashige–Skoog medium; NADP-ME, NADP-malic enzyme; QNP, non-photochemical quenching; PEPC, phosphoenolpyruvate
carboxylase; PRK, phosphoribulokinase; qp, photochemical quenching; PSII, Photosystem II; PCD, programmed cell death; PK, pyruvate kinase; PPDK, pyruvate
orthophosphate dikinase; PPFD, photosynthetic photon flux density; QRT-PCR, quantitative real-time RT-PCR; RuBisCO LSU, ribulose-1,5-bisphosphate carboxylase/
oxygenase large subunit; SBPase, sedoheptulose-1,7-bisphosphatase; VPE, vacuolar processing enzyme.
ª The Author [2010]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.
For Permissions, please e-mail: [email protected]
3676 | Müller et al.
on flowers which have green corollas, or on young flower
buds (Weiss and Halevy, 1991).
After pollination, petals undergo senescence, in which the
term ‘senescence’ is considered to be a synonym of developmental programmed cell death (PCD; van Doorn and
Woltering, 2008). Senescence is a highly regulated developmental process that is tightly controlled by multiple genes.
At the cellular level, PCD is characterized by an increase in
the activity of a variety of degradative enzymes, a decrease
in lipid, protein, and nucleic acid levels, rupture of the
tonoplast, and degradation of the cell walls (Yamada et al.,
2006). In the corolla, many senescence-related genes that
regulate PCD have been identified using differential screening and microarray analysis (Panavas et al., 1999; Eason
et al., 2002; Hunter et al., 2002; van Doorn et al., 2003;
Breeze et al., 2004; Yamada et al., 2007). However, it is
unclear whether the decrease in carbon levels during
both petal and leaf senescence, is the result of C recycling
or tissue respiration (Himelblau and Amasino, 2001;
Verlinden, 2003).
The visual and textural quality of flower petals is of
commercial significance, with international trade in cut
flowers worth more than 4–4.5 billon dollars annually
(O’Donoghue et al., 2009). Thus, it is surprising that the
primary metabolism of flowers has not been analysed in
depth. Only anthocyanin biosynthesis has been intensely
studied as an integral part of the development of many
flowers and its accumulation is accompanied by petal
growth. In addition, the role of light in flavonoid synthesis
has largely been explored with respect to the regulation of
flavonoid gene expression (i.e. light is required for chalcone
synthase gene expression; Moscovici et al., 1996; Schuurink
et al., 2006). However, a complete understanding of flower
primary metabolism is lacking. Multilevel analysis of
primary flower metabolism is necessary in order to identify
key enzymes involved in each developmental stage; which
may help in the identification of cultivars with improved
flower quality or better post-harvest performance. Moreover, there is virtually no information on sepal metabolism.
In this work, a multilevel approach was adopted to analyse
transcript profiles, enzyme content or activity of the main
primary metabolic pathways and pigment profiles of
tobacco flowers at different developmental stages. The
objectives of this study were (i) to assess the gas exchange
and the photosynthetic electron transport capacity of sepals
and petals throughout the developmental stages of the
flower, (ii) to investigate the relevance of photosynthetic
properties to flower metabolism, and (iii) to obtain an
insight into the metabolic changes occurring during flower
development.
Materials and methods
Plant growth conditions and treatments
Plants of Nicotiana tabacum (L. cv. Petit Havana SR1) were grown
from seeds in a compost:sand:perlite mixture (2:1:1 by vol.).
Seedlings were transferred to a greenhouse with a 30/18 C 16/8 h
day/night period and 200 lmol m2 s1 photosynthetic photon
flux density (PPDF). Whole corollas were collected at different
developmental stages (1, 3, 6, 7, and 9; Fig. 1A, B) as described by
Serafini-Fracassini et al. (2002) by observing corolla size, shape,
and colour. These stages are divided from closed corolla (stage 1)
through anthesis (stage 6) to death (stage 9) and are morphologically and physiologically distinguished (Serafini-Fracassini et al.,
2002).
For incubation experiments, flower at anthesis were excised
from the plant at the base of the pedicel. Cut flowers were placed
in Murashige–Skoog medium (MS) as the control or in MS
solutions containing 200 mM sucrose or fructose or glucose or
mannitol or 60 lM 3-(3,4-dichlorophenyl)-1,1-dimethylurea
(DCMU) or with 200 mM sucrose plus 60 lM DCMU. Samples
were taken at 24, 48, and 72 h after immersion. Cut flowers were
kept under the same light conditions specified above.
Entire sepals and petals, and young leaves from unflowered
plants, were immediately frozen in liquid N2 and stored at –80 C
for further analysis, with the exception of Evans Blue staining, gas
exchange, and chlorophyll fluorescence experiments for which
fresh tissue was used.
Evans Blue staining
Cell integrity was determined by the Evans Blue Staining method
described by Delledonne et al. (2001) with some modifications.
Tissues were incubated during 2 h with 0.1% (w/v) Evans Blue
solution and washed with distilled water. After washing with
abundant water, chlorophylls were removed by washing with 96%
(v/v) ethanol. Dead cells were visualized by the blue staining.
Quantitative measurements were carried out by solubilization of
the fixed colorant in 50% (v/v) ethanol, 1% (w/v) SDS solution at
60 C for 30 min. Solutions were spectrophotometrically measured
at 600 nm.
Protein extraction
Total soluble protein from the different tobacco tissues was
extracted using a buffer containing 100 mM TRIS-HCl, pH 7.8,
1 mM EDTA, 10 mM MgCl2, 15 mM b-mercaptoethanol, 20%
(v/v) glycerol, and 1 mM phenylmethylsulphonylfluoride, in the
presence of 33 ll of protease inhibitor cocktail (Sigma, St Louis,
MO, USA) mg1 of fresh tissue. The supernatant of crude extracts
was desalted in a cold Sephadex G-25 column pre-equilibrated
with the above buffer according to Penefsky (1977). This extract was used for activity measurements or, alternatively, diluted
in 0.25 M TRIS-HCl, pH 7.5, 2% (w/v) SDS, 0.5% (v/v)
b-mercaptoethanol, and 0.1% (v/v) bromophenol blue and boiled
for 2 min for SDS-PAGE. In the case of D1 protein analysis,
protein thylakoids were extracted as in Tambussi et al. (2004).
Protein concentration was determined by the method of
Bradford (1976) using the Bio-Rad protein assay reagent (BioRad, Hercules, CA, USA) and bovine serum albumin as
standard.
Enzyme assay
The activity of enzymes was measured spectrophotometrically in
a final volume of 1 ml at 30 C and 340 nm using a UNICAM
Helios b spectrophotometer (UNICAM instruments, Cambridge,
England). The reaction mixtures used for each enzyme were as
follows.
Glucose-6-P dehydrogenase (G6P-DH): 50 mM TRIS-HCl, pH 8.0,
10 mM MgCl2, 0.15 mM NADP, and 3 mM Glc-6-P (Esposito
et al., 2005).
NADP-malic enzyme (NADP-ME): 50 mM TRIS-HCl, pH 7.3,
0.5 mM NADP, 10 mM L-malate, and 10 mM MgCl2. The
reaction was started with malate (Lara et al., 2003).
Nicotiana tabacum flower metabolism | 3677
Fig. 1. Characterization of the developmental stages of Nicotiana tabacum flowers. Morphological characterization of flowers (A, B) at
different developmental stages (1, 3, 6, 7, and 9) and Evans Blue stained petals (C) and sepals (D) are shown. Chlorophyll content (E)
was measured in sepals (circles) and petals (triangles) and anthocyanin content (E) in petals (triangles, dotted line) at the different
developmental stages. For comparison, green leaves chlorophyll content is indicated as a dotted reference line. Water content (F)
expressed as fresh:dry weight (FW/DW) ratio in sepals (circles) and petals (triangles) and in leaves (dotted reference line) are also shown.
Expression analysis of transcripts encoding il (G) and vpe3 (H), determined by QRT-PCR, was carried out with RNA isolated from flowers
collected at stages 1, 3, 6, 7, and 9 in the sepals (black bars) and petals (grey bars). Y axis refers to the fold difference in a particular
transcript level relative to the amount found in green leaves (dashed lines). For each tissue, values with the same letters are not significant
different (P <0.05). Values represent the mean of at least three independent determinations using different flowers 6SD.
Phosphoenolpyruvate carboxylase (PEPC): 100 mM TRIS-HCl,
pH 8.0, 20% (v/v) glycerol, 10 mM MgCl2, 10 mM NaHCO3, 4 mM
PEP, 0.15 mM NADH, and 10 U of malate dehydrogenase (MDH;
Lara et al., 2003).
SDS-PAGE and Western blot analysis
SDS-PAGE was carried out using 10% or 15% (w/v) polyacrylamide gels according to Laemmli (1970). Proteins were visualized
with Coomassie blue or electroblotted onto a nitrocellulose
membrane for immunoblotting according to Burnette (1981).
Bound antibodies were located by linking to alkaline phosphataseconjugated goat anti-rabbit IgG according to the manufacturer’s
instructions (Bio-Rad).
The antibodies used for detection were the following: 1:200 antiAmaranthus viridis PEPC (Colombo et al., 1998); 1:10 000 against
spinach RuBisCO large subunit (RuBisCO LSU, provided by
Dr A Viale; National University of Rosario, Argentina); 1:2000
3678 | Müller et al.
against D1 protein of Solanum nigra (Guiamet et al., 1991); 1:1000
anti-Zea mays L. pyruvate orthophosphate dikinase (PPDK,
Chastain et al., 2000); 1:100 against Brassica napus fructose-1,6bisphosphatase (FBPase, Moorhead et al., 1994); 1:2000 against
pyruvate kinase (PK) from Brassica napus (Plaxton et al., 1989).
The molecular masses of the polypeptides were estimated from
a plot of the log of molecular mass of marker standards versus
migration distance. Densitometric analysis of the bands detected in
at least three independent blots was performed for each enzyme.
Chlorophyll quantitation
Total chlorophyll was extracted in 80% (v/v) acetone. After
clarification, chlorophyll a and b contents were determined as
described by Wintermans and Mots (1965).
Pigment extraction and analysis
Anthocyanins: Anthocyanins were extracted in methanol containing 1% (v/v) HCl for 24 h in the dark and estimated by measuring
the absorbance at 530 nm (Weiss et al., 1988).
Flavonoids: Frozen petals (250 mg) were ground in liquid nitrogen
and then extracted with 1 ml methanol. For the hydrolysis of
flavone glucosides, 4.5 ml 10% (v/v) HCl was added before
incubation at 100 C for 90 min. The hydrolysis solution was
extracted twice with ethyl acetate. The ethyl acetate fraction
was evaporated and redissolved in 500 ml methanol. This solution
was filtered through a 0.22 lm filter (Millipore) and analysed by
high performance liquid chromatography (HPLC; Äkta, GE).
HPLC was carried out with a reverse phase column Luna 5 l C18
(4.6–250 mm, Phenomenex) using 50% (v/v) methanol and 3% (v/v)
acetic acid as the solvent for 20 min at 40 C at a flow rate of
1.0 ml min1. Flavone was quantified by monitoring the peak area
of absorbance at 330 nm, with quercetin and kaemferol as the
standards. The peaks obtained were also checked with a UV
absorbance spectrum. HPLC analysis was performed as described
previously Nishihara et al. (2005).
Chlorophyll fluorescence
Measurements were performed using a Chlorophyll Fluorescence
Package containing a Fluorometer F1, from Qubit Systems Inc.
(Kingston, On., Canada). The beam was aimed at an area of
535 mm, which was in the region joining the tube and the limb in
corollas, as performed in petunia (Weiss et al., 1988). At the
beginning of each measurement, plant material was dark-adapted
for 20 min. Basal fluorescence with open PSII centres (F0 and F0# ),
was measured with modulated weak red light. A saturating white
light pulse (3000 lmol m2 s1; duration 0.8 s) was applied to
determine the maximum chlorophyll fluorescence at closed PSII
centres in the dark (maximum fluorescence, Fm) and during actinic
light illumination Fm# . The steady-state chlorophyll fluorescence
level (Fs) was recorded during actinic light illumination (150 lmol
m2 s1). Fv/Fm was calculated as (Fm–F0)/Fm. Photochemical
quenching qp was calculated as (Fm# Fs =Fm# F0# ) and nonphotochemical quenching QNP was estimated as Fm Fm# =Fm# .
PSII efficiency was calculated using the following equation:
Fm# Fs =Fm# .
Gas exchange analysis
CO2 exchange was measured with an infrared gas analyser (IRGA)
from Qubit Systems Inc., Kingston, On., Canada (Lara
et al., 2003). Detached young leaves, petals, or sepals were weighed
and sealed in the gas exchange chamber with a PPFD of
150 lmol m2 s1 provided by a LED source and 25 C. Data are
expressed as nmol CO2 seg1 g1 FW.
RT-PCR
Total RNA from different tissues of tobacco was isolated from
0.04–0.10 g of tissue using the Trizol method, according to the
manufacturer’s instructions (Invitrogen). The integrity of the RNA
was verified by agarose electrophoresis. The quantity and purity of
RNA were determined spectrophotometrically. First-strand cDNA
was synthesized with MoMLV-reverse transcriptase following the
manufacturer’s instructions (Promega, Madison, WI, USA) using
2 lg of RNA and oligo(dT).
Quantitative real-time PCR
Relative expression was determined by performing quantitative
real-time PCR (QRT-PCR) in an iCycler iQ detection system and
the Optical System Software version 3.0a (Bio-Rad, Hercules, CA,
USA), using the intercalation dye SYBRGreen I (Invitrogen) as
a fluorescent reporter, with 2.5 mM MgCl2, 0.5 lM of each primer
and 0.04 U ll1 GoTaq (Promega). PCR primers were designed
based on tobacco cDNA sequences published in GenBank and
N. tabacum ESTs databases (TIGR Plant Transcript Assemblies;
http://plantta.tigr.org; Childs et al., 2007), with the aid of the webbased program ‘primer3’ (http://www.frodo.wi.mit.edu/cgi-bin/
primer3/primer3_www.cgi) in a way to produce amplicons of 150–
300 bp in size (Table 1). A 10-fold dilution of cDNA obtained as
described above was used as a template. PCR controls were
performed in the absence of added reverse transcriptase to ensure
RNA samples were free of DNA contamination. Cycling parameters were as follows: initial denaturation at 94 C for 2 min, 40
cycles of 96 C for 10 s, and 58 C for 15 s, 72 C for 1 min, and
72 C for 10 min. The SYBRGreen I fluorescence of the doublestrand amplified products was measured at 78 C. Melting curves
for each PCR reaction were determined by measuring the decrease
of fluorescence with increasing temperature (from 65 C to 98 C).
The specificity of the PCR reactions was confirmed by melting
curve analysis using the software as well as by agarose gel
electrophoresis of the products. Relative gene expression was
calculated using the comparative 2DDCT method (Livak and
Schmittgen, 2001) and elongation factor (ef) as the reference gene.
Table 1. Sequences of forward and reverse primers used in realtime RT-PCR for gene expression analysis in flowers at different
stages
In the last column, the accession numbers from GenBank* or
N. tabacum ESTs databases (TIGR Plant Transcript Assemblies;
http://plantta.tigr.org; Childs et al., 2007) of the sequences used for
primer design are shown.
Gene
ID
Forward
primer
sequence (5# to 3#)
Reverse
primer
sequence (5# to 3#)
Accession
no.
nadpme1
nadpme2
nadpme3
sbpase
pepc
prk
cox
aox1
aox2
vpe3
il
aggacaggaatatgccgaac
ctagttccgtactttgcaagg
DQ923119*
tgggcaggaatactatgacttc
gagtggtaccatatttagccaac DQ923118*
gtaccaatcgagtgactaatactg tcttaattcaggatggggttag
EH663836
atacaacagaaattggagaagg
ggtagaggtggtacagtaggaag
tctcatggattccttgtggt
tccgatctacccctaaatcc
ttattggactgttaagtccctt
ttattggaccgtcaaggctctc
gactgggactgccttaaatcc
tctcaatgtgtggttgatgc
TA13615
X59016*
TA12632
TA12588
TA12501
TA12502
TA13611
TA13483
agtttcgccttggtagttgg
atgttcaagggtagcagcag
gaaacctgttccattgttgc
ttacatcctccacgctcttc
agtgttttgatccatccc
ttgatccatcctccactctg
tcatgcactaaaacccctctg
gtcccagtcccagaaaagat
Nicotiana tabacum flower metabolism | 3679
Each cDNA sample was run in triplicate and repeated in at least
three independent set of treatments.
Statistical analysis
Data from the quantitative real-time experiments were tested using
one-way analysis of variance (ANOVA). Minimum significance
differences were calculated by the Bonferroni, Holm-Sidak,
Dunett, and Duncan tests (a¼0.05) using the Sigma Stat Package.
Results
Identification of different developmental stages in
tobacco flowers
By using morphological markers (Fig. 1A, B), different
developmental stages of tobacco flowers were identified
(Serrafini-Fracassini et al., 2002). Whole corollas and sepals
were collected separately at stages 1, 3, 6, 7, and 9, which
are representative of the main process in tobacco flower
lifespan (Fig. 1A, B). In order to develop a better description of the stages, pigments such as chlorophylls and
anthocyanins, and water content status (fresh:dry weight
mass ratio) were measured (Fig. 1E, F). From stages 1–3
the corollas are mostly green, which is supported by the
highest chlorophyll levels in the first stage (Fig. 1A, B, E).
The transition from stage 3 to 4 is characterized by the
beginning of anthocyanin accumulation (Fig. 1A, B, E).
Accumulation of anthocyanins is largely in the upper part
of the flower (the limb) which becomes pink, while the lower
part (the tube) is white with a light greenish tint. Anthesis
occurs at the end of stage 6. Stage 7 shows the first signs of
senescence; the corolla starts losing turgidity (Fig. 1F) and,
in some cases, fading is observed. The very basal part
exhibits a brown ring that marks the future abscission zone
(Fig. 1A). At stage 9, which is characterized by cell death,
the corolla is dry and it is easily detached from the
receptacle. Regarding sepals, water content was constant
during flower development (Fig. 1F), while chlorophyll
increased, reaching the highest levels in the last stages
(Fig. 1E). Chlorophyll content in sepals was similar to that
in leaves, while it was more than six-times lower in petals
(Fig. 1E).
Petals showed intense Evans Blue accumulation at stage 9
in the area defined between the distal petal and the basal
tube (Fig. 1C). With the exception of coloration in the cut
area, sepals in all stages did not show signs of cell death,
evaluated by Evans Blue staining (Fig. 1D).
In addition, the levels of expression of two transcripts
that were previously suggested as senescence markers (van
Doorn and Woltering, 2008), vacuolar processing enzyme 3
(vpe3) involved in macroautophagy and isocitrate lyase (il)
participating in the glyoxylate cycle, were quantified by
QRT-PCR (Fig. 1G, H). Petals exhibited maximum il and
vpe3 expression at anthesis and the following stage. There
was a 100-fold increase in vpe3 compared with the first
stage. In the case of sepals, il levels were also highest at
stage 6 while vpe3 reached maximum amounts at stage 9
(Fig. 1G, H).
Photosynthetic traits of tobacco flowers
Chlorophyll fluorescence parameters and photosystem II
analysis: The photochemical quenching coefficient (qp) provides a measure for the oxidative state of the primary
acceptor of photosystem II (PSII). Both sepals and petals
showed practically the same values for flowers collected at
the different developmental stages, with values similar to qp
of green leaves (Fig. 2A). In addition, non-photochemical
quenching (NPQ) was similar in petals and sepals at the
different developmental stages, and similar to the value of
leaves (Fig. 2B). By contrast, PSII efficiency of the flower
organs was lower than that of leaves (Fig. 2C). At anthesis
(stage 6), both sepals and petals displayed maximum
efficiencies. While, in sepals, the values were lower prior to
anthesis, in petals, this parameter decreased after anthesis
(Fig. 2C). Fv/Fm values during development followed a similar
trend to PSII efficiency (Fig. 2D). In addition, on a soluble
protein basis, the amount of D1, a PSII reaction centre
protein, was lower during the first developmental stages in
both petals and sepals compared with leaves (Fig. 3A).
However, petals showed similar levels of immunoreactive
protein to those in the leaf following anthesis (Fig. 3A).
CO2 assimilation, gas exchange rates, and analysis of Calvin
cycle enzymes: In sepals, net rates of CO2 assimilation on
a fresh weight basis were observed in flowers in the light in
all stages analysed but to a lower extent than that of green
leaves (Fig. 4A). By contrast, a net release of CO2 was
measured in petals collected during the day (Fig. 4A), which
was more pronounced during anthesis and the stages
thereafter (stages 6 and 7, respectively). In the case of
petals, analysis of the rates of respiration was also
performed in the dark for flowers collected during the day.
The difference in the CO2 exchange in the light and dark for
samples collected during the light period was calculated
(Fig. 4B). In this way, even though net CO2 release was
observed in petals during the day (Fig. 4A), CO2 fixation by
photosynthesis occurred in petals in stages 1 and 3
(Fig. 4B). On the other hand, after anthesis, no CO2
fixation was observed (Fig. 4B). In addition, a net CO2
release was observed in flowers collected during the night
period and analysed in the dark (night-time dark respiration), which was similar in both sepals and petals in all
developmental stages, similar to that of leaves (Fig. 4C).
Regarding enzymes of the Calvin Cycle, Western blot
analysis revealed the presence of the RuBisCO large subunit
(RuBisCO LSU) in both tobacco petals and sepals;
nevertheless, the expression in these organs on a soluble
protein basis was considerably lower than in leaves, with the
lowest amount observed in petals (Fig. 3A; note the
different amounts of total proteins for flower and leaf
samples). In petals, the RuBisCO LSU was lower in stage 9,
while in sepals the amount of immunoreactive protein
decreased at anthesis and thereafter (Fig. 3A). Transcripts
encoding sedoheptulose-1,7-bisphosphatase (sbpase) and
phosphoribulokinase (prk), both enzymes exclusively participating in carbon assimilation, were also detected in
3680 | Müller et al.
Fig. 2. Chlorophyll fluorescence analysis of flowers at different developmental stages. Photochemical and non-photochemical
quenching (A, B), Photosystem II efficiency (C) and Fv/Fm (D) were measured at different developmental stages. Mean values 6SD of
three individual determinations using different flowers at stages 1, 3, 6, 7, and 9 are shown. Sepals are represented by filled circles and
petals by open triangles. For each tissue, values with the same letters are not significantly different (P <0.05). Parameters estimated for
green tobacco leaves were used as reference and shown as dashed line.
flowers (Fig. 3B). In sepals, both transcripts displayed the
highest levels during the time of anthesis, which were similar
to the levels detected in leaves. In the case of petals, the
highest amounts were found in the first stage (Fig. 3B).
Analysis of enzymes involved in carbon and oxidative–
reductive metabolism
In order to get an insight into flower primary metabolism,
the level of a number of enzymes was evaluated in the petals
and sepals of flowers at different developmental stages. This
was accessed by the semi-quantification of Western blot
analysis or by activity assays (Fig. 5A, C). In addition, the
levels of transcripts encoding some of these proteins were
quantified by QRT-PCR (Fig. 5B).
Pyruvate kinase (PK) and pyruvate orthophosphate
dikinase (PPDK), both involved in pyruvate production
from PEP, were semi-quantified. PK levels in both the
sepals and petals were lower than in the leaves and
remained practically constant during the different stages of
flower development. In the case of petals, two immunoreactive bands were detected (Fig. 5A). PPDK was not detected
in tobacco sepals and barely detected in tobacco leaves. On
the other hand, with the exception of the first stage, levels of
PPDK in petals were more than 20 times higher than those
in tobacco leaves (Fig. 5A).
Malic enzymes also catalyse pyruvate production using
malate as the substrate. Transcripts encoding a plastidic
(Nt-nadp-me1) and two cytosolic (Nt-nadp-me2 and 3)
NADP-MEs were quantified (Fig. 5B). Nt-nadp-me3, which
is mainly expressed in tobacco vegetative tissues (Müller
et al., 2008) was detected neither in petals nor in sepals. Ntnadp-me1 and Nt-nadp-me2 showed a different pattern of
expression through flower development in both tissues
studied. On the one hand, the level of Nt-nadp-me1 was
almost constant in sepals but variable in petals at the
different developmental stages. On the other hand, Nt-nadpme2 was variable in sepals and constant in petals. Expression of Nt-nadp-me1 was notably high, with the levels in
petals in stage 3 almost 300-times higher than in leaves
(Fig. 5B), and about 40-times higher in sepals. Regarding
Nt-nadp-me2, the level of this transcript in sepals was also
higher than in leaves, but lower in petals—with the
exception of stage 3. NADP-ME activity was constant in
sepals during flower development and similar to that in the
leaf. By contrast, in petals, higher levels were measured,
especially in stages 6 and 7 (Fig. 5C).
Phosphoenolpyruvate carboxylase (PEPC) content, evaluated either at the protein as well as at the transcript level,
did not vary among sepals at different stages, while a higher
PEPC expression was observed in petals at stages 6 and 7
(Fig. 5). The change in the level of PEPC protein correlated
with enzyme activity in both the tissues analysed, with
increases in PEPC activity in petals at stage 7 (Fig. 5C).
The cytosolic fructose-1,6-bisphosphatase (FBPase) immunoreactive protein level was practically constant in all
the sepal samples analysed and similar to that in leaves,
Nicotiana tabacum flower metabolism | 3681
Fig. 3. Analysis of proteins involved in photosynthetic electron transport and in Calvin cycle in tobacco flowers at different developmental
stages. (A) Western blot analysis was conducted using antibodies against D1 protein and RuBisCO LSU. Twenty five micrograms of
soluble protein from sepals (S) and petals (P) were downloaded in each lane, except for RuBisCO LSU where 5 lg was loaded in the lane
of the tobacco leaf. In the case of D1 Western blots, proteins were extracted from isolated thylakoids as described in the Materials and
methods. As the reaction control, proteins from a green tobacco leaf (L) were used. Molecular mass of immunoreactive proteins are
shown on the left and expressed in kDa. The quantification of the immunoreactive bands expressed in relation to the amount in green
leaves (dashed line) is shown below each Western blot (n¼2 or 3). (B) Expression analysis of sbpase and prk determined by QRT-PCR.
Analyses were made with RNA isolated from flowers at different stages of development. The means of the results obtained, using three
independent RNAs as a template, are shown. Y axis refers to the fold difference in a particular transcript level relative to its amount found
in green leaves (dashed lines). For each tissue, values with the same letters are not significantly different (P <0.05). Sepals, black bars;
petals, grey bars.
while in petals, higher amounts were semi-quantified from
stages 3 to 7 (Fig. 5A). With respect to glucose-6-P
dehydrogenase (G6P-DH), in sepals the activity was similar
to that in leaves and remained constant in all the stages
analysed. By contrast, in petals, the activity was similar to
that in leaves in stages 1 and 9 and increased in stages 3 to 7
(Fig. 5C).
With the aim of exploring respiration in flowers, transcripts encoding cytochrome c oxidase (cox) and alternative
oxidase (aox1 and aox 2), involved in the ‘classic’ and
‘alternative’ electron transport pathways, respectively, were
also quantified at different stages (Fig. 5B). In sepals, cox
levels were higher than those in leaves, showing an
expression peak at anthesis. In petals, cox expression was
also highest in stage 6; nevertheless, the levels in the other
stages were similar to those in the leaf (Fig. 5B). A high
level of expression was observed for aox1 in both the sepals
and petals in comparison to the leaf. Aox1 was greatly
increased in sepals at stage 7 while in petals the increase was
observed during anthesis (Fig. 5B). With respect to aox2,
the highest expression was observed at stage 9, in both
sepals and petals (Fig. 5B).
3682 | Müller et al.
Fig. 4. Gas exchange analysis of tobacco flowers at different
developmental stages. Sepals (filled circles) and petals (open
triangles) were collected at stages 1, 3, 6, 7, and 9. Green leaves
were measured as a control; the values obtained are shown as
a reference dashed line. (A) Daytime CO2 exchange measurement
of flowers. CO2 gas exchange was evaluated in samples collected
during the day and under 150 lmol m2 s1. (B) Estimation of
daytime CO2 fixation rate in petals. The difference between the
CO2 exchange in the light (A) and in the dark is shown for petals
collected during the day. (C) Night-time dark respiration. CO2 gas
exchange in the dark was measured in tobacco flowers collected
during the night. Values represent the mean of at least three
independent determinations using different flowers 6SD.
Positive and negative values represent CO2 uptake and release,
respectively. For each tissue, values with the same letters are
not significant different (P <0.05).
Effect of sugar feeding and inhibition of photosynthesis
on flower senescence
To understand the connection between photosynthesis,
sugar levels, and senescence, two inhibitors of the photo-
synthetic electron transport, DCMU and atrazine, which
block the electron flow toward plastoquinone in PSII, were
applied to cut flowers kept in MS medium at anthesis
(stage 6). In addition, flowers were fed with different
sugars in the absence or presence of the photosynthesis
inhibitors. Since both compounds produced essentially the
same effects on tobacco flowers, only the results using
DCMU are presented. In all cases, flowers were visually
inspected for visible signs of senescence (see Supplementary Fig. S1 at JXB online) and Evans Blue accumulation
as an indicator of cell death was measured spectrophotometrically (Fig. 6A).
After 24 h of incubation in MS or MS+DCMU, in both
treatments an increase in the Evans Blue staining was
observed, while symptoms of petal senescence, such as
loss of turgidity, were visible at 48 h (see Supplementary
Fig. S1 at JXB online). Thereafter, death was extended in
petals and in both cases, a complete phenotype of
senescence was observed after 72 h (see Supplementary
Fig. S1 at JXB online). On the other hand, exogenous
sugars (sucrose, glucose or fructose) in the presence or
absence of DCMU, delayed senescence, which was visible
after 72 h and very apparent after 96 h of incubation (see
Supplementary Fig. S1 at JXB online; Fig. 6A). On the
other hand, incubation with mannitol delayed senescence
to a lesser extent than sugar feeding (see Supplementary
Fig. S1 at JXB online), suggesting that the osmotic effect
is not the only reason for this phenomenon. Photosynthetic efficiency was evaluated in all samples, after 24 h
and 48 h of incubation. After 48 h of keeping the cut
flowers in MS a decrease in this parameter was observed
in both petals and sepals (not shown). DCMU significantly decreased the PSII quantum yield in both petals
and sepals, independently of the presence of sucrose,
indicating that this inhibitor entered the cells (not
shown).
Pigment content was also evaluated in the presence of
photosynthesis inhibitors (Fig. 6B, C). In cut flowers kept
either in MS or supplemented with sucrose, an increase in
the absorbance at 530 nm at 48 h with respect to time
0 was observed in petals (Fig. 6B). The same trend was
observed in flowers in planta, with increases at stage 6
(Fig. 1E). On the other hand, DCMU not only prevented
the increase, but also caused a decrease in the anthocyanin levels after 48 h (Fig. 6B). Moreover, the addition of
sucrose could not prevent the decrease observed in the
presence of DCMU (Fig. 6B). Flavonoid content in petals
was also analysed by HPLC-UV after 48 h of incubation
of the cut flowers in MS, and in the presence of DCMU
or sucrose (Fig. 6C). In the presence of DCMU, a 20%
decrease in the main peak of absorbance at 330 nm with
respect to the peak observed in flowers kept either in MS
or supplemented with sucrose was observed (Fig. 6C).
The main flavonoids detected in tobacco petals, quercetin
and kaemferol (Nakatsuka et al., 2007), were used as
controls, which displayed practically the same retention
time as the peak observed in cut flowers by this technique
(Fig. 6C).
Nicotiana tabacum flower metabolism | 3683
Fig. 5. Analysis of proteins involved in carbon metabolism and respiration, in tobacco flowers at different developmental stages. (A)
Western blot analysis using antibodies against phosphoenolpyruvate carboxylase (PEPC), pyruvate orthophosphate dikinase (PPDK),
fructose-1,6-bisphosphatase (FBPase), and pyruvate kinase (PK). Twenty-five micrograms of total soluble protein from sepals (upper
panel) and petals (lower panel) were downloaded in each lane. As a reaction control, proteins from a green tobacco leaf were used.
3684 | Müller et al.
Discussion
Photosynthesis is carried out in petals and sepals of
tobacco flowers
Data presented in the present work indicate that, although
to a lesser extent than in leaves, tobacco sepals and petals
are capable of fixing CO2 in the early developmental stages
(Fig. 4). In petals, the maximal chlorophyll concentration,
achieved at an early developmental stage was about 20% of
leaves. The maximum yield of PSII obtained in the light
(150 PPFD) and maximum Fv/Fm values were 50% of those
of leaves (Figs 1E, 2D). In petals, although net CO2 release
was observed in the light, light minus dark rates of CO2
exchange indicate substantial fixation of CO2 by photosynthesis during the first stages (Fig. 4B). In agreement,
RuBisCO LSU protein, and prk and sbpase transcripts were
also higher during the first stages (Fig. 3). In sepals, net
carbon uptake by photosynthesis was observed during all
the stages analysed (Fig. 4A), and higher levels of RuBisCO
LSU protein, prk, and sbpase than in petals were observed,
with increases in prk and sbpase during anthesis (Fig. 3).
Overall, the results obtained indicate that, although the
flower organ functions mainly as a sink, the photosynthetic
apparatus is operative and contributes to the supply of
organic C in some developmental stages. Carbon gain by
the flower through photosynthesis during the day could
offset carbon losses by respiration at night.
Photosynthetic electron transport in tobacco petals is
required for pigment biosynthesis
After anthesis, no net CO2 uptake was detected in tobacco
flowers (Fig. 4B); however, the photosynthetic electron
transport is still operating (Fig. 2). Inhibitors of the electron
transport chain (ETC) were used at this stage to analyse its
role in pigment content (Fig. 6). In cut flowers kept either in
MS or supplemented with sucrose, an increase in the
anthocyanin content was observed after 48 h, indicating
that endogenous compounds were enough to support
pigment biosynthesis which was not interrupted due to
detachment (Fig. 6B). However, DCMU produced a decrease in anthocyanin content, which could not be prevented by the presence of sucrose (Fig. 6B). Moreover,
DCMU also induces a decrease in flavonoid content in
relation to the levels observed in the presence of sucrose
(Fig. 6C). Therefore, a plausible hypothesis is that electrons
absorbed by the photosynthetic ETC in petals are, at least
in part, sustaining pigment biosynthesis. In Petunia flowers,
which show active chloroplasts even at advanced stages,
certain photosynthetic metabolites like products of PSI were
proposed to have a role in pigmentation (Weiss et al., 1988;
Smillie et al., 1999). Moreover, it was previously observed
that DCMU does not exert a direct inhibition on the
enzymes of the pigment biosynthetic pathways, for example,
on phenylalanine ammonia lyase (PAL) activity. Thus, light
is not only important in the transcriptional control of genes
involved in pigment biosynthesis, as in the case of PAL
induction (Koes et al., 2005); but, it also has a direct and
important role in pigment biosynthesis.
Role of photosynthesis and sugars after anthesis
Feeding cut tobacco flowers with sugars in MS media at
stage 6 delayed senescence signs by about 1 d (see Supplementary Fig. S1 at JXB online; Fig. 6A). Since mannitol
exerted an intermediate effect between the presence or
absence of sugars (see Supplementary Fig. S1 at JXB
online), it suggests sugars have an effect through metabolism that is not only osmotic. On the other hand, the
presence of DCMU did not significantly affect the time of
cell death establishment with respect to flowers in MS
(Fig. 6A). In addition, in flowers incubated with sucrose,
DCMU did not affect the senescence delay, besides differences in pigment concentrations (Fig. 6). Overall, these
results indicate that corolla photosynthetic ETC is not
involved in the senescence process in tobacco flowers; but
conversely, sugars have a role in delaying this process. This
result reinforces the idea that the photosynthetic ETC after
anthesis in petals is not involved in sugar biosynthesis, with
no net CO2 fixation (Fig. 4B), and that its principal role is
related to pigment biosynthesis. Previous studies on cut
flowers have also shown that exogenous sugars delay flower
senescence; but, it was not established if they produced
a specific effect or if they simply improved water relations
(van Doorn, 2008). As sugars regulate the ethylene response
by inhibiting the expression of genes involved in its
synthesis and signalling (Wingler and Roitsch, 2008), it is
possible that exogenous sugars could inhibit the ethylene
response and thus, delay the senescence process.
Anthesis is characterized by active metabolism and
respiration in petals
After anthesis, there is an increase in the respiration rate in
petals both during the day and at night (Fig. 4). In addition,
proteins participating in mitochondrial ETC are also
Molecular mass of immunoreactive proteins are shown on the left and expressed in kDa. The quantification of the immunoreactive bands
is expressed in relation to the amount in green leaves (reference dashed line) shown below each Western blot (n¼2 or 3). (B) Expression
analysis of aox, nadp-me, pepc, and cox, determined by QRT-PCR. Analyses were made with RNA isolated from flowers at different
stages of development. The means of the results obtained, using three independent RNAs as a template, are shown. Y axis refers to the
fold difference in a particular transcript level relative to its amount found in green leaves (dashed lines). (C) PEPC, NADP-ME, and G6PDH activity measurement. Total activity is expressed in International Units mg1 of total soluble protein. Values obtained in tobacco
leaves are shown as a reference dashed line. Standard deviations are shown. For each tissue, values with the same letters are not
significantly different (P <0.05). Sepals, black bars; petals, gray bars.
Nicotiana tabacum flower metabolism | 3685
translocation (Siedow and Umbach, 1995; Vanlerberghe,
1997). Heat production in flowers such as lilies has been
related to the release of volatile compounds, which attract
insects (Meeuse and Raskin, 1988) as well as in the
generation of a warm environment for them (Seymour,
2004; Seymour and Gibernau, 2008).
Other enzymes involved in cytosolic carbon metabolism
such as FBPase, PPDK and PEPC are highest at anthesis
(Fig. 5). PPDK levels are remarkably high in petals, in
comparison to leaves, probably denoting the participation
of this enzyme in PEP metabolism. The shikimate pathway
uses PEP and erythrose-4-P and provides precursors for the
biosynthesis of various primary and secondary metabolites
such as anthocyanins. During the anthesis stage, a major
rate of increase in the anthocyanin content is observed,
although the levels start increasing at stage 3 (Fig. 1E).
Higher levels of PPDK could support PEP provision for
pigment biosynthesis. Since part of the pigment biosynthesis
takes place in the plastids (Saito et al. 2006), the plastidic
NADP-ME1, which transcripts levels are highest at this
stage, could work in a concerted manner with PPDK
providing pyruvate for PPDK and NADPH for flavonoids
biosynthesis (Casati et al., 1998). In addition, G6P-DH
activity, which produces NADPH, is also high during
anthesis (Fig. 5C).
Onset of senescence and metabolism in tobacco petals
Fig. 6. Effect of photosynthesis inhibition and sugar feeding on
senescence and pigment content. Flowers collected at anthesis
were kept in MS media and fed with the following compounds:
sucrose, DCMU or sucrose+DCMU. (A) The degree of cell death
was quantified every 24 h during a 4 d period by spectrometric
measurement of Evans Blue accumulation and expressed relative
to the absorbance at time 0. (B) Anthocyanins were quantified in
petals immediately after excision (0 h) or after 24 h and 48 h of
incubation. (C) Flavonoid compounds were extracted after 48 h of
flower incubation in MS (solid line) and in the presence of DCMU
(dashed line) or sucrose (dotted line). Biological triplicates were run
for each condition. Right upper chromatograph shows profiles
obtained for the standards quercetin (solid line) and kaemferol
(dotted line). In (A) and (B), standard deviations are shown and
values with the same letters are not significantly different (P <0.05).
increased at this stage, as accounted for by maximum
expression levels of cox, the terminal electron carrier, and
a dramatic increase of aox1, which bypasses COX (Fig. 5).
AOX1 may participate in thermogenesis since free energy
released during electron flow is not used for proton
In the present work, flower anthocyanin content is maximum at stage 7 but dehydration is already observed
(Fig. 1E, F). The following biochemical and molecular
results are indicative of petal senescence at stage 7:
(i) maximum il levels (Fig. 1G), (ii) increased respiration
rate (Fig. 4), (iii) increased PEPC activity, which contributes
to the supply of carbon skeleton compounds for nitrogen
compounds synthesis (Fig. 5C), and (iv) a high level of
FBPase expression enabling gluconeogenesis (Fig. 5A). On
the other hand, PPDK was proposed as an earlier marker of
senescence in A. thaliana (Lin and Wu, 2004), and enhanced
PPDK expression in senescing broccoli florets (Page et al.,
2001) and Brassica napus (King and Morris, 1994;
Buchanan-Wollaston, 1997) has also been described. However, in tobacco petals, PPDK is not specifically induced at
this stage, probably because the levels are already high. On
the other hand, since il and vpe3 increase at anthesis, it
raises the question whether senescence has already begun at
this stage (Fig. 1H). Petal senescence in Ipomoea nil starts
before the flowers open, with a few mesophyll cells showing
ultrastructural features of senescence (Yamada et al., 2009).
This could also be true for tobacco flowers where at least
some senescence-related processes may start before the
anthesis.
At stage 9, there is extended cell death in the corolla
(Fig. 1C). However, not all the cells were stained with Evans
Blue. On the one hand, there is a moderate to large decline
in some proteins, transcripts, and activities (Figs 2–5).
However, other transcripts, proteins, and metabolites are
found at their highest levels, with remarkable increases in
3686 | Müller et al.
aox2 and D1 protein (Figs 1, 3, 5). Therefore, at this stage
there is a high metabolic activity, probably due to carbon
mobilization. Nevertheless, impairment of the pentose
phosphate pathway (G6P-DH decrease, Fig. 5C), together
with a decrease in photosynthesis (Fig. 2) and NADP-ME
(Fig. 5), could result in insufficient production of NADPH
for membrane repair processes and for the maintenance of
cellular redox states.
Sepal metabolism
Sepals are modified leaves, which remain green in all the
flower developmental stages analysed, with the highest
level of chlorophyll in the latter stages, similar to those of
the leaf (Fig. 1E). Although a lower PSII efficiency and
RuBisCO level were detected in sepals than in leaves
(Figs 2C, 3A), net CO2 uptake in sepals was measured
during all the developmental stages analysed (Fig. 4A).
On the other hand, sbpase and prk levels were similar in
petals and leaves, especially at stage 6 (Fig. 3B). G6PDH, PEPC, and NADP-ME activities were similar in
leaves and sepals; however, differences in the levels of
transcripts encoding enzymes involved in the respiration
process such as aox1, aox2, and cox were found (Fig. 5),
indicating active mitochondrial processes in the sepals. It
is also notable the higher levels of nadp-me2 in sepals
than in petals and leaf (Fig. 5B). Specific roles for each
NADP-ME isoform have been suggested in Arabidopsis,
and it is likely that the protein encoding nadp-me2
may have a particular physiological role in this tissue
(Maurino et al., 2009).
During the period of time analysed, neither dehydration
(Fig. 1A) nor cell death was detected in sepals by Evans
Blue staining (Fig. 1D). In addition, even after corolla
abscission sepals remained green (not shown). Nonetheless,
i1 and vpe3 are greatly increased in stages 7 and 9,
respectively (Fig. 1G, H). Therefore, the timing of senescence is different in sepals and in petals. Nevertheless, it is
clear that in both petals and sepals vpe3 and il increases
before signs of senescence are observed; suggesting that
these transcripts could be used as earlier markers of
senescence.
Supplementary data
Supplementary data are available at JXB online.
Supplementary Fig. S1. Effects of sugar feeding and
photosynthetic transport inhibition on flower senescence.
Acknowledgements
This work was funded by grants from CONICET (PIP No.
5224) and from Agencia Nacional de Promoción Cientı́fica
y Tecnológica (PICT No. 32233). CSA, MFD, and MVL
and are members of the Researcher Career of CONICET,
and GLM is a fellow of the same institution.
References
Aschan G, Pfanz H. 2003. Non-foliar photosynthesis: a strategy of
additional carbon acquisition. Flora 198, 81–97.
Bradford MM. 1976. Rapid and quantitative method for quantitation
of microgram quantities of protein utilizing the principle of protein–dye
binding. Analytical Biochemistry 72, 248–252.
Breeze E, Wagstaff C, Harrison E, Bramke I, Rogers H, Stead A,
Thomas B, Buchanan-Wollaston V. 2004. Gene expression
patterns to define stages of post-harvest senescence in Alstroemeria
petals. Plant Biotechnology Journal 2, 155–168.
Buchanan-Wollaston V, Ainsworth C. 1997. Leaf senescence in
Brassica napus: cloning of senescence related genes by subtractive
hybridization. Plant Molecular Biology 33, 821–834.
Burnette WN. 1981. ‘Western blotting’. Electrophoretic transfer of
proteins from sodium dodecyl sulfate-polyacrylamide gels to
unmodified nitrocellulose and radiographic detection with antibody and
radioiodinated protein A. Analytical Biochemistry 112, 195–203.
Casati P, Drincovich MF, Andreo CS, Donahue R, Edwards G.
1998. UV-B, red and far-red light regulate induction of the C4 isoform
of NADP-malic enzyme in etiolated maize seedlings. Australian Journal
of Plant Physiology 25, 701–708.
Chastain CJ, Botschner M, Harrington GS, Thompson BJ,
Mills SE, Sarta G, Chollet R. 2000. Further analysis of the maize C4pyruvate, orthophosphate dikinase phosphorylation by its bifunctional
regulatory protein using selective substitutions of the regulatory Thr456 and catalytic His-458 residues. Archives of Biochemistry and
Biophysics 375, 165–170.
Childs KL, Hamilton JP, Zhu W, Ly E, Cheung F, Wu H,
Rabinowicz PD, Town CD, Buell CR, Chan AP. 2007. The TIGR
Plant Transcript Assemblies database. Nucleic Acids Research 35,
D846–851.
Clément C, Burrrus M, Audran JC. 1996. Floral organ growth and
carbohydrate content during pollen development in Lilium. American
Journal of Botany 83, 459–469.
Colombo SL, Andreo CS, Chollet R. 1998. The interaction of
shikimic acid and protein phosphorylation with PEP carboxylase from
the C4 dicot Amaranthus viridis. Phytochemistry 48, 55–59.
Delledonne M, Zeier J, Marocco A, Lamb C. 2001. Signal
interactions between nitric oxide and reactive oxygen intermediates in
the plant hypersensitive disease resistance response. Proceedings of
the National Academy of Sciences, USA 23, 13454–13259.
Eason JR, Ryan DJ, Pinkney TT, O’Donoghue EM. 2002.
Programmed cell death during flower senescence: isolation and
characterization of cysteine proteinases from Sandersonia aurantiaca.
Functional Plant Biology 29, 1055–1064.
Esposito S, Guerriero G, Vona V, Di Martino Rigano V,
Carfagna S, Rigano C. 2005. Glutamate synthase activities and
protein changes in relation to nitrogen nutrition in barley: the
dependence on different plastidic glucose-6P dehydrogenase
isoforms. Journal of Experimental Botany 56, 55–64.
Guiamet JJ, Schwartz E, Pichersky E, Noodén LD. 1991.
Characterization of cytoplasmic and nuclear mutations affecting
chlorophyll and chlorophyll-binding proteins during senescence in
soybean. Plant Physiology 96, 227–231.
Nicotiana tabacum flower metabolism | 3687
Himelblau E, Amasino RM. 2001. Nutrients remobilized from leaves
of Arabidopsis thaliana during leaf senescence. Journal of Plant
Physiology 158, 1317–1323.
Panavas T, Pikula A, Reid PD, Rubinstein B, Walker EL. 1999.
Identification of senescence-associated genes from daylily petals.
Plant Molecular Biology 40, 237–248.
Hunter DA, Steele BC, Reid MS. 2002. Identification of genes
associated with perianth senescence in daffodil (Narcissus
pseudonarcissus L. ‘Dutch Master’. Plant Science 163, 13–21.
Penefsky H. 1977. The reversible binding of Pi by beef heart
mitochondrial adenosine triphosphatase. Journal of Biological
Chemistry 252, 2891–2899.
King GA, Morris SC. 1994. Early compositional changes during
postharvest senescence of broccoli. Journal of American Society of
Horticultural Science 119, 1000–1005.
Plaxton WC. 1989. Molecular and immunological characterization of
plastid and cytosolic pyruvate kinase isozymes from castor-oil-plant
leaf and endosperm. European Journal of Biochemistry 181, 443–451.
Koes R, Verweij W, Quatrrocchio F. 2005. Flavonoids: a colorful
model for the regulation and evolution of biochemical pathways.
Trends in Plant Science 10, 236–242.
Saito R, Fukuta N, Ohmiya A, Itoh Y, Ozeki Y, Kuchitsu K,
Nakayama M. 2006. Regulation of anthocyanin biosynthesis involved
in the formation of marginal picotee petals in Petunia. Plant Science
170, 828–834.
Laemmli UK. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Lara MV, Disante K, Podestá FE, Andreo CS, Drincovich MF. 2003.
Induction of a crassulacean acid like metabolism in the C4 succulent
plant, Portulaca oleracea L.: physiological and morphological changes
are accompanied by specific modifications in phosphoenolpyruvate
carboxylase. Photosynthesis Research 77, 241–254.
Schuurink RC, Haring MA, Clark DG. 2006. Regulation of volatile
benzenoid biosynthesis in petunia flowers. Trends in Plant Science 11,
20–25.
Lin JF, Wu SH. 2004. Molecular events in senescing Arabidopsis
leaves. The Plant Journal 39, 612–628.
Serafini-Fracassini D, Del Luca S, Monti F, Poli F, Sacchetti S,
Bregoli AM, Biondi S, Della Mea M. 2002. Transglutaminase activity
during senescence and programmed cell death in the corolla of
tobacco (Nicotiana tabacum) flowers. Cell Death and Differentiation 9,
309–321.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2–DDCT. Methods 25,
402–408.
Seymour RS. 2004. Dynamics and precision of thermoregulatory
responses of eastern skunk cabbage Symplocarpus foetidus. Plant,
Cell and Environment 27, 1014–1022.
Maurino VG, Gerrard Wheeler MC, Andreo CS, Drincovich MF.
2009. Redundancy is sometimes seen only by the uncritical: does
Arabidopsis need six malic enzyme isoforms? Plant Science 176,
715–721.
Seymour RS, Gibernau M. 2008. Respiration of thermogenic
inflorescences of Philodendron melinonii: natural pattern and
responses to experimental temperatures. Journal of Experimental
Botany 59, 1353–1362.
Meeuse BJD, Raskin I. 1988. Sexual reproduction in the arum lily
family, with emphasis on thermogenicity. Sexual Plant Reproduction 1,
3–15.
Siedow JN, Umbach AL. 1995. Plant mitochondrial electron transfer
and molecular biology. The Plant Cell 7, 821–831.
Moorhead GBG, Hodgson RJ, Plaxton WC. 1994. Copurification of
cytosolic fructose-1,6- bisphosphatase and cytosolic aldolase from
endosperm of germinating castor oil seeds. Archives of Biochemistry
and Biophysics 312, 326–335.
Moscovici S, Moalem-Beno D, Weiss D. 1996. Leaf mediated light
responses in petunia flowers. Plant Physiology 11, 1275–1282.
Müller GL, Drincovich MF, Andreo CS, Lara MV. 2008. Nicotiana
tabacum NADP-malic enzyme: cloning, characterization and analysis
of the biological role. Plant and Cell Physiology 49, 469–480.
Nakatsuka T, Abe Y, Kakizaki Y, Yamamura S, Nishihara M.
2007. Production of red-flowered plants by genetic engineering of
multiple flavonoid biosynthetic genes. Plant Cell Reports 26,
1951–1959.
Nishihara M, Nakatsuka T, Yamamura S. 2005. Flavonoid
components and flower color change in transgenic tobacco plants by
suppression of chalcone isomerase gene. FEBS Letters 27,
6074–6078.
Smillie RM, Hetherington SE, Davies WJ. 1999. Photosynthetic
activity of calyx, green shoulder, pericarp and locular parenchyma of
tomato fruit. Journal of Experimental Botany 50, 707–718.
Stead AD, van Doorn WG, Jones ML, Wagstaff C. 2006. Flower
senescence: fundamental and applied aspects. In: Ainsworth C, ed.
Flowering. Annual Plant Reviews, 20. Oxford, UK: Blackwells Ltd.
Tambussi EA, Bartola CG, Guiamet JJ, Belgrano J, Araus JL.
2004. Oxidative stress and photodamage at low temperatures in
soybean (Glycine max L. Merr.) leaves. Plant Science 167, 19–26.
van Doorn WG. 2008. Is the onset of senescence in leaf cells of intact
plants due to low or high sugar levels?. Journal of Experimental Botany
59, 1963–1972.
van Doorn WG, Balk PA, van Houwelingen AM, Hoeberichts FA,
Hall RD, Vorst O, van der Schoot C, van Wordragen MF. 2003.
Gene expression during anthesis and senescence in Iris flowers. Plant
Molecular Biology 53, 845–863.
van Doorn WG, Woltering EJ. 2008. Physiology and molecular biology
of petal senescence. Journal of Experimental Botany 59, 453–480.
O’Donoghue EM, Somerfield SD, Watson LM, Brummell DA,
Hunter DA. 2009. Galactose metabolism in cell wall of opening and
senescing petunia petals. Planta 229, 709–721.
Vanlerberghe GC. 1997. Alternative oxidase: from gene to function.
Annual Review of Plant Physiology and Plant Molecular Biology 48,
703–734.
Page T, Griffiths G, Buchanan-Wollaston V. 2001. Molecular and
biochemical characterization of postharvest senescence in broccoli.
Plant Physiology 125, 718–727.
Verlinden S. 2003. Changes in mineral nutrient concentrations in
Petunia corollas during development and senescence. Horticultural
Science 38, 71–74.
3688 | Müller et al.
Weiss D, Halevy AH. 1991. The role of light reactions in the
regulation of anthocyanin synthesis in Petunia corollas. Physiologia
Plantarum 81, 127–133.
Weiss D, Schönfeld M, Halevy AH. 1988. Photosynthetic activity in
Petunia corolla. Plant Physiology 87, 666–970.
Wingler A, Roitsch T. 2008. Metabolic regulation of leaf senescence:
interactions of sugar signalling with biotic and abiotic stress
responses. Plant Biology 1, 50–62.
Wintermans JFGH, de Mots A. 1965. Spectrophotometric
characteristics of the chlorophyll and their pheophytins in ethanol.
Biochemical and Biophysical Acta 109, 448–453.
Yamada T, Ichimura K, Kanekatsu M, van Doorn WG. 2009.
Homologs of genes associated with programmed cell death in animal
cells are differentially expressed during senescence of Ipomoea nil
petals. Plant and Cell Physiology 50, 610–625.
Yamada T, Ichimura K, Kanekatsu M, van Doorn WG. 2007.
Gene expression in opening and senescing petals of morning glory
(Ipomoea nil) flowers. Plant Cell Reports 26, 823–835.
Yamada T, Takatsu Y, Kasumi M, Ichimura K, van Doorn WG.
2006. Nuclear fragmentation and DNA degradation during
programmed cell death in petals of morning glory (Ipomoea nil). Planta
224, 1279–1290.