Download Cloning and expression analysis of three novel CC chemokine

Cloning and expression analysis of three novel
CC chemokine genes from Japanese flounder
Paralichthys olivaceus
学位名
学位授与機関
学位授与年度
URL
修士(海洋科学)
東京海洋大学
2014
http://id.nii.ac.jp/1342/00001332/
Master’s Thesis
CLONING AND EXPRESSION ANALYSIS OF THREE
NOVEL CC CHEMOKINE GENES FROM JAPANESE
FLOUNDER Paralichthys olivaceus
September 2014
Graduate School of marine Science and Technology
Tokyo University of Marine Science and Technology
Master Course of Marine Life Sciences
ZOU GANGGANG
Master’s Thesis
CLONING AND EXPRESSION ANALYSIS OF THREE
NOVEL CC CHEMOKINE GENES FROM JAPANESE
FLOUNDER Paralichthys olivaceus
September 2014
Graduate School of marine Science and Technology
Tokyo University of Marine Science and Technology
Master Course of Marine Life Sciences
ZOU GANGGANG
Contents
Abstract .................................................................................................. i
1. Introduction ...................................................................................... 1
1.1 Japanese flounder...................................................................................1
1.2 Cytokines..............................................................................................2
1.3 Chemokines...........................................................................................3
1.4 Objective...............................................................................................5
2. Materials and methods ...................................................................... 6
2.1 Cloning of Japanese flounder CC chemokine genes .................................... 6
2.2 Expression analysis of three novel CC chemokine genes in healthy fish .......... 6
2.3 Gene expression of three novel CC chemokines after pathogens infection ....... 7
3. Results .............................................................................................. 8
3.1 Japanese flounder CC chemokine cDNA and genes .................................... 8
3.2 Phylogenetic analysis ............................................................................ 8
3.3 Constitutive expression of the CC chemokines in vivo ................................. 9
3.4 CC chemokine genes expression upon stimulation with pathogens ................ 9
4. Discussion ......................................................................................... 10
4.1 Cloning and sequence analysis of the CC chemokine genes ..........................10
4.2 Expression analysis of CC chemokine genes in Japanese flounder ................ 11
4.3 CC chemokine genes expression analysis in response to pathogens infection .. 12
5. Conclusion ........................................................................................ 13
6. Acknowledgments ............................................................................ 29
7. Reference .......................................................................................... 31
Abstract
Chemokines are small cytokines secreted by various cell types. They not only function in cell
activation, differentiation and trafficking, but they also have influences on many biological
processes. According to the arrangement of the first two cysteine residues in their sequence, the
chemokines are divided into four subfamilies: CXC, CC, CX3C and C. Recently, a new subfamily
of chemokines which named CX was described in zebrafish. CC chemokines constitutes the
largest group of chemokines in mammals with 28 CC chemokines have been identified. However,
in teleost fish CC chemokines, most efforts have been directed at cloning and phylogenetic
analysis and only few studies have dealt with their functions in the immune response.
Three novel CC chemokine genes Paol-SCYA105, 106 and 107 in Japanese flounder
(Paralichthys olivaceus) were cloned and characterized. Paol-SCYA105, Paol-SCYA106 and
Paol-SCYA107 they have between 59 and 67% amino acid sequence identities with their closest
matches in the databases. Amino acid sequences alignment of three novel CC chemokines with
other CC chemokines shows that four cysteine residues are conserved. A phylogenetic tree showed
Paol-SCYA105, Paol-SCYA106 and Paol-SCYA107 are genetically closest to CCL17/22, CCL19
and CCL27/28 clade, respectively. The gene structure of Paol-SCYA105 and Paol-SCYA107
consist of 3 exons and 2 introns. Paol-SCYA106 consists of 4 exons and 3 introns. Paol-SCYA105
i
transcripts were expressed mainly in gill, kidney and spleen, weakly in brain and skin but not
in the liver or muscle. Paol-SCYA106 was expressed in all tissues examined. Paol-SCYA107 was
expressed in the spleen, kidney and gill. In response to VHSV, Paol-SCYA105 expression was
significantly increased at 3 day post infection (dpi). Paol-SCYA106 expression was up-regulated
at 3 and 6 dpi. Paol-SCYA107 expression peaked at 6 dpi. In response to infection by E. tarda,
three novel CC chemokines only Paol-SCYA106 was up-regulated. In response to infection by S.
iniae, Paol-SCYA 106 expression peaked at 1dpi.
In this study, I reported three novel CC chemokines Paol-SCYA105, Paol-SCYA106 and
Paol-SCYA107 in Japanese flounder. Sequencing alignment and genomic structure analysis
suggest that the three CC chemokine represent novel members of the CC chemokine family in
Japanese flounder. The expressions of two of the chemokine genes were tissue-specific. These
chemokines have a role in the immune response against viral and bacterial infection, especially
VHSV infection.
ii
1. Introduction
1.1 Japanese flounder
Japanese flounder (Paralichthys olivaceus) is a large flatfish and one of important fishes in
the coastal fisheries of Japan [1]. The aquaculture production of Japanese flounder have
significantly increased in the past three decades. In 2012, the global aquaculture production was
almost 42 thousands tonnes (Figure 1). With the development of aquaculture, there is one severe
disadvantage is that fish become susceptible to infectious agents, like viral hemorrhagic
septicemia virus infection and it caused high mortality [2]. Therefore, more research to
understanding the flounder immune system is very important.
Figure 1 Global Capture/Aquaculture Production for Paralichthys olivaceus (tonnes) (FAO, 2014)
1
1.2 Cytokines
Cytokines are small proteins and they are involved in almost every biological process
including non-specific responses to infection, specific response to antigen, embryonic
development, stem cell differentiation, cell proliferation and cell migration [3, 4]. Conventionally,
cytokines are divided into different families like interleukins (IL) family, tumor necrosis factors
(TNF) family, interferons (IFN) family, colony stimulating factors (CSF) family and chemokines
family [5]. Cytokines are produced by T lymphocytes, B lymphocytes, macrophages, granulocytes,
mast cells, epithelial cells and dendritic cells, for example, macrophages can secret IL-1, IL-6,
IL-12, TNFα, and chemokines such as IL-8 and MCP-1, all of which are indispensable for cells
recruitment to the infected tissues [6] (Figure 2). Cytokines can bind to their corresponding
receptors through autocrine or paracine manner to modulate immune responses [7].
Different cytokines have different functions and several cytokines have been identified.
For example, in some teleost species, TNF-α has a high constitutive expression in different tissues
of healthy fish and it is mainly involved in the recruitment of leukocytes to the inflammatory site
[8, 9, 10, 11, 12]. Meanwhile, IL-1β is one of earliest expressed pro-inflammatory cytokines and is
involved in the regulation of immune relevant genes, leucocytes migration, lymphocyte activation
and bactericidal activities [13, 14, 15, 16, 17, 18]. IL-8 is an important chemokine belonging to the
2
CXC chemokine subfamily and is involved in pro-inflammatory process and attract neutrophils, T
lymphocytes and basophils [19, 20, 21, 22].
Figure 2 Interaction of antigen presenting macrophages and other cells with cytokines (BioCarta)
1.3 Chemokines
Chemokines are small molecular weight cytokines that induce chemotaxis in different cells,
such as lymphocytes, monocytes and neutrophils [23]. Chemokines are usually classified as
inflammatory or homeostatic depending on their functions [24]. Inflammatory chemokines are
inducible and typically promote leukocyte migration to injured sites which is critical for the innate
3
immune system. Homeostatic chemokines are expressed constitutively and generally involved in
lymphocyte trafficking, immune surveillance and cell localization in the lymphatic tissues [25, 26].
Depending on the number and arrangement of the first two conserved cysteine residues (C) in the
amino terminus, chemokines are divided into four subfamilies: CXC, CC, C and CX3C (where X
means any amino acid) [27] (Figure 2). CXC chemokines mainly act on neutrophils and
lymphocytes while CC chemokines target macrophages, eosinophils, lymphocytes and dendritic
cells. C and CX3C chemokines primarily target lymphocytes [28]. Recently, a new subfamily of
chemokines which named CX was described in zebrafish [29].
Figure 3 Structure of chemokines (Kohidai and Laszlo, 2006)
4
The largest subfamily of chemokines is CC chemokines in mammals, with 28 CC chemokines
being identified [30] and many others in fish. Generally, CC chemokines contain four cysteine
residues, but some have six cysteine residues, such as CCL28 in human [31]. CC chemokines can
be divided into several groups according to functional and sequence similarity, such as allergenic,
pro-inflammatory, haemofiltrate CC chemokine (HCC), developmental and homeostatic [24]. The
first fish chemokine reported was CK-1 from rainbow trout [32]. To date, a large number of CC
chemokines from fish have been discovered in channel catfish (Ictalurus punctatus) [33, 34],
Atlantic cod (Gauds morhua) [35], rainbow trout (Oncorhynchus mykiss) [36], gilthead seabream
(Sparus aurata) [28] and large yellow croaker (Pseudosciaena crocea) [37, 38]. Four type of CC
chemokines in Japanese flounder (Paralichthys olivaceus) have been identified during the past
few years. They are play an important role in the fish immune system [39, 40, 41, 42]. In this
study we named them as Paol-SCYA101, Paol-SCYA102, Paol-SCYA103, and Paol-SCYA104,
following Pestman et al [43].
1.4 Objective
In this study, we cloned and characterized three novel CC chemokine genes in Japanese
flounder which were designated as Paol-SCYA105, Paol-SCYA106 and Paol-SCYA107,
respectively. We also studied the tissue distributions of three novel CC chemokine mRNA and
analyzed their expression pattern upon infection with a virus and two species of bacteria.
5
2. Materials and methods
2.1. Cloning of Japanese flounder CC chemokine genes
Total RNA was extracted from kidney of Japanese flounder using RNAiso reagent (Takara
Bio). Full length cDNA sequences were obtained by SMART RACE cDNA amplification
following the manufacturer’s instructions (Clontech). Three novel CC chemokine EST sequences
of Japanese flounder were obtained from a previous study [44]. Primer sets were designed,
according to the EST sequences (Table 1). On the basis of the full-length cDNA sequence, the
deduced amino acid sequences were analyzed using BLAST (http://www.ncbi.nlm.nih.gov/blast/).
Multiple sequence alignments were done in DNAMAN program (Lynnon). A phylogenetic tree
based on deduced amino acid differences was constructed by MEGA4.0 software using
neighbor-joining method [45]. To identify CC chemokine gene sequence, genomic DNA was
extracted from kidney of Japanese flounder using phenol-chloroform extraction methods. Primers
used in PCR reactions were listed in Table 1. Exon/intron junctions were deduced according to
cDNA sequence and gene sequence alignments.
2.2 Expression analysis of three novel CC chemokine genes in healthy fish
Various tissues including gills, spleen, brain, kidney, liver, skin and muscle, were obtained
from three apparently healthy fish. Total RNA was extracted using RNAiso reagent (Takara Bio).
cDNA was synthesized from 2μg of each total RNA using M-MLV reverse transcriptase
6
(Invitrogen). One microliter of cDNA was used as template for PCR amplification, and RT-PCR
was performed with the primer sets (Table 1) under the following PCR conditions: pre-denatured
at 95℃ for 5min, then amplified for 32 cycles at 95℃ for 30s, 52℃ for 30s, 72℃ for 30s and a
final extension at 72℃ for 5min. β-actin was used as a positive control. RT-PCR products were
analyzed by electrophoresis on 1% agarose gel.
2.3 Gene expression of three novel CC chemokines after pathogens infection
Healthy Japanese flounder juveniles (average wt. 26 g) were challenged with a Gram-positive
bacteria, Streptococcus iniae (S. iniae), Gram-negative bacteria, Edwardsiella tarda (E. tarda),
and viral hemorrhagic septicemia virus (VHSV) at 1.8×106 CFU/ml, 3.5×106 CFU/ml and 105
TCID50/ml, respectively. Kidneys were collected from three fish at 0, 1, 3 and 6 days post
infection. RNA extraction and cDNA synthesis were performed as described above. Quantitative
real time PCR was performed using Thunderbird SYBR qPCR mix (Toyobo) on ABI7300
real-time PCR system (Applied Biosystems) according to the manufacturer’s protocol. The primer
sets for Q-PCR were designed using Primer Express Software (Applied Biosystems). β-actin was
used as a internal control. The expression levels of the target gene were normalized to the
expression level of β-actin, and were expressed as fold change relative to the level of the control
group. The significant difference between 0 day and other time points were performed using
Student’s t-test.
7
3. Results
3.1 Japanese flounder CC chemokine cDNA and genes
In this study, we cloned three novel CC chemokines of Japanese flounder and designating
them as Paol-SCYA105, Paol-SCYA106 and Paol-SCYA107, respectively. They have between 59
and 67% amino acid sequence identities with their closest matches in the databases (Table 2).
Among seven CC chemokines in Japanese flounder showed low amino acid sequence identities
with each others by homology comparison (data not shown). An alignment of these and other CC
chemokines shows that four cysteine residues are conserved (Fig. 1). Paol-SCYA105 (accession
no. AB937785) and Paol-SCYA107 (accession no. AB937789) consist of 3 exons and 2 introns
(Fig. 2). Three of the conserved cysteine residues are located in the second exon and one is located
in the third exon (Fig. 2). Paol-SCYA106 (accession no. AB937787) consists of 4 exons, 3 introns
and two additional cysteine residues, located at 2nd and 4th exons (Fig. 2).
3.2 Phylogenetic analysis
A phylogenetic tree was constructed based on the deduced amino acid sequences of CC
chemokines from Japanese flounder and other vertebrate CC chemokines (Fig. 3). In the tree,
seven clades were named as Fish CC clade, CCL27/28 clade, CCL19 clade, CCL16/20/21/25
clade, CCL17/22 clade, CCL1 clade and CCL24 clade, based on their mammalian membership. It
showed that Paol-SCYA105, Paol-SCYA106 and Paol-SCYA107 are genetically closest to
8
CCL17/22 clade, CCL19 clade and CCL27/28 clade, respectively. These seven CC chemokines in
Japanese flounder showed a complex pattern of divergence.
3.3 Constitutive expression of the CC chemokines in vivo
Paol-SCYA105 transcripts were expressed mainly in gill, kidney and spleen, less in brain and
skin but not in the liver or muscle. Paol-SCYA106 was expressed in all tissues examined.
Paol-SCYA107 was expressed in the spleen, kidney and gill. Paol-SCYA101 and Paol-SCYA102
were highly expressed in spleen, gill and kidney and not in muscle. Paol-SCYA103 and
Paol-SCYA104 had constitutively expression in immune-related organs and cells (Fig. 4).
3.4 CC chemokine genes expression upon stimulation with pathogens
The effects of pathogens on CC chemokine expression in Japanese flounder are shown in
Fig. 5. Paol-SCYA106, Paol-SCYA102 and Paol-SCYA103 shared consistent expression patterns
after pathogen infection. Paol-SCYA105 and Paol-SCYA106 also showed consistent expression
patterns after pathogen infection. Paol-SCYA107 and Paol-SCYA101 showed different expression
patterns with other chemokines. In response to VHSV, Paol-SCYA105 expression was
significantly increased at 3 day post infection (dpi) (Fig. 6). Paol-SCYA106 expression was
up-regulated at 3 and 6 dpi (Fig. 7), while Paol-SCYA107 expression peaked at 6 dpi (Fig. 8). The
expressions of Paol-SCYA101 (Fig. 9), Paol-SCYA102 (Fig. 10) and Paol-SCYA103 (Fig. 11)
peaked at 3 dpi. Paol-SCYA104 expression, however was not significantly increased (Fig. 12). In
9
response to infection by E. tarda, only one of the three new CC chemokines, Paol-SCYA106, was
up-regulated (Fig. 7). Its expression was highest at 6 dpi as was the case with Paol-SCYA102 and
Paol-SCYA103. In response to infection by S. iniae, Paol-SCYA 106 expression peaked at 1dpi
(Fig. 7), consistent with Paol-SCYA102 and Paol-SCYA103.
4. Discussion
4.1 Cloning and sequence analysis of the CC chemokine genes
We identified three novel CC chemokines in Japanese flounder. The three novel CC
chemokines showed high amino acid sequence identities with other known fish CC chemokines
and their deduced amino acid sequences possess four conserved cysteines, which are important for
tertiary structure and function [24]. Paol-SCYA105 and Paol-SCYA107 have 3 exons. The
exon/intron boundaries are similar to those of the most CC chemokine genes. Paol-SCYA106 gene
structure is similar to the CC chemokines of Paol-SCYA101, Trout CK1 and mammalian C6-CC
chemokine. However, in mammalian C6-CC chemokine, the additional cysteines are located at the
C-terminus and are considered to form an additional cysteine loop [46]. In this study, the CCL19,
CCL17/22 and CCL27/28 clades in the phylogenetic tree were supported by Peatman and Liu [33].
Three novel CC chemokines were distributed to different clades and most closely related to the
CC chemokines of other fish. There is no consistent nomenclature for non-mammalian CC
10
chemokines [47] and it is still difficult to compare teleost CC chemokines with each other. Seven
CC chemokine in Japanese flounder showed low identities with each other, consistent with CC
chemokines in trout [36] and catfish [43]. The highly divergent sequences may not support a
reliable phylogenetic analysis for establishment of orthologies [34]. Functional analysis as an
additional method will indicate more relationships between CC chemokines of teleosts.
4.2 Expression analysis of CC chemokine genes in Japanese flounder
The chemokine mRNA expression patterns are important to clarify the immune response
mechanisms and disease control [48]. In this study, the majority of the CC chemokine genes were
highly expressed in gills and immune-related organs (kidney and spleen). The kidney and spleen
are major lymphoid organs in teleosts, where included a large number of immune cells like
macrophages and lymphocytes, which might be the reason why CC chemokines were highly
expressed in these tissues [39, 49, 50]. In gills, that might be because it serves as a barrier to the
entry of pathogens and it contains leukocytes responsible for local immune responses [51].
Paol-SCYA106, Paol-SCYA101, Paol-SCYA102, Paol-SCYA103 and Paol-SCYA104, were
consistently expressed in most tested tissues. The expression results of Paol-SCYA101,
Paol-SCYA103 and Paol-SCYA104 were consistent with previous studies. These results indicated
possible homeostatic functions of CC chemokines in immunosurveillance more than the better
known functions of chemotactic attraction of leukocytes in immune related tissues [34, 52]. This
11
ubiquitous expression pattern has also been reported in other fish CC chemokines, like LycCC
chemokine in large yellow croaker [38], Mimi-CC chemokine in miiuy croaker [53] and 14
chemokine in catfish [34]. However, Paol-SCYA105 and Paol-SCYA107 appeared tissue specific
expression and expressed highly in immune-related tissues, suggesting their specific roles in
inflammatory responses.
4.3 CC chemokine genes expression analysis in response to pathogens infection
Chemokines have a vital role in the innate immune response and they have been shown to be
important for elimination of many types virus and bacteria [54, 55, 56, 57, 58]. Time-course
expression analysis showed that Paol-SCYA106 expression in kidney was obviously up-regulated
and reached relative high peak levels by VHSV, E. tarda and S. Iniae at day3, 6 and 1, respectively,
and then followed by a decrease, consistent with Paol-SCYA102 and Paol-SCYA103. These results
suggest Paol-SCYA106 have same functions with Paol-SCYA102 and Paol-SCYA103 and
supports a potential inflammatory function for Paol-SCYA106. E. tarda and S. iniae produced no
significant effect and only VHSV was capable of significantly up-regulating the levels of
expression of Paol-SCYA105, Paol-SCYA107 and Paol-SCYA101. This result is consistent with
CK3, CK7, CK8 and CK10 CC chemokines in gilthead seabream [28]. However, the expression of
Paol-SCYA104 was not significantly changed in kidney after viral and bacteria infection and is
different from other CC chemokines. We also found that VHSV appeared to be more potent than
12
bacteria in up-regulating the three novel CC chemokine expression and that some non-chemokine
immune genes such as IL-1β and TNF-α have a greater immunostimulatory effect in response to
bacteria than viral infection [59,60]. The differences in expression patterns of the CC chemokines
may be due to functional differences in innate immune responses. Similar differences in the
expressions of CC chemokines were observed in response to different stimuli in trout [61] and large
yellow croaker [37,38].
5. Conclusion
In this study, we reported three novel CC chemokines Paol-SCYA105, Paol-SCYA106 and
Paol-SCYA107 in Japanese flounder. Sequence alignment and genomic structure analysis suggest
that the three CC chemokine represent novel members of the CC chemokine family in Japanese
flounder. The expressions of two of the chemokine genes were tissue-specific. These chemokines
appear to have a role in the immune response against viral and bacterial infection, especially
VHSV infection.
13
Fig. 1. Alignment of deduced amino acid sequences of Japanese flounder CC chemokines
identified in this study (Paol-SCYA105, 106 and 107) with other known fish CC chemokines by
DNAman program. The four conserved cysteine residues are shown in black background. Other
partly conserved residues are shown in a gray background (>50% aa sequence identities). Gene
Bank
accession
Paol-SCYA107,
Numbers:
Paol-SCYA105,
AB937786;
Paol-SCYA106,
AB937788;
AB937790;
Paol-SCYA101,
AB070836;
Paol-SCYA102,
AB427185;
Paol-SCYA103, AB111860; Paol-SCYA104, AB080612; Orange spotted grouper CCL4,
AFN58329; Zebrafish eotaxin-like, XP-004542516; Silver cod CC19 precursor, ACQ57919;
Orange spotted grouper CC2, AEA39657; Rock bream CC1, BAM34025; Gilthead sea bream
CK3, ADE58986; Fugu CC14-like, XP-003966784.
14
Fig. 2. Gene structures of Japanese flounder Paol-SCYA105, 106 and 107 from start codon to stop
codon. Boxes indicate exon-coding regions, while bars indicate introns. Numbers indicate the
lengths of exons and introns in bp. The relative positions of the conserved cysteine residues are
shown.
15
16
Fig. 3. Phylogenetic tree based on genetic distances of the deduced amino acid sequences of CC
chemokines from Japanese flounder and other vertebrate CC chemokines by MEGA4.0 software
using neighbor-joining method. The number on nodes represent the confidence level of 1000
bootstrap replications. The gene bank accession numbers used in this study are as follows:
Japanese flounder (SCYA101, AB070836; SCYA102, AB427185; SCYA103, AB111860;
SCYA104, AB080612; SCYA105, AB937786; SCYA106, AB937788; SCYA107, AB937790);
oncorhynchus mykiss (CK1, AF093802; CK2, AF418561; CK3, AJ315149; CK4A,CA371157;
CK4B, CA352593; CK5A, CA383670; CK5B, CA374135; CK6, CA355962; CK7, CA346976;
CK8B, CA353159; CK9, CA378686; CK10, CA361535; CK11, BX072681; CK12A, CA358073;
CK12B, CA346383); Human (CCL1, EAW80204; CCL2, AAH09716; CCL3, AAI71891; CCL4,
AAI04228; CCL5, EAW80120; CCL7, EAW80210; CCL8, AAI26243; CCL11, EAW80209;
CCL13, AAH08621; CCL14, AAH38289; CCL15, AAI40942; CCL16, EAW80114; CCL17,
EAW82921; CCL19, EAW58416; CCL20, AAH20698; CCL21, EAW58415; CCL22, AAH27952;
CCL23, AAI43311; CCL24, EAW71772; CCL25, AAI30562; CCL26, EAW71771; CCL27,
EAW58421; CCL28, AAH62668); Catfish
(Icfu-SCYA101, DQ173276; Icfu-SCYA102,
DQ173277; Icfu-SCYA103, DQ173278; Icfu-SCYA104, DQ173279; Icfu-SCYA106, DQ173280;
Icfu-SCYA107,
DQ173281;
Icfu-SCYA108,
DQ173282;
Icfu-SCYA109,
DQ173283;
Icfu-SCYA110,
DQ173284;
Icfu-SCYA111,
DQ173285;
Icfu-SCYA112,
DQ173286;
Icfu-SCYA113,
DQ173287;
Icfu-SCYA114,
DQ173288;
Icfu-SCYA115,
DQ173289;
Icfu-SCYA116,
DQ173290;
Icfu-SCYA117,
DQ173291;
Icfu-SCYA118,
DQ173292;
Icfu-SCYA119,
DQ173293;
Icfu-SCYA120,
DQ173294;
Icfu-SCYA121,
DQ173295;
Icfu-SCYA122, DQ173296; Icfu-SCYA124, DQ173297; Icfu-SCYA126, DQ173298); Orange
spotted grouper CCL4, AFN58329; Zebrafish eotaxin-like, XP-004542516; Silver cod CC19
precursor, ACQ57919;
17
Fig. 4. CC chemokine gene expression in various tissues detected by RT-PCR. β-actin was used as
a positive control.
18
Fig. 5. mRNA expressions of novel CC chemokine genes in Japanese flounder kidney after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. CC chemokine gene expression
patterns are alignment by Cluster3.0. All data were normalized to β-actin and are expressed as
fold-induction relative to the control.
19
Fig. 6. mRNA expressions profiles of Paol-SCYA105 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
20
**
*
**
**
*
Fig. 7. mRNA expressions profiles of Paol-SCYA106 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
21
**
Fig. 8. mRNA expressions profiles of Paol-SCYA107 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
22
Fig. 9. mRNA expressions profiles of Paol-SCYA101 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
23
*
**
**
Fig. 10. mRNA expressions profiles of Paol-SCYA102 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
24
**
**
**
**
*
Fig. 11. mRNA expressions profiles of Paol-SCYA103 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
25
Fig. 12. mRNA expressions profiles of Paol-SCYA104 gene in kidney of Japanese flounder after
challenge with VHSV, E. tarda and S. iniae for 0, 1, 3 and 6 day. All data were normalized to
β-actin and data were expressed as fold change relative to control. Error bars indicate standard
deviation of the mean, (*) represents p<0.05; (**) represents p<0.01.
26
Table 1. Primers of CC chemokine genes in Japanese flounder used in this study.
Primer
Purpose
primer sequence(5 '-3 ')
Paol-SCYA101 F
Paol-SCYA101 R
Paol-SCYA102 F
Paol-SCYA102 R
Paol-SCYA103 F
Paol-SCYA103 R
Paol-SCYA104 F
Paol-SCYA104 R
Paol-SCYA105 F
Paol-SCYA105 R
Paol-SCYA105 F '
Paol-SCYA105 R '
Paol-SCYA106 F
Paol-SCYA106 R
Paol-SCYA106 F '
Paol-SCYA106 R '
Paol-SCYA107 F
Paol-SCYA107 R
β-actin F
β-actin R
RT-Paol-SCYA101 F
RT-Paol-SCYA101 R
RT-Paol-SCYA102 F
RT-Paol-SCYA102 R
RT-Paol-SCYA103 F
RT-Paol-SCYA103 R
RT-Paol-SCYA104 F
RT-Paol-SCYA104 R
RT-Paol-SCYA105 F
RT-Paol-SCYA105 R
RT-Paol-SCYA106 F
RT-Paol-SCYA106 R
RT-Paol-SCYA107 F
RT-Paol-SCYA107 R
RT-β-actin F
RT-β-actin R
RT-PCR
ATGTGGACTCTTTCTGCC
TTAAGTCGTCGACACGTCT
ATGGTCTACTCTGGAAGC
CTACTCGTTGCTGCCTTCT
ATGCAGCTTTGCATCAAAAG
CTATGAGCTGGAGGTTGTCGT
ATGAGGCCCCTTCAGGTC
TTAAAAATGTTTTTCATCC
GGGAACACATACGTTTCAGGA
CATAACTGGATCGCATCCTTG
GTTTGGAAAGTGAATCTG
ACCTTGTCCTCGGGCAGT
ACTTCACCAGCTCAGCAACC
GAATTGCAATGACCCGATG
AGTGGAACTGTGGGTG
ATGGGAACCTGTGCTGAT
CACCATACCTTTTCTTAGCCTGAC
CTGCTTTGCAATAACTCAGTGG
TTTCCCTCCATTGTTGGTCG
GCGACTCTCAGCTCGTTGTA
GCACGCCTACCTGATTGAAAC
GCGGCCTCTGGATCGAT
CGCTCCGTGGGTTCGA
GGAGTGGACTGAGCTCTTGCTT
GCGTCCGCGCTGTCATAT
TGTTTCCAGTGGCTGCAGATT
CGAAGACGGGCGTCATTTTA
TGGACATCTGGATCCACACAGA
GGTTCCGGCCCAAAGAAG
CCTTGTCCTCGGGCAGTTT
TGGGTCCAGGCAGTGATGA
TCCCGGTCTTCCTGCACTT
CAAGACGATAAAAGGCAAAAGGA
CATGCTCGACTTTGTCCACTGA
TGATGAAGCCCAGAGCAAGA
CTCCATGTCATCCCAGTTGGT
RT-PCR/Full-length cloning
Full-length cloning
RT-PCR/Full-length cloning
Full-length cloning
RT-PCR/Full-length cloning
RT-PCR
Real-time PCR
27
Table 2. Summary of sequence similarities of the Japanese flounder CC chemokines.
CC
chemokine
Accession
numbers
Homologous gene (Species / Accession numbers)
E
value
Amino acid
identify
References
Paol-SCYA105
AB937786
CC ligand 4 (Epinephelus coioides / AFN58329)
9e-40
67%
In this study
Paol-SCYA106
AB937788
CC19 precursor (Anoplopoma fimbria / ACQ57919)
1e-35
66%
In this study
Paol-SCYA107
AB937790
eotaxin-like (Maylandia zebra / XP-004542516)
7e-33
59%
In this study
Paol-SCYA101
AB070836
-
-
-
[18]
Paol-SCYA102
AB427185
-
-
-
-
Paol-SCYA103
AB111860
-
-
-
[17]
Paol-SCYA104
AB080612
-
-
-
[16]
AU090535
-
-
-
[19]
28
Acknowledgments
Firstly, I would like to express my deepest gratitude to Professor Ikuo Hirono, my supervisor,
for his constant encouragement and guidance. Second, I would like to express my heartfelt
gratitude to Associate Professor Hidehiro Kondo, without his consistent and illuminating
instruction, this thesis could not have reached its present form. I am also indebted to the Reiko
Nozaki at the laboratory of Genome Science, who have instructed and helped me a lot in my
experiment. I would like to thank Professor Motohiko Sano from the Tokyo University of Marine
Science and Technology for taking time out from his busy schedule to serve as my external
supervisor and his suggestions.
I also owe my sincere gratitude to Japan-China-Korea Exchange Project Promotion
Committee for providing this opportunity for me to study in Japan.
I would like express my gratitude to all of members in Laboratory of Genome Science who
gave me their help and time in listening to me and helping me work out my problems, especially
to Sakurai Taiki who is my tutor and Zhao Beibei..
I am sincere indebted to my supervisory professor Wu Changwen, when I was a master
student in China, for his continually encouraging and supporting me.
My special thanks also go to all my teachers whose teaching and helping me during my
master course and authors whose words I have cited or quoted in my thesis.
29
Last my thanks would go to my beloved family and friends for their loving considerations
and great confidence in me all through these years.
30
References
[1] Fujii T, Noguchi M. Interactions between released and wild Japanese flounder (Paralichthys
olivaceus) on a nursery ground. Alaska Sea Grant Report AK-SG-95-03, 1993:57-65.
[2] Isshiki T, Nishizawa T, Kobayashi T, Nagano T, Miyazaki T. An outbreak of VHSV (viral
hemorrhagic septicemia virus) infection in farmed Japanese flounder Paralichthys olivaceus
in Japan. Dis Aquat Org 2001;47:87-99.
[3] Dinarello CA. Historical Review of Cytokines. Eur J Immunol 2007;37:34–45.
[4] Feldmann M. Many cytokines are very useful therapeutic targets in disease. J Clin Invest
2008;118:3533–3536.
[5] Secombes CJ, Hardie LJ, Daniels G. Cytokines in fish: an update. Fish Shellfish Immunol
1996;6:291–304.
[6] Cerpa SR, Maisey K, López FR, Ascuy DT, Sandino AM, Imarai M. (2012) Fish Cytokines
and Immune Response, New Advances and Contributions to Fish Biology, Prof. Hakan
Turker (Ed.), ISBN: 978-953-51-0909-9, InTech, DOI: 10.5772/53504.
[7] Wang T, Huang W, Costa MM, Secombes CJ. The gamma-chain cytokine/receptor system in
fish: more ligands and receptors. Fish Shellfish Immunol 2011;31:673-687.
[8] Hirono I, Nam BH, Kurobe T, Aoki T. Molecular cloning, characterization, and expression of
TNF cDNA and gene from Japanese flounder Paralychthys olivaceus. J Immunol
2000;165:4423-7.
31
[9] Laing KJ, Wang T, Zou J, Holland J, Hong S, Bols N, Hirono I, Aoki T, Secombes CJ.
Cloning and expression analysis of rainbow trout Oncorhynchus mykiss tumour necrosis
factor-alpha. Eur J Biochem 2001;268:1315-1322.
[10] Savan R, Sakai M. Presence of multiple isoforms of TNF alpha in carp (Cyprinus carpio L.):
genomic and expression analysis. Fish Shellfish Immunol 2004;17:87–94.
[11] Praveen K, Evans DL, Jaso-Friedmann L. Constitutive expression of tumor necrosis
factor-alpha in cytotoxic cells of teleosts and its role in regulation of cell-mediated
cytotoxicity. Mol Immunol 2006;43:279-291.
[12] Roca FJ, Mulero I, López-Muñoz A, Sepulcre MP, Renshaw SA, Meseguer J, Mulero V.
Evolution of the inflammatory response in vertebrates: fish TNF-alpha is a powerful activator
of endothelial cells but hardly activates phagocytes. J Immunol 2008;181:5071-5081.
[13] Zou J, Grabowski PS, Cunningham C, Secombes CJ. Molecular cloning of interleukin 1beta
from rainbow trout Oncorhynchus mykiss reveals no evidence of an ice cut site. Cytokine.
1999;11:552-560.
[14] Fujiki K, Shin DH, Nakao M, Yano T. Molecular cloning and expression analysis of carp
(Cyprinus carpio) interleukin-1 beta, high affinity immunoglobulin E Fc receptor gamma
subunit and serum amyloid A. Fish Shellfish Immunol. 2000;10:229-242.
32
[15] Peddie S, Zou J, Cunningham C, Secombes CJ. Rainbow trout (Oncorhynchus mykiss)
recombinant IL-1beta and derived peptides induce migration of head-kidney leucocytes in
vitro. Fish Shellfish Immunol 2001;11:697-709.
[16] Bird S, Wang T, Zou J, Cunningham C, Secombes CJ. The first cytokine sequence within
cartilaginous fish: IL-1 beta in the small spotted catshark (Scyliorhinus canicula). J Immunol
2002;168:3329–3340.
[17] Corripio-Miyar Y, Bird S, Tsamopoulos K, Secombes CJ. Cloning and expression analysis of
two pro-inflammatory cytokines, IL-1 beta and IL-8, in haddock (Melanogrammus
aeglefinus). Mol Immunol 2007;44:1361-1373.
[18] Lu DQ, Bei JX, Feng LN, Zhang Y, Liu XC, Wang L, Chen JL, Lin HR. Interleukin-1beta
gene in orange-spotted grouper, Epinephelus coioides: molecular cloning, expression,
biological activities and signal transduction. Mol Immunol 2008;45:857-867.
[19] Mukaida N, Harada A, Matsushima K. Interleukin-8 (IL-8) and monocyte chemotactic and
activating factor (MCAF/MCP-1), chemokines essentially involved in inflammatory and
immune reactions. Cytokine Growth Factor Rev 1998;9:9-23.
[20] Lee EY, Park HH, Kim YT, Choi TJ. Cloning and sequence analysis of the interleukin-8 gene
from flounder (Paralichthys olivaceous). Gene 2001;274:237-243.
33
[21] Laing KJ, Zou JJ, Wang T, Bols N, Hirono I, Aoki T, Secombes CJ. Identification and
analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus mykiss. Dev Comp
Immunol 2002;26:433-444.
[22] Chen L, He C, Baoprasertkul P, Xu P, Li P, Serapion J, Waldbieser G, Wolters W, Liu Z.
Analysis of a catfish gene resembling interleukin-8: cDNA cloning, gene structure, and
expression after infection with Edwardsiella ictaluri. Dev Comp Immunol 2005;29:135-142.
[23] Borish
LC,
Steinke
JW.
Cytokines
and
chemokines.
J
Allergy
Clin
Immun
2003;111:S460-S475.
[24] Laing KJ, Secombes CJ. Chemokines. Dev Comp Immunol 2004;28:443-460.
[25] Fernandez EJ, Lolis E. Structure, function, and inhibition of chemokines. Annu Rev
Pharmacool Toxicol 2002;42: 469-499.
[26] Esche C, Stellato C, Beck LA. Chemokines: Key Players in Innate and Adaptive Immunity. J
Invest Dermatol 2005;125:615-628.
[27] Rosenwasser LJ, Zimmermann N, Hershey GK, Foster PS, Rothenberg ME. Chemokines in
asthma: Cooperative interaction between chemokines and IL-13. J Allergy Clin Immun
2003;111:227-242.
34
[28] Cuesta A, Dios S, Figueras A, Novoa B, Esteban MA, Meseguer J, Tafalla C. Identification of
six novel CC chemokines in gilthead seabream (Sparus aurata) implicated in the antiviral
immune response. Mol Immunol 2010;47:1235-1243.
[29] Nomiyama H, Hieshima K, Osada N, Kato-Unoki Y, Otsuka-Ono K, Takegawa S, Izawa T,
Yoshizawa A, Kikuchi Y, Tanase S, Miura R, Kusuda J, Nakao M and Yoshie O. Extensive
expansion and diversification of the chemokine gene family in zebrafish: Identification of a
novel chemokine subfamily CX. BMC Genomics 2008;9:222.
[30] Bacon K, Baggiolini M, Broxmeyer H, Horuk R, Lindley I, Mantovani A, Matsushima K,
Murphy P, Nomiyama H, Oppenheim J, Rot A, Schall T, Tsang M, Thorpe R, Van Damme J,
Wadhwa M, Yoshie O, Zlotnik A, Zoon K. Chemokines/chemokine receptor nomenclature.
Cytokine 2003;21:48-49.
[31] Wang W, Soto H, Oldham ER, Buchanan ME, Homey B, Catron D, Jenkins N, Copeland NG,
Gilbert DJ, Nguyen N, Abrams J, Kershenovich D, Smith K, McClanahan T, Vicari AP,
Zlotnik A. Identification of a novel chemokine (CCL28), which binds CCR10 (GPR2). J Biol
Chem 2000;275:22313-22323.
[32] Dixon B, Shum B, Adams EJ, Magor K, Hedrick RP, Muir DJ, Parham P. CK-1, a putative
chemokine of rainbow trout (Oncorhynchus mykiss). Immunol Rev 1998;166:341-348.
35
[33] Peatman E, Liu Z. Evolution of CC chemokines in teleost fish: a case study in gene
duplication and implications for immune diversity. Immunogenetics 2007;59:613-623.
[34] Bao BL, Peatman E, Peng X, Baoprasertkul P, Wang GL, Liu ZJ. Characterization of 23 CC
chemokine genes and analysis of their expression in channel catfish (Ictalurus punctatus). Dev
Comp Immunol 2006;30:783-796.
[35] Borza T, Stone C, Rise M L, Bowman S, Johnson S C. Atlantic cod (Gauds morhua) CC
chemokines: Diversity and expression analysis. Dev Comp Immunol 2010;34:904-913
[36] Laing KJ, Secombes CJ. Trout CC chemokines: comparison of their sequences and expression
patterns. Mol Immunol 2004;41:793-808.
[37] Zhang JZ, Ao JQ, Chen XH. Molecular and functional characterization of a novel CC
chemokine in large yellow croaker (Pseudosciaena crocea). Fish Shellfish Immunol
2008;25:664-671.
[38] Zhang JZ, Chen XH. Molecular characterization of a novel CC chemokine in large yellow
croaker (Pseudosciaena crocea) and its involvement in modulation of MHC class I antigen
processing and presentation pathway. Mol Immunol 2008;45:2076-2086.
[39] Khattiya R, Hirono I, Aoki T. Molecular cloning, gene structure and expression of two CC
chemokines from Japanese flounder Paralichthys olivaceus. Fisheries Sci 2003;69:1065-1074.
36
[40] Khattiya R, Ohira T, Hirono I, Aoki T. Identification of a novel Japanese flounder
(Paralichthys olivaceus) CC chemokine gene and an analysis of its function. Immunogenetics
2004;55:763-769.
[41] Khattiya R, Kondo H, Hirono I, Aoki T. Cloning, expression and functional analysis of a
novel-chemokine gene of Japanese flounder, Paralichthys olivaceus, containing two additional
cysteines and an extra fourth exon. Fish Shellfish Immunol 2007;22:651-662.
[42] Kono T, Kusada R, Kawahara E, Sakai M. The analysis of immune responses of a novel
CC-chemokine gene from Japanese flounder Paralichthys olivaceus. Vaccine 2003;21:446 –
457.
[43] Pestman E, Bao BL, Baoprasertkul P, Liu ZJ. In silico identification and expression analysis of
12 novel CC chemokines in catfish. Immunogenetics 2005;57:409-419.
[44] Taechavasonyoo A, Kondo H, Nozaki R, Suzuki Y, Hirono I. Identification of novel
interleukin 1 beta family genes in Japanese flounder Paralichthys olivaceus. Fish Shellfish
Immunol 2013;34:393-396.
[45] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596-1599.
[46] Hedrick JA, Zlotnik A. Identification and characterization of a novel β chemokine containing
six conserved cysteines. J Immunol 1997;159:1589-1593.
37
[47] Alejo A, Tafalla C. Chemokines in teleost fish species. Dev Comp Immunol
2011;35:1215-1222.
[48] Feng J, Su YL, Guo ZX, Xu LW, Sun XX, Wang YX. Identification and expression analysis of
a
CC
chemokine
from
cobia
(Rachycentron
canadum).
Fish
Physiol
Biochem
2013;39:459-469.
[49] Chaves-Pozo E, Muñoz P, López-Muñoz A, Pelegrín P, Ayala AG, Mulero V, Meseguer J.
Early innate immune response and redistribution of inflammatory cells in the bony fish
gilthead seabream experimentally infected with Vibrio anguillarum. Cell Tissue Res
2005;320:61-68.
[50] Trede NS, Langenau DM, Traver D, Look AT, Zon LI. The use of zebrafish to understand
immunity. Immunity 2004;20:367-379.
[51] Press CM, Evensen Ø. The morphology of the immune system in teleost fishes. Fish Shellfish
Immunol 1999;9:309-318.
[52] Cheng YZ, Sun YN, Shi G, Wang RX, Xu TJ.Molecular cloning, characterization and
expression analysis of a CC chemokine gene from miiuy croaker (Miichthys miiuy). Fish
Physiol Biochem 2012;38:1697-1708.
38
[53] Cheng YZ, Wang RX, Sun YN, Xu TJ. Molecular characterization of miiuy croaker CC
chemokine gene and its expression following Vibrio anguillarum injection. Fish Shellfish
Immunol 2011;31:148-154.
[54] Cheng YZ, Wang RX, Xu TJ. Molecular cloning, characterization and expression analysis of a
miiuy
croaker
(Miichthys
miiuy)
CXC
chemokine
gene
resembling
the
CXCL9/CXCL10/CXCL11. Fish Shellfish Immunol 2011;31:439-445.
[55] Alfano M, Poli G. Role of cytokines and chemokines in the regulation of innate immunity and
HIV infection. Mol Immunol 2005;42:161–182.
[56] Christensen JE, de Lemos C, Moos T, Christensen JP, Thomsen AR. CXCL10 is the key ligand
for CXCR3 on CD8+ effector T cells involved in immune surveillance of the lymphocytic
choriomeningitis virus-infected central nervous system. J Immunol 2006;176:4235–4243.
[57] Chaves-Pozo E, Montero J, Cuesta A, Tafalla C. Viral hemorrhagic septicemia and infectious
pancreatic necrosis viruses replicate differently in rainbow trout gonad and induce different
chemokine transcription profiles. Dev Comp Immunol 2010;34:648-658.
[58] Chen SL, Liu Y, Dong XL, Meng L. Cloning, characterization, and expression analysis of a
CC chemokine gene from turbot (Scophthalmus maximus). Fish Physiol Biochem
2010;36:147-155.
39
[59] Heydtmann M, Adams DH. Chemokines in the immunopathogenesis of hepatitis C infection.
Hepatology 2009;49:676-688.
[60] Cook WJ, Kramer MF, Walker RM, Burwell TJ, Holman HA, Coen DM and Knipe DM.
Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites
of herpes simplex virus 1 infection. Virol. J 2004;1:5.
[61] Sanchez E, Coll J, Tafalla C. Expression of inducible CC chemokines in rainbow trout
(Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA
vaccine and interleukin 8. Dev Comp Immunol 2007;31:916-926.
40