Download here

Honors Bio: Study Guide: Human Genetics Quiz
Text References: 10 (replication, transcription, translation), 12 (human genetics, chromosomes and inheritance) and 13-2
(human genome)
Be able to:
o Explain what a mutation is: ______________________________________________
_____________________________________________________________________
o “How” a mutation can occur: _____________________________________________
_____________________________________________________________________
o Transcribe (DNA to mRNA)
o Example… original DNA:
TACCCCGGTAAACTCTTTAAATAC
Transcribe:
o Identify gene mutations including point mutations (substitutions) and frame shift mutations
(insertions and deletions)
o Example… original DNA:

TACCCCGGTAAACTCTTTAAATAC
Decide whether the following mutations represent substitutions, insertions or
deletions:
o Mutated DNA:
TACCCCGGTAATCTCTTTAAATAC
_________________________
o Mutated DNA:
TACCCCCGGTAAACTCTTTAAATAC
_________________________
o Mutated DNA:
TACCCCGGTAAACTCTTTAATAC
_________________________
o Differentiate between the three types of mutations:
o Lethal: ________________________________________________________
o Germ cell: ______________________________________________________
o Somatic cell: ____________________________________________________
o Differentiate between types of chromosomal mutations:
o Deletion: _______________________________________________________
o Inversion: ______________________________________________________
o Translocation: ___________________________________________________
o Nondisjunction: __________________________________________________
o Duplication: _____________________________________________________
o Distinguish between monosomy and trisomy nondisjunction disorders.
o Nondisjunction: __________________________________________________
o Monosomy: _____________________________________________________
o Trisomy: _______________________________________________________

Example: Trisomy 21 [also known as ___________________________] and XXY [also
known as ____________________________] are TRISOMY disorders while Turner’s
Syndrome [also known as _____________] is a MONOSOMY disorder.

Know how many chromosomes are in each cell of those affected with trisomy
and monosomy.
o Distinguish between sex-linked, sex-influenced, polygenic and multiple allele traits. Be able to
cite examples:
o Sex-linked: _____________________________________________________
o Sex-influenced: _________________________________________________
o Polygenic: ______________________________________________________
o Multiple allele: __________________________________________________
o Be able to distinguish between the genotypes for Type A, B, AB and O blood (be able to
create a punnett square, if asked):
o IAIA :_________________________
o IBIB :_________________________
o IAIB :_________________________
o IBi :__________________________
o IAi :__________________________
o ii :__________________________
o Distinguish between three types of genetic disorder pathways: Autosomal Dominant,
Autosomal Recessive and Sex-linked (X-linked).
o Example… Decide if the following genotypes represent “affected”, “normal” or
“carrier”
o Dominant Allele Disorders:

AA- ______________________

Aa- ______________________

aa- ______________________
o Recessive Allele Disorders:

AA- ______________________

Aa- ______________________ (phenotypically normal, but can still pass on the
allele to offspring)

aa- ______________________
o X-linked Disorders

Male: X Y- ______________________


X Y- ______________________
Female: X X- _____________________

X X- _____________________ (phenotypically normal, but can still pass on
the allele to offspring)

X X- ______________________
o Know what a complex character is: ________________________________________________
_______________________________________________________________________Be able to cite
examples of complex characters:
o Be able to determine red and white eye color in male and female flies, as evidenced by
Morgan’s experimentation with sex-linked traits.
o Know what linked genes are (linkage groups and gene mapping).
o Know the pathways of the various genetic disorders we’ve learned about. Reference your
notes.
o Pedigrees- know how to draw them and interpret them
o Know symbols for male and female (inclusive of those who are normal, affected and carriers).
Know how to indicate “unknown gender” and “death”.
o Know how to assign genotypes to pedigrees (dominant, recessive and X-linked)
o Know what genetic counseling is: __________________________________________________
o Know what amniocentesis and chorionic villi sampling are:
_____________________________________________________________________________________________
_____________________________________________________________________________________________
___________________________
o Distinguish between germ cell gene therapy and somatic cell gene therapy:
_____________________________________________________________________________________________
_____________________________________________________________________________________________
_____________________________________________________________________________________________
_____
o Be able to answer critical thinking questions.