Download Instructions/info

GENE EXPRESSION: PROTEIN SYNTHESIS
BACKGROUND INFORMATION
You have learned how a DNA molecule is able to act as a template for its own replication, and in so doing, you
have discovered how genetic information maintains the continuity of a species from one generation to the next.
You also know that genetic information is used to build and maintain the phenotype of the individual
organisms. How is the information stored in DNA used by each organism that possesses it? How do your cells
use the information stored in the sequence of nucleotides in your DNA to build and maintain the physical being
that is you?
In this activity you will develop your own explanation of the relationship between genotype and phenotype by
tracing the series of events that leads to gene expression. The gene you will study is the gene for sickle cell
disease, a potentially fatal condition. As you and your partner work through this activity, you will create a poster
that illustrates the molecular basis of sickle cell disease.
PROCESS & PROCEDURE
Part A: Looking at Sickle Cell Disease
1. Begin your study of the molecular basis of sickle cell disease by reading the following information about
this inherited disorder and about the associated gene.
Hemoglobin and Red Blood Cell Abnormalities in Sickle Cell Disease
Each year about 1 in 625 African-American children in the United States is born with sickle cell disease.
This disease is caused by an abnormality in hemoglobin, the protein in red blood cells that carries oxygen to
the cells of the body. When the oxygen supply in the blood is low (ex: strenuous exercise or high altitude),
these abnormal hemoglobin molecules clump together instead of remaining separate as normal hemoglobin
molecules do. The figure below shows this difference between the behavior of sickle cell hemoglobin and
normal hemoglobin.
Normal oxygen level in blood
Low oxygen level in blood
Normal oxygen level in blood
Low oxygen level in blood
The clumping of the hemoglobin molecules at low oxygen levels causes the shape of red blood cells in
a person with sickle cell disease to become long and rigid like a sickle instead of remaining round and flexible.
(see figure below).
Sickled red
Blood Cells
Normal Red
Blood Cells
This change in cell shape causes a variety of problems in the body (medical implications). For example, as
cells become sickled, they tend to block small blood vessels, causing pain and damage to the areas that are
not receiving an adequate blood supply (see below). The long-term effect of repeated blockages may
permanently damage a person's internal organs, including the heart, lungs, kidneys, brain, and liver. For some
people the damage is so severe that they die in childhood. With good medical care, however, many people
with sickle cell disease can live reasonable normal lives.
Sickle-shaped Red Blood
Cells in Blood Vessels
Normal shaped Red Blood
Cells in Blood Vessels
Sickle Cell Disease is associated with the genotype Hbs Hbs (ss). People who have this condition have two
abnormal genes, one inherited from each parent.
2. Discuss the following questions with your partner before writing your answer on the Team Answer
Sheet.
a. Define the term “allele.”
b. What medical symptoms might a person with sickle cell disease experience?
c. What is the physiological cause of these symptoms?
d. What problem in the red blood cells causes these symptoms to occur?
e. What problem in the behavior of the hemoglobin molecules is associated with these changes in
an individual's red blood cells?
f. Think back to your knowledge of DNA structure. What might be the molecular basis for the
phenotype of sickle cell disease?
3. Working with your partner, look over the poster template provided. In this assignment you will create a
poster that will illustrate the molecular basis of sickle cell disease. The top half of the poster is for
Normal Hemoglobin (HbS HbS) and the bottom for Sickle Hemoglobin (Hbs Hbs). Write in a title for
your poster at the top. As you read through the directions in Part B and C, keep in mind that the
information you fill in for sections 1-4 will be DNA/RNA nucleotides or amino acids.
1. Genotype (completed for you)
2. DNA Sequence
3. mRNA sequence
4. polypeptide (protein) sequence
The information for Sections 5-8 will be in picture form, which should be accompanied by labels.
There are four sets of pictures in the reading. Use these pictures and draw them in the appropriate
place on your poster.
5. Shape of the hemoglobin molecule
6.
Behavior of the hemoglobin molecule
7.
Shape of the red blood cell under low oxygen conditions
8.
Medical implications
TITLE:  write a title for your poster
1
genotype
2
DNA seq.
3
mRNA seq
4
protein
(amino acid)
sequence
5
6
7
8
Hb
Hb
RBC shape @ low
shape
behavior
medical
implications
oxygen levels
(RBC: Red Blood Cell)
normal
HbS HbS
sickle cell
Hbs Hbs
Part B: Looking at the Structure of the Gene Involved in Sickle Cell Disease
1. To understand in more detail how the information present in the hemoglobin gene is related to sickle
cell disease, refer to the DNA sequences below. Use these sequences as paper models of the same
portion of two different alleles of the hemoglobin gene (normal and sickled). Copy them onto your
poster.
DNA Sequences for Hemoglobin Alleles
Normal Allele:
AGGTCTCCTCTAATGGGTCTCCTTAGGTCTCCT
Sickle Cell Allele:
AGGTCTCCTCTAATGGGTCACCTTAGGTCTCCT
2. Compare the 2 nucleotide sequences.
a. Draw an arrow or a circle on your poster to indicate the nucleotides in the sickle cell sequence
that differ from those in the normal sequence.
b. What type of mutations exist in the sickle cell allele? (use section 12-4 from your textbook
and be sure to write your answer on your Team Answer Sheet)
Part C: Looking at the Expression of the Gene Involved in Sickle Cell Disease
1. To understand how the difference in sequence between the normal and sickle cell alleles of the
hemoglobin gene results in the symptoms associated with the disease, determine the messenger RNA
(mRNA) sequences that corresponds to the DNA sequences that you examined in Part B. One member
of the group should determine the mRNA sequence that results from the DNA sequence that
represents the allele for Normal Hemoglobin. The other group member should transcribe the mRNA
from the DNA sequence that represents the allele for Sickle Cell hemoglobin. Write both mRNA
sequences in section 3 of your poster.
2. Compare the mRNA that results from the transcription of the normal allele of the hemoglobin gene to
the mRNA that results from the transcription of the sickle cell allele. Use an arrow or a circle to indicate
on your poster the nucleotides in the sickle cell mRNA that differ from those in the normal sequence.
3. Use the genetic code handout to determine the amino acid sequence that would result from the
translation of both mRNA molecules. Write this sequence in section 4 of your poster.
4. Compare the amino acid sequence that results from transcription and translation of the normal allele for
the hemoglobin gene with the amino acid sequence that results from transcription and translation of the
sickle cell allele. Use an arrow or a circle to indicate on your poster the amino acids in the sickle cell
protein sequence that differ from those in the normal sequence.
5. Read the following information about the relationship between the sequence of amino acids in a
hemoglobin molecule and the molecule's shape.
Inside the environment of the red blood cell, a molecule of normal hemoglobin consists of four
protein chains folded into a globular shape. The molecule remains folded in this manner due to
attractive forces that occur between amino acids in different parts of the protein chains that
make up the molecule.
The change in the amino acid sequence that occurs as a result of the single nucleotide mutation
in the hemoglobin gene has no effect on the overall shape of the molecule when oxygen levels
are normal, so sickle cell hemoglobin behaves just like normal hemoglobin under these
conditions. When oxygen levels are low, however, the amino acid change alters the attractive
forces inside the molecule, causing molecules of sickle cell hemoglobin to assume a different
shape from those of normal hemoglobin. As the figure below shows, it is this change in
molecular shape under low oxygen levels- a change in shape that results from only one change
in the amino acid sequence- that causes sickle hemoglobin to form the rigid rods characteristic
of the condition.
The difference in behavior of sickle cell
hemoglobin is related to a shape change
that occurs at low oxygen levels. This
shape change results from the substitution
of the amino acid valine for a glutamic
acid.
a. SHAPE: Molecules of normal
hemoglobin will not associate with each
other because the bulge created by the
glutamic acid is too large to fit into a
pocket that occurs in another part of the
hemoglobin molecule. Molecules of sickle
hemoglobin, however, will associate with
each other because the bulge created
when a valine is substituted for the
glutamic acid is small enough to fit into the
pocket. (The size of the pocket does not
change.)  Column 5
b. BEHAVIOR: Molecules of normal
hemoglobin remain in solution, even under
conditions of low oxygen. In contrast,
molecules of sickle hemoglobin associate
together to form rigid cells under
conditions of low oxygen.  Column 6
6. Add the information presented in Step 5 above to the appropriate place in your team's poster.
7. Complete your team's poster by adding a descriptive title and any other details that you think would
help someone else understand the information that it presents.