Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
1. CTACGTGCGCAGAGGCATCGGGGAAAAAAA 2. AAAGTACGGTAGGTCGGAAATCGAAAAAAA 3. TACAATTTCGTATAAGGGATCTTAAAAAAAA 4. AGGATACTTCATGTCAACAGAAATCAAAAAA 5. ACTACCGAACTCGGCCTCTTATCAGGGAAAA 6. CCGGTACTTGAAGATTAAAATCCGGAGAAAA 7. GCGCTACACGAAGACAGGAATCGATCAAAAA 8. ATACTCGCACGCTGCGATCGGCCTTTTAAAAA 9. TCGGGCTACCCCCAATGTACCGTCAGTATCAA 10. AAGGATACCAGGTCTTTCCAATCAGGATTCAA 11. ACCGTACAGCCGTCTAGAGATCGATTTCAAAA 12. CTACGTGACTCTGGCAATCGATCAAGAAAAAA 13. TTACTTCATGTCATATGTCATCGGGAACAAAA 14. GGAAGGATACTGCGAGACTAACCCGATCAAAA 15. ATTCATACTTGCATCTCTCTTTTCCAATCAAAAA 16. TTTCCTACCCCTGATTAACCAGTATCGCCAAAA 17. TTAATACGTGACTCGGTCCATCGGGGCCGGCAA 18. AAAAAATACGCCCATCTCTAAGGGATCGGCAA 19. CAACTACTTGCAGATTAAATTTCCAATCAAAAA 20. TTTTTACCGAGATGTGGCTAACCCGATCACAAA DNA Message Number Copy the DNA Message Complementary DNA chain mRNA from the Original DNA Message Circle the codons on the mRNA above starting with the Start Codon (AUG) and end at the Stop Codon (UAG) Determine the AntiCodons for the Codons circled above. Find the words that the tRNA would represent and determine the message. DNA Message Number Copy the DNA Message Complementary DNA chain mRNA from the Original DNA Message Circle the codons on the mRNA above starting with the Start Codon (AUG) and end at the Stop Codon (UAG) Determine the AntiCodons for the Codons circled above. Find the words that the tRNA would represent and determine the message. Analysis: 1. How is complementary base paring different when pairing DNA to DNA than when pairing DNA to mRNA? 2. What is the role of each of the following molecules in protein synthesis? a. DNA b. mRNA c. tRNA d. Amino Acids 3. What is the process of transcription? 4. What location in the cell does transcription occur? 5. What is the process of translation? 6. What location in the cell does translation occur? 7. During the simulation, why were the words of the message written on the back of the tRNA cards? 8. Compare and contrast DNA polymerase and RNA polymerase? 9. Does transcription and translation start at the first nucleotide of the gene? Explain your answer. 10. Explain the difference between a codon and an anticodon. 11. What would happen to the message if you accidently wrote down the wrong letter when you were copying the DNA? Explain your answer. 12. Do you think it would make a bigger difference if you wrote the wrong letter or left a letter out? Explain your answer. 13. How did you know where to on the chain to start and stop making codons? 14. Name three differences between DNA and RNA Amino Acids tRNA Amino Acids tRNA a an and are Batman's ACC CUG GAU GCU UCG UGU AAG CAU CAA GUG best CCG has have love mother Mr. Clendenon much CCU biology breath butt cheese day dog dress Ducks ear eat every father fun funny girls hockey I idiot is jump kicks kind L.A. Kings like look CGA GGA GAA GUC CCA ACA AGU AGC AUU CAG UUU UGA CUU UCC GCC GAG UUG GCA ACU GAC AGG UAG UGC nice nothing old padded play read smells so someone superman teaches team tell the them they tights to us wax weak wears with GGG GGC UAU GCG CGU UCU AUG CGG UUC GGU CGC GUU AAU AAC AUA GUA CAC CUC AGA AAA CUA UUA UGG UCA UAA you your ACG CCC "START" "STOP" UAC AUC