Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Regulatory Role of CARD3 in Left Ventricular Remodelling and Dysfunction After Myocardial Infarction Liangpeng Li • Xiaodi Wang • Wen Chen • Haoyu Qi • Ding-Sheng Jiang • Ling Huang • Fuhua Huang • Liming Wang • Hongliang Li • Xin Chen L. Li • X. Wang • W. Chen • H. Qi • F. Huang • L. Wang • X. Chen () Department of Thoracic and Cardiovascular Surgery, Nanjing Hospital Affiliated to Nanjing Medical University, Changle Road 68, Nanjing 210006, Jiangsu, People’s Republic of China. D. Jiang • L. Huang • H. Li Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan 430060, China; Cardiovascular Research Institute of Wuhan University, Wuhan 430060, People’s Republic of China Correspondence to Xin Chen, PhD, MD Professor and Director Department of Thoracic and Cardiovascular Surgery Nanjing Hospital Affiliated to Nanjing Medical University Address: Changle Road 68, Nanjing 210006, Jiangsu, P. R. of China. Tel & Fax: 86-25-52247821. Email: [email protected] Supplemental Tables Supplementary Table 1. The primers for Real-Time PCR. Primer name Forward Primer Reverse Primer CARD3-human TCCGCTGCTCGACAGTGAAAGA GGGCAATTTCATGCAGGATGCGA CARD3-mouse AGGTTCAGAGCGCCCACCAATT AAGGGCGTCCAGCGATTGGTTA ANP-Mouse ACCTGCTAGACCACCTGGAG CCTTGGCTGTTATCTTCGGTACCGG BNP-Mouse GAGGTCACTCCTATCCTCTGG GCCATTTCCTCCGACTTTTCTC β-MHC-Mouse CCGAGTCCCAGGTCAACAA CTTCACGGGCACCCTTGGA CTGF-Mouse TGACCCCTGCGACCCACA TACACCGACCCACCGAAGACACAG Collagen I-Mouse AGGCTTCAGTGGTTTGGATG CACCAACAGCACCATCGTTA Collagen III-Mouse CCCAACCCAGAGATCCCATT GAAGCACAGGAGCAGGTGTAGA Bcl-2-Mouse TGGTGGACAACATCGCCCTGTG GGTCGCATGCTGGGGCCATATA IL-1β-Mouse CCGTGGACCTTCCAGGATGA GGGAACGTCACACACCAGCA MCP-1-Mouse TGGCTCAGCCAGATGCAGT CCAGCCTACTCATTGGGATCA Supplemental Figures Fig. S1 The sites of ligature were confirmed in KO and TG mouse hearts by Evans blue staining. The heart sections of KO and TG mice after MI surgery are located in the concordant ligation sites (n=5 mice per experimental group). A blue color indicated normal myocardial tissue, while a pale gray color indicated infarcted tissue. Fig. S2 The schematic diagram for the assessment of infarct size. The LV myocardial midline was marked with the broken white line at the center between the epicardial (red) and endocardial (green) surfaces and the length of the midline was measured as midline circumference. Midline infarct length (blue arrow line) was taken as the midline of the length of infarct. Fig. S3 Immunohistochemical staining of the cardiac CARD3 protein in the heart sections of wild type mice after sham or MI surgery. I: infarct area; B: border zone; R: remote area. Fig. S4 Effects of CARD3 on infarct size and cardiomyocyte apoptosis 3 days after MI. a Histological analysis of hematoxylin and eosin (H&E)-stained WT and CARD3-KO hearts at 3 days after MI (n=4 mice per experimental group). b H&E staining in NTG and CARD3-TG mice at 3 days post-MI (n=4 mice per experimental group). c Representative merged images via TUNEL staing showing cardiomyocyte apoptosis in the border zone of WT and CARD3-KO hearts at 4 weeks post-MI (n=4 mice per experimental group; magnification, 400 x). d TUNEL staining in the border zone of NTG and CARD3-TG hearts at 4 weeks post-MI (n=4 mice per experimental group).