Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Supplementary Information (doc 488K)
Document related concepts
no text concepts found
Transcript
SUPPLEMENTAL MATERIAL Figure Legends Supplemental Figure One. A. Detailed characterization of six iPSC cell lines—three from controls (C1-C3), and three from bipolar patients (BP1-BP3). Fibroblast cell lines from each patient sample exhibit a fusiform morphology and express the fibroblast marker Te-7 (Fibroblast; Cy3-secondary antibody, red). As they form aggregates of iPSC, Te-7 expression is downregulated (iPSC; primary antibody Te-7, Cy3-secondary antibody). Hoechst 23487 (blue) identifies nuclei, Scale bars = 200 m. B. Markers of pluripotency including the nuclear marker Nanog, and cell surface restricted proteins SSEA4,Tra-1-60 and alkaline phosphatase (AP) are induced. Cy3 – secondary antibody. C. PCR analysis of the expression of pluripotency markers, Nanog, Oct4 and Sox2, in each of the six iPSC lines. B-actin – loading control. D. IPSC from each patient sample were differentiated in suspension culture in complete medium to form embryoid bodies. After 45 days of differentiation, RNA was extracted and subjected to PCR to determine the expression of lineage markers: alpha-fetoprotein (AFP, endoderm), smooth muscle actin (SMA), and ectoderm (B-III tubulin), B-actin – control. Supplemental Figure Two. Characterization of Neural Progenitors. After rosettes were picked and passaged 2-3 times, cells were plated for differentiation in defined medium. Neural progenitor cells express nuclear Sox2 (Cy3-secondary antibody) and cytoplasmic nestin (FITC-secondary antibody). Scale bars = 200 m. Supplemental Figure Three. A. Scatterplots illustrate the distribution of transcripts significantly altered in cells derived from BP and control individuals (FC > 15% and A > 4, p < 0.05). Average probe intensities are shown on the X axis, mean fold change in log2 ratio on the Y axis. Red = transcripts upregulated, Green = down-regulated transcripts. B. Dendrogram illustrating a distinct transcriptional signature in neurons from patients with bipolar disorder (N2; 7-9) compared with controls (N1; 10-12), whereas iPSCs from bipolar samples (1-3) or controls (4-6) have indistinguishable transcriptional signatures. Supplemental Figure Four. Immunohistochemical localization of the ventral protein NKX2-1 and of the dorsal marker EMX2 in neuronal precursors exposed to purmorphamine (PM), no treatment (0), or to lithium chloride (Li), in control (C), or BP cell lines. Neuronal precursors respond to purmorphamine by increasing the number of NKX2-1 + cells present (A,D) compared to untreated cultures (B,E), while exposure to lithium increased the number of cells expressing EMX2 in both groups (C,F). Scale Supplemental Figure Five. KCl induced changes in Flo-4AM fluorescence intensity (y axis) over 5 minutes (x axis) in C vs BP neurons + Li treatment. Supplemental Tables Supplemental Table 1 A. Antibodies Antibody EMX2 NKX2-1 Nanog Nestin PAX6 SOX2 SSEA4 Synapsin1 Te-7 Tra1-60 Source Santa Cruz; sc-19956 AbCam; ab76013 Abcam; AAB21624 Millipore; MAB4304 Stemgent; 09-0075 Santa Cruz; Sc17317 Millipore; MAB4304 Cell Signaling; 5297 Millipore; CBL271 Millipore; MAB4360 Dilution 1:100 1:250 1:200 1:500 1:500 1:100 1:200 1:200 1:500 1:200 B. PRIMERS Transcript Forward Reverse -fetoprotein CCATGTACATGAGCACTGTTG CTCCAATAACTCCTGGTATCC -III tubulin ATGCGGGAGATCGTGCACAT CCCTGAGCGGACACTGT -actin GCCGAGGACTTTGATTGC GTGTGGACTTGGGAGAGG Nanog TAGCAATGGTGTGACGCAGA CCTCGCTGATTAGGCTCCAA Nkx2.1 GCAAGATGTAGGCTTCTATTGTCTTG GCTGCCTCGCGTTTGTTTTA OCT4 CTGCAGTGTGGGTTTCGGGCA CTTGCTGCAGAAGTGGGTGGAGGA Smooth muscle actin GATCACCATCGGAAATGAAACGT TTTAGAAGCATTTGCGGTGGAC Sox-2 ATGCACCGCTACGACG CTTTTGCACCCCTCCCATTT C. Transcript MEAN ct FC TaqMan t test FC MA t-test MA array BDNF -1.0686 2.0974 -0.201 -1.5520 0.074 - GABRA3 -0.3676 1.2902 0.58 -1.4906 0.045 - GLI1 -1.3540 2.5562 0.06 1.7146 0.146 + Taq-man Analysis HOXA2 LEFTY1 -4.3788 1.5619 20.8052 -2.9526 0.12 0.04 2.2778 -5.8886 0.083 0.012 + + MAP2 -3.4913 11.2458 0.03 5.0126 0.07 + SNAI2 -4.2276 18.7337 0.04 4.6951 0.05 + ZIC1 -3.5820 11.9750 0.1 6.4566 0.13 + Supplemental Table 1. A. Antibodies employed, their source, and working dilutions. B. Primer sets. C. Taq-man validation of chosen transcripts. Data are expressed as BP vs C. The final row illustrates corresponding (+) or not corresponding (-) expression levels in microarray analysis. I. Transcripts Increased in iPSC vs Neurons Supplemental Table 2 KEGG PATHWAY: Calcium signaling Transcript ATP2A2 ATP2B1 GNAS ADRA1D ADRB3 CACNA1E CAMK2B CAMK2D CAMK2G CALM3 CALML3 F2R EDNRA EGFR GRIN2C GNA14 HRH1 ITPR3 TNF LTB4R2 NOS1 NOS3 PPID PDE1A PLN PLCE1 PHKA2 PHKB PTAFR PRKCA PRKACB PPP3CC P2RX1 RYR1 SPHK1 SPHK2 1 Chromosome 12q24.11 12q21.3 20q13.3 20p13 8p12 1q25.3 7p14.3-p14.1 4q26 10q22 19q13.2-q13.3 10p15.1 5q13 4q31.22 7p12 17q25 9q21 3p25 6p21 6p21.3 14q11.2-q12 12q24.2-q24.31 7q36 4q31.3 2q32.1 6q22.1 10q23 Xp22.2-p22.1 16q12-q13 1p35-p34.3 17q22-q23.2 1p31.1 8p21.3 17p13.3 19q13.1 17q25.2 19q13.2 Association1 SZ27 BP35 BP63 0 0 ASD73 SZ72 SZ34; BP94 0 0 0 0 BP45 BP92 0 0 0 0 BP26 0 SZ91 BP82 0 MDD112 0 BP2 0 0 0 SZ12 MDD90; BP3 BP62 0 NMS88 0 0 Legend: ADHD=attention deficit hyperactivity disorder; ASD = autism spectrum disorder; BP = bipolar disorder; DS= down syndrome; ID=intellectual disability; MDD= major depressive disorder; NB=neuroblastoma; NMS= neuroleptic malignant syndrome; SCA=spinocerebellar ataxia; SZ = schizophrenia; TTS = Tourette’s syndrome. TNNC1 3p21.1 SZ89 VDAC3 8p11.2 0 Supplemental Table Two. KEGG pathway analysis of the transcripts expressed at significantly higher levels in iPSC compared with neurons identified 38 members of the Calcium signaling pathway. Many have previously been associated with neuroaffective or neurodevelopmental disorders (Association) or are located at BP susceptibility loci. II. Transcripts Increased in BP vs Control iPSC Supplemental Table 3 Cluster One: Transcript COL2A1 DLC1 EDN1 FBN2 FOXG1 FZD3 GAS1 GREM1 HOXA1 MSX2 NEUROD1 RARB ROR2 SATB2 SLIT2 TFAP2A TSHZ1 Embryonic morphogenesis Chromosome Association 12q13.11 0 8p22 0 6p24.1 0 5q23-q31 0 14q13 Microcephaly54 8p21 SZ46,48 9q21.3-q22 0 15q13.3 SZ3 7p15.3 ASD13 5q35.2 0 2q32 MDD36 3p24.2 3p; SZ78 9q22 0 2q33 ID83 4p15.2 4p; Suicide attempters93 6p24 ADHD59 18q22.3 18q Supplemental Table Three. Of the 14 significant clusters of genes expressed at higher levels in BP vs C iPSC, Cluster One contained 17 genes associated with embryonic development including: patterning factors, signaling molecules, and cell-cell or cell-extracellular matrix adhesion factors. Supplemental Table 4 CLUSTER Two: Signal Transcript Chromosome ACVRIB 12q13 ADAMTS19 5q23.3 ANTXR2 4q21.21 BMP5 6p12.1 BMPR1B 4q22-q24 CADM1 11q23.2 CD47 3q13.1-q13.2 CDH2 18q11.2 CDH6 5p13.3 COL1A2 7q22.1 COL2A1 12q13.11 COL4A6 Xq22.3 CXCL14 5q31 DLL1 6q27 EDN1 6p24.1 EDNRA 4q31.22 EPHA7 6q16.1 FAM20A 17q24.2 FBN2 5q23-q31 FNDC5 1p35.1 FST 5q11.2 FZD3 8p21 GALP 11q13.43 GAS1 9q21.3-q22 GREM1 15q13.3 LEPR 1p31 LHCGR 2p21 LPHN3 4q13.1 LPL 8p22 LRIG3 12q14.1 LRP2 2q24-q31 LRP4 11p11.2 LRRN3 7q31.1 LYPD1 2q21.2 NID2 14q22.1 PAPPA 9q33.2 PCDH10 4q28.3 PCDH17 13q21.1 PCDH18 4q31 PI15 8q21.11 PLAT 8p12 Association SZ44 0 0 SZ44 0 ASD30 SZ68 18q 0 0 0 Lissencephaly25 0 6q; ASD32; DS67 0 0 6q 0 0 0 0 SZ46,48 0 0 SZ3 ID39; MDD105 0 Dyslexia29 SZ57 0 ASD42 0 ASD60 0 0 0 ASD69 13q 0 8q ASD, SZ97 PRTG RGMB RNASE1 RNASE4 RNF43 ROR2 SEMA3C SLIT2 SLITRK6 SOST SPON1 TFPI THBS3 UNC5C WLS 15q21.3 5q15 14q11.2 14q11 17q22 9q22 7q21-q31 4p15.2 13q31.1 17q11.2 11p15.2 2q32 1q21 4q21-q23 1p31.3 ASD110 ASD86 MDD5; SZ4 0 0 0 SZ3 4p; Suicide attempters93 13q; BP37 0 SZ33 0 0 ASD71 0 Supplemental Table Four. Of the transcripts expressed at significantly higher levels in BP vs C iPSC, Cluster Two contained 56 transcripts associated with the term “Signal”. This group contained secreted factors as well as extracellular matrix and cell surface molecules and receptors. Supplemental Table 5 Cluster Three: Axonogenesis Transcript Chromosome Association EPHA7 6q16.1 6q SLITRK6 13q31.1 13q; BP37 BMPR1B 4q22-q24 0 FOXG1 14q13 Microcephaly54 GAS1 9q21.3-q22 0 HOXA1 7p15.3 ASD13 SLIT2 4p15.2 4p; Suicide attempters93 UNC5C 4q21-q23 ASD71 ULK2 17p11.2 SZ40 Supplemental Table Five. Cluster Three contained 9 genes associated with the GO Term “Axonogenesis” that were expressed at higher levels in BP iPSC compared with control iPSC. These included cell surface molecules and receptors. Supplemental Table 6 Cluster Six: Cell adhesion Transcript Chromosome Association ARHGAP5 14q12 0 BMPR1B 4q22-q24 0 CADM1 11q23.2 ASD30 CD47 3q13.1-q13.2 SZ68 CDH2 18q11.2 18q CDH6 5p13.3 0 COL2A1 12q13.11 0 COL4A6 Xq22 Lissencephaly25 DLC1 8p22 0 NEDD9 6p25-p24 0 NID2 14q22.1 0 PCDH10 4q28.3 ASD81,103 PCDH17 13q21.1 13q; SZ23 PCDH18 4q31 0 RGMB 5q15 ASD86 RHOB 2p24 0 ROR2 9q22 0 SPON1 11p15.2 SZ33 THBS3 1q21 0 Supplemental Table Six. Cluster Six contained 19 transcripts that encode proteins involved in cell- or cell-extracellular matrix adhesion that were up-regulated in BP iPSC Supplemental Cluster Ten: Positive regulation of development Transcript Chromosome Association ACVRIB 12q13 SZ44 BMPR1B 4q22-q24 0 FOXG1 4q13 Microcephaly54 FST 5q11.2 0 ID2 2p25 0 IRX3 16q12.2 0 LPL 8p22 SZ57 NEUROD1 2q32 MDD36 RHOB 2p24 0 SLIT2 4p15.2 4p; Suicide attempters93 TIAM1 21q22.11 0 ZFHX3 16q22.3 0 Table 7 Supplemental Table Seven. Cluster Ten identified 12 transcripts expressed at higher levels in BP vs C iPSC that are associated with the positive regulation of development. They include cell surface receptors, transcription factors and secreted molecules. III. Transcripts Increased In BP vs Control Neurons Supplemental Table 8 CLUSTER ONE: Plasma Membrane part Transcript Chromosome ALK 2p23 AP1S3 2q36.1 CACNA1E 1q25.3 CHRNB4 15q24 CNTN1 12q11-q12 CTNNA3 10q22.2 DIRAS2 9q22.2 DLGAP3 1p35.3-p34.1 GABRG2 5q34 GPR22 7q22-q31.1 GRIA4 11q22 HSPA12A 10q26.12 ITGBL1 13q33 KCNA3 1p13.3 KCND3 1p13.3 KCNIP4 4p15.32 KCNJ3 2q24.1 LOC100287987 3q13.11 LOC441528 Xp22.33 MAOB Xp11.23 MME 3q25.2 MPP2 17q12-q21 NLGN1 3q26.31 NPY1R 4q31.3-q32 P2RX5 17p13.3 PCDH17 13q21.1 PRKX Xp22.3 PRMT8 12p13.3 PTGER3 1p31.2 RAB7L1 1q32 RAPH1 2q33 SEMA5A 5p15.2 SEMA6A 5123.1 SLC12A5 20q13.12 SLC13A3 20q13.12 SLC7A1 13q12.3 SNTG1 8q11-q12 TF 3q22.1 TGFB1i1 16p11.2 TJP2 9q13-q21 TYRO3 15q15 Association NB24 SZ33 0 ADHD, MDD14 SZ70 0 ADHD, BP82 TTS22 SZ115 0 SZ61 SZ77 13q; SZ18 BP9 SCA56 4p; ADHD109 SZ113 0 0 SZ, ASD76,108 0 ID28 ASD114; ASD,ID,SZ38 SZ43 0 13q; SZ23 0 0 SZ98 BP74 0 ASD65 0 MDD,SZ99 0 13q 8q SZ80 16p SZ70 0 Additional transcripts significantly increased in BP neurons, but not included in Cluster 1 GAMT 19p13.3 ID58 FGF14 13q34 SCA11 RCAN2 6p12.3 DS84.96 SMARCA2 TUBB4A 9p22.3 19p13.3 ID104; SZ51 Agenesis of the corpus callosum101 Supplemental Table Eight. Of the transcripts that were significantly increased in BP vs C neurons Functional Annotation Cluster analysis identified a cluster of 41 transcripts associated with the term “Plasma membrane part”. Additional transcripts that have been previously associated with neurodevelopmental disorders, but not present in Cluster one are also included in this table. Supplemental Table 9 Cluster Two: Ion Transport Gene Chromosome CACNA1E 1q25.3 CHRNB4 15q24 GABRG2 5q34 GRIA4 11q22 KCNA3 1p13.3 KCND3 1p13.3 KCNIP4 4p15.32 KCNJ3 2q24.1 P2RX5 17p13.3 SLC12A5 20q13.12 SLC13A3 20q13.12 SLC24A3 20p13 SLC38A4 12q13 SLC41A2 12q23.3 TF 3q22.1 Association 0 ADHD14 SZ115 SZ61; BP16 BP9 SCA56 4p; ADHD109 SZ99 0 SZ80 0 0 0 0 SZ80 Supplemental Table Nine. Cluster Two contained 15 transcripts involved in ion transport that were significantly increased in BP neurons, including genes involved in cation channels, receptors and cell surface molecules. IV. Transcripts Increased In Control vs BP Neurons Supplemental Table 10 Cluster 1. Nucleus Transcript Chromosome AEN 15q26.1 BC2L1 20q11.21 BCL11B 14q32.2 CDK1 10q21.1 CECR2 22q11.2 CHD1L 1q12 CHD2 15q26 CSRP2 12q21.1 DCP2 5q22.2 DMRTA2 1p32.3 EMX2 10q26.1 EOMES 3p24.1 EYA3 1p36 FEZF2 3p14.2 GATAD2A 19p13.11 HDAC4 2q37.3 HNRNPC 14q11.2 HNRNPD 4q21 HNRNPM 19p13.3-p13.2 KHDRBS2 6q11.1 KIFC1 6p21.3 MED13L 12q24.21 MLLT10 10p12 MZF1 19q13.4 NCOA2 8q13.3 NFIB 9p24.1 NR6A1(GCNF) 9q33.3 PLCD4 2q35 PPARA 22q13.31 SNRPA 19q13.1 SOX6 11p15.3 SRSF3 6p21 STK36 2q35 TCF3 19p13.3 TIPIN 15q22.31 UHRF1 19p13.3 YES1 18p11.31-p11.21 ZCCHC18 Xq22.2 ZNF207 17q11.2 ZNF536 19q12 ZNF586 19q13.43 ZNF606 19q13.4 Association 0 SZ40 MDD55 0 Neurulation defect7 0 0 ASD32 0 0 Schizencephaly10,100 Microcephaly6 0 ASD95 0 ID87 SZ33 SZ64 BP49 6q 0 Psychosis102 0 0 8q ASD17 0 BP36 SZ20 0 SZ70 BP107 Hydrocephalus106 0 0 0 18p 0 0 Microcephaly8 0 0 Supplemental Table Ten. Of the transcripts expressed at significantly higher levels in Control vs BP neurons, a single significant cluster of 42 transcripts associated with the term “Nucleus” was identified. Transcripts that encode patterning factors and signaling molecules, as well as transcription factors were present in this group. V. Transcripts Coordinately Expressed in BP Premotor Cortex and in BP iPSC- Derived Neurons Supplemental Table 11 Transcript AKAP11 ATP5O C11orf31 C19orf42/SMIM7 C1orf57/NTPCR C20orf30/TMEM230 C6orf106 CCDC88A CCND2 CEP68 CIAO1 CLASP2 CNOT7 CNTN4 COG5 COPS3 CSNK2A1 DR1 FANCF FBXO38 GTF2H1 HEMK1 HIPK2 JTB KPNA6 LARS MAD2L1 MAGI1 MAPK14 MIB1 MPHOSPH9 MPI MRPL16 Coordinate Regulation DOWN DOWN DOWN DOWN DOWN DOWN DOWN UP DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN UP DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN Chromosome 13q14.11 21q22.11 11q12.1 19p13.11 1q42,2 20p13 6p21.31 2p16.1 12p13 2p14 2q11.2 3p22.3 8p22-021.3 3p26.3 7q31 17p11.2 20p13 1p22.1 11p15 5q32 11p15.1-p14 3p21.3 7q32-q34 1q21 1p35.1 5q32 4q27 3p14.1 6p21.3-p21.2 18q11.2 12q24.31 15q22qter 11q12.1 Association 0 BP53 SZ33 0 SZ31 ASD32 0 0 BP9; SZ78 0 0 BP85 0 ASD21 0 0 SZ3 SZ1 0 0 0 0 0 0 0 0 0 BP47 0 0 0 0 0 MRPS22 MRS2 NMT1 OGT PCNP PDE4DIP POLR3E PSMA5 PSMB4 PSMD4 RC3H2 RNF146 SLC25A15 SLC6A15 SSBP1 STK17B SUPT7L TMEM43 TPI1 TTC14 UBE2Z XRCC5 ZSCAN18 DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN DOWN 3q23 6p22.3-p22.1 17q21.31 Xq13 3q12.3 1q12 16p12.2 1p13 1q21 1q21.3 9q34 6q22.1-q22.33 13q14 12q21.3 7q34 2q32.3 2p23.3 3p25.1 12p13 3q26.33 17q21.32 2q35 19q13.43 0 0 0 0 0 ASD41 0 SZ19 MDD112 0 0 0 SZ66 MDD52 ASD75 0 NTDs15 0 SZ50 0 0 0 SZ31 Supplemental Table Eleven. Transcripts expressed at significantly higher levels in BP vs C neurons were compared with transcripts expressed at significantly higher levels in the premotor cortex of patients with BP who were not taking typical antipsychotic medications. Of the 57 transcripts that were coordinately expressed, only two were both up-regulated. Kinases, cell cycle and signaling pathway members were present; some have previously been associated with neurodevelopmental or psychiatric conditions. Supplemental References 1. Akaho R, Matsushita I, Narita K, Okazaki Y, Okabe Y, Matsushita M et al., Support for an association between HLA-DR1 and schizophrenia in the Japanese population. Am J Med Genet 200; 96: 725-727. 2. Alliey-Rodriguez N, Zhang D, Badner JA, Lahey BB, Zhang X, Dinwiddie S et al. Genome-wide association study of personality traits in bipolar patients. Psychiatr Genet. 2011; 21: 190-194. 3. Arion D, Horvath S, Lewis DA, Mirnics K. Infragranular gene expression disturbances in the prefrontal cortex in schizophrenia: signature of altered neural development? Neurobiol Dis 2010; 37: 738-746. 4. Aston C, Jiang l, Sokolov BP. Microarray analysis of postmortem temporal cortex from patients with schizophrenia. Mol Psychiatry 2005; 10: 309-322. 5. Aston C, Jiang L, Sokolov BP. Transcriptional profiling reveals evidence for signaling and oligodendroglial abnormalities in the temporal cortex from patients with major depressive disorder. J Neurosci Res 2004; 77: 858-866. 6. Baala L, Briault S, Etchevers HC, Laumonnier F, Natiq A, Amiel J, Boddaert N, Picard C, Sbiti A, Asermouh A, Attie-Bitach T, Encha-Razavi F, Munnich A, Sefiani A, Lyonnet S. Homozygous silencing of T-box transcription factor EOMES leads to microcephaly with polymicrogyria and corpus callosum agenesis. Nat Genet 2007; 39: 454-456. 7. Banting GS, Barak O, Ames TM, Burnham AC, Kardel MD, Cooch NS, Davidson CE, Godbout R, McDermid HE, Shiekhattar R. CECR2, a protein involved in neurulation, forms a novel chromatin remodeling complex with SNF2L. Hum Mol Genet 2005; 14: 513-524. 8. Bartsch O, Schindler D, Beyer V, Gesk S, van't Slot R, Feddersen I, Buijs A, Jaspers NG, Siebert R, Haaf T, Poot. A girl with an atypical form of ataxia telangiectasia and an additional de novo 3.14 Mb microduplication in region 19q12. Eur J Med Genet 2012; 55: 49-55. 9. Benes FM, Lim B, Matzilevich D, Subbaraju S, Walsh JP. Circuitry-based gene expression profiles in GABA cells of the trisynaptic pathway in schizophrenics versus bipolars. Proc Natl Acad Sci 2008; 105: 20935-20940. 10. Brunelli S, Faiella A, Capra V, Nigro V, Simeone A, Cama A et ak. Germline mutations in the homeobox gene EMX2 in patients with severe schizencephaly. Nat Genet 1996; 12: 94-96. 11. Brusse E, De Koning I, Maat-Kievit A, Oostra BA, Heutink P, van Swieten JC. Spinocerebellar ataxia associated with a mutation in the fibroblast growth factor 14 gene (SCA27): a new phenotype. Mov Disord 2006; 21: 396-401. 12. Carroll LS, Williams NM, Moskvina V, Russell E, Norton N, Williams HJ et al. Evidence for rare and common genetic risk variants for schizophrenia at protein kinase C, alpha. Mol Psychiat 2010; 15: 1101-1111. 13. Chakrabarti B, Dudbridge F, Kent L, Wheelwright S, Hill-Cawthorne G, Allison C et al. Genes related to sex steroids, neural growth, and social-emotional behavior are associated with autistic traits, empathy, and Asperger syndrome. Autism Res 2009; 2: 157-177. 14. Chen LS, Xian H, Grucza RA, Saccone NL, Wang JC, Johnson EO et al. Nicotine dependence and comorbid psychiatric disorders: examination of specific genetic variants in the CHRNA5-A3-B4 nicotinic receptor genes. Drug Alcohol Depend 2012; 123S1: S42-51. 15. Chen X, Shen Y, Gao Y, Zhao H, Sheng X, Zou J et al. Detection of copy number variants reveals association with neural tube defects. PLosOne 2013; 8: e54492. Doi: 10.1371/journal.pone.0054492 16. Chiesa A, Crisafulli C, Porcelli S, Balzarro B, Han C, Patkar AA et al. Case-control association study of GRIA1, GRIA2 and GRIA4 polymorphisms in bipolar disorder. Int J Psychiatry Clin Pract 2012; 16: 18-26. 17. Choi J, Ababon MR, Matteson PG, Millonig JH. Cut-like homeobox1 and nuclear factor I/B mediate ENGRAILED autism spectrum disorder-associated haplotype function. Hum Mol Genet 2012; 21: 1566-1580. 18. Chumakov I, Blumenfeld M, Guerassimenko O, Cavarec L, Palicio M, Abderrahim H et al. Genetic and physiological data implicating the new human gene G72 and the gene for D-amino acid oxidase in schizophrenia. Proc Natl Acad Sci USA 2002; 99: 13675-13680. 19. Cohen OS, Mccoy SY, Middleton FA, Bialosuknia S, Zhang-James Y, Liu L et al. Transcriptomic analysis of postmortem brain identifies dysregulated splicing events in novel candidate genes in schizophrenia. Schizophr Res 2012; 142: 188-199. 20. Costa M, Squassina A, Congiu D, Chillotti C, Niola P, Galderisi S et al. Investigation of endocannabinoid system genes suggests association between peroxisome proliferator activator receptor - gene (PPARA) and schizophrenia. Eur Neuropsychopharmacol. 2012; ePub. August 21. 21. Cottrell CE, Bir N, Varga E, Alvarez CE, Bouyain S, Zernzach R et al. Contactin 4 as an autism susceptibility locus. Autism Res 2011; 4: 189-199. 22. Crane J, Fagerness J, Osiecki L, GunnellB, Stewart SE, Pauls DL et al. Tourette Syndrome International Consortium for Genetics. Family-based genetic association study of DLGAP3 in Tourette Syndrome. Am J Med Genet B. Neuropsychiatr Genet 2011; 156B: 108-114. 23. Dean B, Keriakous D, Scarr E, Thomas EA. Gene expression profiling in Brodmann’s area 46 from subjects with schizophrenia. Aust NZ J Psychiat 2007; 41: 308-320. 24. dePontual L, Kettaneh D, Gordon CT, Oufadem M, Boddaert N, Lees M et al. Germline gain-offunction mutations of ALK disrupt central nervous system development. Hum Mutat 2011; 32: 272-276. 25. Dobyns WB, Andermann E, Andermann F, Czpansky-Beilman D, Dubeau F, Dulac O et al. Xlinked malformations of neuronal migration. Neurology 1996; 47: 331-339. 26. Doganavsargil-Baysal O, Cinemre B, Aksoy UM, Akbas H, Metin O, Fettahoglu C et al. Levels of TNF-α, soluble TNF receptors (sTNFR1, sTNFR2), and cognition in bipolar disorder. Hum Psychopharmacol 2012; 28: 160-167. 27. Earls LR, Fricke RG, Yu J, Berry RB, Baldwin LT, Zakharenko SS. Age-dependent microRNA control of synaptic plasticity in 22q11 deletion syndrome and schizophrenia. J Neurosci 2012; 32: 14132-14144. 28. Echaniz-Laguna A, Mohr M, Epailly E, Nishino I, Charron P, Richard P et al. Novel lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve 2006; 33: 393-397. 29. Field LL, Shumansky K, Ryan J, Truong D, Swiergala E, Kaplan BJ.. Dense-map genome scan for dyslexia supports loci at 4q13, 16p12, 17q22; suggests novel locus at 7q36. Genes Brain Behav 2013; 12: 56-69. 30. Fujita E, Tanabe Y, Imhof BA, Momoi MY, Momoi T. A complex of synaptic adhesion molecule CADM1, a molecule related to autism spectrum disorder, with MUPP1 in the cerebellum. J Neurochem 2012; 123: 886-894. 31. Gardiner EJ, Cairns MJ, Liu B, Beveridge NJ, Carr V, Kelly B et al. Gene expression analysis reveals schizophrenia-associated dysregulation of immune pathways in peripheral blood mononuclear cells. J Psychiatr Res 2013; 47: 425-437. 32. Ghahramani Seno MM, Hu P, Gwadry FG, Pinto D, Marshall CR, Casallo G et al. Gene and miRNA expression profiles in autism spectrum disorders. Brain Res 2011; 1380: 85-97. 33. Glatt SJ, Stone WS, Nossova N, Liew C-C, Seidman LJ, Tsuang MT. Similarities and differences in peripheral blood gene-expression signatures of individuals with schizophrenia and their first-degree biological relatives. Am J Med Genet 2011; 156: 869-887. 34. Glessner JT, Reilly MP, Kim CE, Takahashi N, Albano A, Hou C et al. Strong synaptic transmission impact by copy number variations in schizophrenia. Proc Natl Acad Sci USA 2010; 107: 10584-10589. 35. Gordon-Smith K, Jones LA, Burge SM, Munro CS, Tavadia S, Craddock N. The neuropsychiatric phenotype in Darier disease. Br J Dermatol 2010; 163: 515-522. 36. Gratacos M, Costas J, de Cid R, Bayes M, Gonzalez JR, Baca-Garcia E et al. Psychiatric Genetics Network. 2009. Identification of new putative susceptibility genes for several psychiatric disorders by association analysis of regulatory and non-synonymous SNPs of 306 genes involved in neurotransmission and neurodevelopment. Am J Med Genet B. Neuropsychiatr Genet 2009; 150B: 808-816. 37. Greenwood TA, the Bipolar Genome Study Consortium, Kelsoe JR. 2013. Genome-wide association study of irritable vs elated mania suggests genetic differences between clinical subtypes of bipolar disorder. PLoS One 8: e53804. 38. Guilmatre A, Dubourg C, Mosca AL, Legallic S, Goldenberg A, Drouin-Garraud V et al. Recurrent rearrangements in synaptic and neurodevelopmental genes and shared biologic pathways in schizophrenia, autism and mental retardation. Arch Gen Psychiatry 2009; 66: 947-956. 39. Guo M, Lu Y, Garza J, Li Y, Chua SC, Zhang W et al. Forebrain glutamatergic neurons mediate leptin action on depression-like behaviors and synaptic depression. Transl Psychiat 2012; 2: e83. 40. Horesh Y, Katsel P, Haroutunian V, Domany E. Gene expression signature is shared by patients with Alzheimer’s disease and schizophrenia at the superior temporal gyrus. Eur J Neurol 2011; 18: 410-424. 41. Hu VW, Sarachana T, Kyung SK, Nguyen A, Kulkami S, Steinberg ME et al. Gene expression profiling differentiates autism case-controls and phenotypic variants of autism spectrum disorders: evidence for circadian rhythm dysfunction in severe autism. Autism Res 2009; 2: 78-7. 42. Ionita-Laza I, Makarov V, the ARRA Autism Sequencing Consortium 3, Buxbaum JD. Scan-statistic approach identifies clusters of rare disease variants in LRP2, a gene linked and associated with autism spectrum disorders, in three datasets. Am J Hum Genet 2012; 90: 1002-1013. 43. Iwamoto K, Kato T. Gene expression profiling in schizophrenia and related mental disorders. Neuroscientist 2006; 12: 349-361. 44. Jia, P, Wang L, Meltzer HY, Zhao Z.. Common variants conferring risk of schizophrenia: a pathway analysis of GWAS data. Schizophrenia Res 2010; 122: 38-42. 45. Kaneva R, Milanova V, Angelicheva D, MacGregor S, Kostov C, Vladimirova R et al. Bipolar disorder in the Bulgarian Gypsies: genetic heterogeneity in a young founder population. Am J Med Genet 2009; 150B: 191-201. 46. Kang C, Zhou L, Liu H, Yang J. Association study of the frizzled 3 gene with Chinese Va schizophrenia. Neurosci Lett 2011; 505: 196-199. 47. Karlsson R, Graae L, Lekman M, Wang D, Favis R, Axelsson T et al. MAGI1 copy number variation in bipolar affective disorder and schizophrenia. Biol Psychiat 2012; 71: 922-930. 48. Katsu, T, Ujike H, Nakano T, Tanaka Y, Nomura A, Nakata K et al. The human frizzled-3 (FZD3) gene on chromosome 8p21, a receptor gene for Wnt ligands, is associated with the susceptibility to schizophrenia. Neurosci Lett 2003; 353: 53-56. 49. Kazuno A-a, Ohtawa K, Otsuki K, Usui M, Sugawara H, Okazaki Y et al. Proteomic analaysis of lymphoblastoid cells derived from twins discordant for bipolar disorder: a preliminary study. PLoS One 2013; 8: e53855 50. Kim HJ, Eom CY, Kwon J, Joo J, Lee S, Nah SS et al. Roles of interferon-gamma and its target genes in schizophrenia: proteomics-based reverse genetics from mouse to human. Proteomics 2012; 12: 1815-1829. 51. Koga M, Ishiguro H, Yazaki S, Horiuchi Y, Arai M, Niizato K et al. Involvement of SMARCA2/BRM in the SWI/SNF chromatin-remodeling complex in schizophrenia. Hum Mol Genet 2009; 18: 24832494. 52. Kohli MA, Lucae S, Saemann PG, Schmidt MV, Demirkan A, Hek K et al. The neuronal transporter gene SLC6A15 confers risk to major depression. Neuron 2011; 70: 252-265. 53. Konradi C, Eaton M, MacDonald ML, Walsh J, Benes FM, Heckers S. Molecular evidence for mitochondrial dysfunction in bipolar disorder. Arch Gen Psychiatry 2004; 61: 300-308. 54. Kortum F, Das S, Flindt M, Morris-Rosendahl DJ, Stefanova I, Goldstein A et al. The core FOXG1 syndrome phenotype consists of postnatal microcephaly, severe mental retardation, absent language, dyskinesia and corpus callosum hypogenesis. J Med Genet 2011; 48: 396-406. 55. Lee PH, Perlis RH, Jung J-Y, Byrne EM, Rueckert E, Siburian R et al. Multi-locus genome-wide association analysis supports the role of glutamatergic synaptic transmission in the etiology of major depressive disorder. Transl Psychiatry 2012; 2: e184. 56. Lee Y-C, Durr A, Majczemko K, Huang Y-H, Liu Y-C, Lien C-C et al. Mutations in KCND3 cause spinocerebellar ataxia type 22. Ann Neurol 2012; 72: 859-869. 57. Le-Niculescu H, Balaraman Y, Patel S, Tan J, Sidhu K, Jerome RE et al. Towards understanding the schizophrenia code: an expanded convergent functional genomics approach. AM J Med Genet B. Neuropsychiatr Genet 2007; 144B: 129-158. 58. Leuzzi V. Inborn errors of creatine metabolism and epilepsy: clinical features diagnosis, and treatment. J Child Neurol 2002; 17S3: 3S89-97. 59. Lionel AC, Crosbie J, Barbosa N, Goodale T, Thiruvahindrapuram B, Rickaby J et al. Rare copy number variation discovery and cross-disorder comparisons identify risk genes for ADHD. Sci Transl Med 2011; 3: 95ra75; doi: 10.1126/scitranslmed.3002464 60. Maestrini E, Pagnamenta AT, Lamab JA, Bacchelli E, Sykes NH, Sousa I et al. High-density SNP association study and copy number variation analysis of the AUTS1 and AUTS5 loci implicate the IMMP2L-DOCK4 gene region in autism susceptibility. Mol Psychiat 2010; 15: 954-968. 61. Makino C, Fujii Y, Kikuta R, Hirata N, Tani A, Shibata A et al. Positive association of the AMPA receptor subunit GluR4 gene (GRIA4) haplotype with schizophrenia: linkage disequilibrium mapping using SNPs evenly distributed across the gene region. Am J Med Genet B. Neuropsychiatric Genet 2003; 116B: 17-22. 62. Mathieu F, Miot S, Etain B, El Khoury MA, Chevalier F, et al. Association between the PPP3CC gene, coding for the calcineurin gamma catalytic subunit, and bipolar disorder. Behav Brain Funct 2008; 4:2. Doi: 10.1186/1744-9081-4-2. 63. McDonald ML, MacMulle C, Liu DJ, Leal SM, Davis RL. Genetic association of cyclic AMP signaling genes with bipolar disorder. Translational Psychiatry 2012; 2, e169. doi: 10.1038/tp.2012.92 64. McInnis LA, Lauriat TL. RNA metabolism and dysmyelination in schizophrenia. Neurosci Biobehav Rev 2006; 30: 551-561. 65. Melin M, Carlsson B, Anckarsater H, Rastam M, Betancur C, Isaksson A et al. Constitutional downregulation of SEMA5A expression in autism. Neuropsychobiol 2006; 54: 64-69. 66. Mistry M, Gillis J, Pavlidis P. Genome-wide expression profiling of schizophrenia using a large combined cohort. Mol Psychiat 2013; 18: 215-225. 67. Moldrich RX, Dauphinot L, Laffaire J, Vitalis T, Herault Y, Beart PM et al. Proliferation deficits and gene expression dysregulation in Down’s syndrome (Ts1Cje) neural progenitor cells cultured from neurospheres. J Neurosci Res 2009; 87: 3143-3152. 68. Moon HJ, Yim S-V, Lee WK, Jeon Y-W, Kim YH, Ko YJ et al. Identification of DNA copy-number aberrations by array-comparative genomic hybridization in patients with schizophrenia. Biochem Biophys Res Comm 2006; 344: 531-539. 69. Morrow EM, Yoo SY, Flavell SW, Kim TK, Lin Y, Hill RS et al. Identifying autism loci and genes by tracing recent shared ancestry. Science 2008; 321: 218-223. 70. Narayan S, Tang B, Head SR, Gilmartin TJ, Sutcliffe JG, Dean B et al. Molecular profiles of schizophrenia in the CNS at different stages of illness. Brain Res 2008; 1239: 235-248. 71. Nava C, Keren B, Mignot C, Rastetter A, Chantot-Bastaraud S, Faudet A et al. Prospective diagnostic analysis of copy number variants using SNP microarrays in individuals with autism spectrum disorders. Eur J Hum Genet online pub 1 May 2013; doi: 10.1038/3jhg.2013.88 72. Novak G, Seeman P, Tallerico T. Increased expression of calcium/calmodulin-dependent protein kinase II beta in frontal cortex in schizophrenia and depression. Synapse 2006; 59: 61-81. 73. O'Roak BJ, Vives L, Girirajan S, Karakoc E, Krumm N, Coe BP et al. Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations. Nature 2012; 485: 246-250. 74. Pedroso I, Lourdusamy A, Rietschel M, Nothen MM, Cichon S, McGuffin P et al. Common genetic variaants and gene-expression changes associated with bipolar disorder are over-represented in brain signaling pathways. Biol Psychiat 2011; 72: 311-317. 75. Picard BS, Millar JK, Porteous DJ, Muir WJ, Blackwood DHR. Cytogenetics and gene discovery in psychiatric disorders. Pharmacogenomics J 2005; 5: 81-88. 76. Piton A, Gauthier J, Hamdan FF, Lafreniere RG, Yang Y, Henrion E et al. Systematic resequencing of X-chromosome synaptic genes in autism spectrum disorder and schizophrenia. Mol Psychiat 2011; 16: 867-880. 77. Pongrac JL, Middleton FA, Peng L, Lewis DA, Levitt P, Mirnics K. Heat shock protein 12A shows reduced expression in the prefrontal cortex of subjects with schizophrenia. Biol Psychiat 2004; 56: 943-950. 78. Prabakaran S, Swatton JE, Ryan MM, Huffaker SJ, Huang JT, Griffin JL et al. Mitochondrial dysfunction in schizophrenia: evidence for compromised brain metabolism and oxidative stress. Mol Psychiatry 2004; 9: 684-697. 79. Pulver AE, Lasseter VK, Kasch L, Wolyniec P, Nestadt G, Blouin JL et al. Schizophrenia: a genome scan targets chromosomes 3p and 8p as potential sites of susceptibility genes. Am J Med Genet 1995; 60: 252-260. 80. Qu M, Yue W, Tang F, Wang L, Han Y, Zhang D. Polymorphisms of transferrin gene are associated with schizophrenia in Chinese Han population. J Psychiatr Res 2008; 42: 877-883. 81. Redies C, Hertel N, Hubner CA. Cadherins and neuropsychiatric disorders. Brain Res 2012; 1470: 130-144. 82. Reif A, Nguyen TT, Weissflog L, Jacob CP, Romanos M, Renner TTJ et al. DIRAS2 is associated with adult ADHD, related traits, and co-morbid disorders. Neuropsychopharm 2011; 36: 2318-2327. 83. Rosenfield JA, Ballif BC, Lucas A, Spence EJ, Powell C, Aylsworth AS et al. Small deletions of SATB2 cause some of the clinical features of the 2q33.1 microdeletion syndrome. PLoS One 2009; 4: 36568. 84. Rothermel B, Vega RB, Yang J, Wu H, Bassel-Duby R, Williams RS. A protein encoded within the Down syndrome critical region is enriched in striated muscles and inhibits calcineurin signaling. J Biol Chem 2000; 275: 8719-8725. 85. Ryan MM, Lockstone HE, Huffacker SJ, Wayland MT, Webster MJ, Bahn S. Gene expression analysis of bipolar disorder reveals downregulation of the ubiquitin cycle and alterations in synaptic genes. Mol Psychiatry 2006; 11: 965-978. 86. Salyakina D, Ma DQ, Jaworski JM, Konidari I, Whitehead PL, Henson R et al. Variants in several genomic regions associated with Asperger disorder. Autism Res 2010; 3: 303-310. 87. Sando R 3rd, Gounko N, Pieraut SS, Liao L, Yates J 3rd, Maximov A. HDAC4 governs a transcriptional program essential for synaptic plasticity and memory. Cell 2012; 151: 821-834. 88. Sato T, Nishio H, Iwata M, Tamura A, Miyazaki T, Suzuki K. Postmortem molecular screening for mutations in ryanodine receptor type 1 (RYR1) gene in psychiatric patients suspected of having died of neuroleptic malignant syndrome. Forensic Sci Int 2010; 194: 77-79. 89. Schmitt A, Leonardi-Essmann F, Durrenberger PF, Wichert SP, Spanagel R, Arzberger T et al. Structural synaptic elements are differentially regulated in superior temporal cortex of schizophrenia patients. Eur Archiv Psychiat Clin Neurosci 2012; 262: 565-577. 90. Shelton RC, Hal Manier D, Lewis DA. Protein kinases A and C in post-mortem prefrontal cortex from persons with major depression and controls. Int J Neuropsychopharmacol 2009; 12: 1223-1232. 91. Silberberg G, Ben-Shachar D, Navon R. Genetic analysis of nitric oxide synthase 1 variants in schizophrenia and bipolar disorder. Am J Med Genet B Neuropsychiatr Genet 2010; 153B: 1318-1328. 92. Sklar P, Smoller JW, Fan J, Ferreira MA, Perlis RH, Chambert K et al. Whole genome association study of bipolar disorder. Mol Psychiat 2008; 13: 558-569. 93. Sokolowski M, Wasserman J, Wasserman D. Association of polymorphisms in the SLIT2 axonal guidance gene with anger in suicide attempters. Mol Psychiat 2010; 15: 10-11. 94. Sprooten E, Fleming KM, Thomson PA, Bastin ME, Whalley HC, Hall J et al. White matter integrity as an intermediate phenotype: Exploratory genome-wide association analysis in individuals at high risk of bipolar disorder. Psychiatry Res 2013; 206: 223-231. 95. Srinivasan K, Leone DP, Bateson RK, Dobreva G, Kohwi Y, Kohwi-Shigematsu T et al. A network of genetic repression and derepression specifies projection fates in the developing neocortex. Proc Natl Acad Sci USA 2012; 109: 19071-19078. 96. Strippoli P, Lenzi L, Petrini M, Carinci P, Zannotti M. A new gene family including DSCR1 (Down Syndrome Candidate Region 1) and Zaki-4: characterization from yeast to human and identification of DSCR1-like 2; a novel human member (DSCR1L2). Genomics 2000; 64: 252-263. 97. Tabares-Seisdedos R, Rubenstein JL. Chromosome 8p as a potential hub for developmental neuropsychiatric disorders: implications for schizophrenia, autism and cancer. Mol Psychiat 2009; 14: 463-589. 98. Tang B, Capitao C, Dean B, Thomas EA. Differential age- and disease-related effects on the expression of genes related to the arachidonic acid signaling pathway in schizophrenia. Psychiatry Res 2012; 196: 201-206. 99. Tao R, Li C, Newburn EN, Ye T, Lipska BK, Herman MM, Weinberger DR, Kleinman JE, Hyde TM. 2012. Transcript-specific associations of SLC12A5 (KCC2) in human prefrontal cortex with development, schizophrenia and affective disorders. J Neurosci 32: 5216-5222. 100. Tietjen I, Bodell A, Apse K, Mendonza AM, Chang BS, Shaw GM et al. Comrehensive EMX2 genotypinc of a large schizencephaly case series. Am J Med Genet A 2007; 143A: 1313-1316. 101. Tischfield MA, Engle EC. Distinct alpha- and beta-tubulin isotypes are required for the positioning, differentiation and survival of neurons; new support for the ‘multi-tubulin’ hypothesis. Biosci Rep 2010; 30: 319-330. 102. Tomppo L, Ekelund J, Lichtermann D, Veijola J, Jarvelin M-R, Hennah W. DISC1 Conditioned GWAS for psychosis proneness in a large Finnish cohort. PLos ONE 2012; 7: e30643. 103. Tsai NP, Wilkerson JR, Guo W, Maksimova MA, Demartino GN, Cowan CW et al. Multiple autism-linked genes mediate synapse elimination via proteasomal degradation of a synaptic scaffold PSD-95. Cell 2012; 151: 1581-1594. 104. Van Houdt JK, Nowakowska BA, Sousa SB, van Schaik BD, Seuntjens E, Avonce N et al. Heterozygous missense mutations in SMARCA2 cause Nicolaides-Baraitser syndrome. Nat Genet 2012; 44: 445-449. 105. Vauthier V, Jaillard S, Journel H, Dubourg C, Jockers R, Dam J. Homozygous deletion of an 80kb region comprising part of DNAJC6 and LEPR genes on chromosome 1P31.3 is associated with early onset obesity, mental retardation and epilepsy. Mol Genet Metab 2012; 106: 345-350. 106. Vogel P, Read RW, Hansen GM, Payne BJ, Small D, Sands AT et al. Congenital hydrocephalus in genetically engineered mice. Vet Pathol 2012; 49: 166-181. 107. Watanuki T, Funato H, Uchida S, Matsubara T, Kobayashi A et al. Increased expression of splicing factor SRp20 mRNA in bipolar disorder patients. J Affect Disord. 2008; 110: 62-69. 108. Wei YL, Li CX, Li SB, Liu Y, Hu L. Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese. Behav Brain Funct 2011; 7: 42. 109. Weissflog L, Scholz CJ, Jacob CP, Nguyen TT, Zamzow K, Gross-Lesch S et al. KCNIP4 as a candidate gene for personality disorders and adult ADHD. Eur Neuropsychopharm 2012; doi: 10.1016/j.euroneuro.2012.07.017 110. Wigg KG, Feng Y, Crosbie J, Tannock R, Kennedy JL, Ickowicz A et al. Association of ADHD and the protogenin gene in the chromosome 15q21.3 reading disabilities linkage region. Genes Brain Behav 2008; 7: 877-886. 111. Wong ML, Dong C, Maestre-Mesa J, Licinio J. Polymorphisms in inflammation-related genes are associated with susceptibility to major depression and antidepressant response. Mol Psychiat 2008; 13: 800-812. 112. Wong ML, Whelan F, Deloukas P, Whittaker P, Delgado M, Cantor RM et al. Phosphodiesterase genes are associated with susceptibility to major depression and antidepressant treatment response. Proc Natl Acad Sci 2006; 103: 15124-15129. 113. Yamada K, Iwayama Y, Toyota T, Ohnishi T, Ohba H, Maaekawa M et al. Association study of the KCNJ3 gene as a susceptibility candidate for schizophrenia in the Chinese population. Hum Genet 2012; 131: 443-451. 114. Ylisaukko-oja T, Rehnstrom K, Auranen M, Vanhala R, Alen R, Kempas E et al. Analysis of four neuroligin genes as candidates for autism. Eur J Hum Genet 2005; 13: 1285-1292. 115. Zai CC, Tiwari AK, King N, De Luca V, Mueller DJ, Shaikh S et al. Association study of the gamma-aminobutyric acid type a receptor gamma2 subunit gene with schizophrenia. Schizophr Res 2009; 114: 33-38.
Related documents