Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Name Date Period Transcription and Translation Part A: 1. Below is a portion of a gene on a DNA molecule. TACCCTTGCATACGTCTGACATAAAAAAGG Write out the DNA chain that would bond to the above chain. 2. Write out the base sequence for the mRNA that would be formed from the transcription of the original DNA molecule 3. Circle the codons in the mRNA chain above. 4. Write the amino acid sequence of the protein formed from translation of the mRNA. (use Figure 1) _ Part B 1. Using Figure 1, complete the Data Table for each protein molecule Protein Amino Acid DNA Triplet mRNA Codon tRNA anticodon CTA 1 AAG UCC Proline 2 Alanine GGA Methionine 3 GGC AUA 2. In what ways do DNA and RNA nucleotides differ? 3. Explain how mRNA is formed. 4. What is the role of tRNA in translation? Name 5. How do ribosomes assist in the production of proteins? Date Period 6. What is a codon and an anticodon? 7. What is the start codon? 8. What is the difference between an intron and an exon? 9.How is DNA Replication similar to Transcription? mRNA Codon A G U C Lysine Arginine Isoleucine Threonine A Lysine Arginine Methionine Threonine G Asparagine Serine Isoleucine Threonine U Asparagine Serine Isoleucine Threonine C Glutamic acid Glycine Valine Alanine A Glutamic acid Glycine Valine Alanine G Aspartic acid Glycine Valine Alanine U Aspartic acid Glycine Valine Alanine C “Stop” codon “Stop” codon Leucine Serine A “Stop” codon Trytophan Leucine Serine G Tyrosine Cysteine Phenylalanine Serine U Tyrosine Cysteine Phenylalanine Serine C Glutamine Arginine Leucine Proline A Glutamine Arginine Leucine Proline G Histidine Arginine Leucine Proline U Histidine Arginine Leucine Proline C A G U C Second Base in Code Word Third Base in Code Word First Base in Code Word Figure 1