Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
pSABAD92A pSKDuet12 was constructed by inversion PCR of pSKDuet1A [1] using oligonucleotides #SK165 (CACCGTAACGGAGACAAAATGTCTAAGCTATG) and #SK160 (TGTCTCCGTTACGGTGTAGGTTTTGG) and carries a fusion protein with an N-terminal His-Tag, the, B1-domain of G-protein (GB1) and the N-terminal fragment (IntN) of the native split NpuDnaE intein[2]. The primers #DuetMCS-fw (GGATCTCGACGCTCTCCCT) and #HK010 (CGCATCTCGAGTTCGGCAAATTATCAAC) were used to amplify part of pSKDuet12 with PCR. The PCR product was then ligated into pCDFDuet-1 (plasmid 15917 from Addgene) using the NcoI and XhoI sites resulting in pTMCDF01. An His-Tag was inserted by ligating the oligonucleotide #SZ008 (TCGACTCATCATCATCATCATCATTAA) and #SZ009 (TCGACTTAATGATGATGATGATGATGA) into pTMCDF01 using newly created XhoI site to result in plasmid pTMCDF02. Furthermore, an EcoRI site and an EF-linker (Glu-Phe) was created by inversion PCR using oligonucleotides #HK038 (GATAATTTGCCGAACGAATTCCATCATCATCATC) and #HK039 (GATGATGATGATGGAATTCGTT) to end up into pHKCDF22-3. Finally the primers #SK012 (TCCTTACATATGCAGTACAAACTTATC) and #HK122 (CTAAAGCTTAATGATGATGATGATGATG) were used to amplify a part of pHKCDF22-3 and the PCR product was ligated between the NdeI and HindIII sites of pSKBAD2A [1] (plasmid 15335 from Addgene) vector to yield pMHBAD10. To gain the fusion-protein IntC- B1-domain of G-protein (GB1)-His-Tag, a part of pSKBAD2A was amplified with oligonucleotides #SK094 (TAACATATGATCAAAATAGCCACACG) and #HK158 (AGAATTCCGTTACGGTGTAGGTTTTG), and ligated into pMHBAD10 between the NdeI and EcoRI sites resulting in pMHBAD14. Then GB1 was replaced by the R-module of AlgE4. To obtain the R-module template, pSKDuet1A was digested with NcoI and HindIII and ligated into pRSF-1b (Novagen) resulting in pHYRSF1. pSABAD28 was constructed by PCR using pSKBAD2A as a template and using oligonucleotides #SK094 (TAACATATGATCAAAATAGCCACACG), #HK036 (CCGCGGGCGTTCGTGCAATTAGAAGCTATGAAGCC), and #HK037 (CAGGTACCGCCAGCCCCGCGGGCGTTCGTGC) and ligating the product into pSKBAD2A between the NdeI and KpnI sites. pSABAD28 was digested with NdeI and HindIII and the digestion product was ligated into pHYRSF1 obtaining pSARSF1-28. pSARSF1-66 was constructed by inversion PCR of pSARSF1-28 using oligonucleotides #HK152 (GACGCTGCTACCGCCGAAAAAGTTTTCAAAC) and #HK153 (GTTTGAAAACTTTTTCGGCGGTAGCAGCGTC). Finally pSARSF1-LICI-1 was constructed by ligation independent cloning (LIC) by amplifying the part of pFA1 [3], that contains the gene of the R-module of AlgE4, with oligonucleotides #HK137 (GCACGAACGCCCAAGGAAGCGACGGCGAGCCAC) and #HK138 (ACCGCCAGCCCCTTAGACGATCGCCCCGGCCTG) and inserting the ligation product into pSARSF1-66 using the SacII site. The gene of the R-module of AlgE4 was amplified from pEBBAD30A with oligonucleotides #HK057 (AAGGTACCGGAAGCGACGGCGAGCCAC) and#HK197 (GTCTTCGCCGCGACCGAATTCA) and inserted it into pMHBAD14 between the KpnI and EcoRI sites. pEBBAD30A was obtained by ligating the product from NcoI and HindIII digestion of pSARSF1LICI-1f into pSKBAD2A. The resulting plasmid pSABAD92 encodes a fusion protein consisting of the C-terminal 36 residues (IntC) of the NpuDnaE intein from Nostoc punctiforme,the AlgE4 R-module and the C-terminal His-Tag with an EF linker (GluPhe). pEBDuet23A The DNA fragment encoding the A-module (residues 1-379) of AlgE4 was amplified from pBS32 by the two oligonucleotides # HK54 (CCTACCTGAAAAGTTTCGAGGCGGATGC) and #HK141 (CCGGCGAACCCGGCGCGACAA) and cloned into pSKDuet12 using the NcoI and AhdI sites, resulting in the plasmid pEBDuet23A. pBS32 is a derivative of pTYB4 (NEB) in which a 1.65 kb NcoI-XmaI DNA fragment corresponding to the full-length AlgE4 from pHH4 [4] was subcloned. pEBDuet28A: pTMDuet03 was constructed by cloning the N-terminal domain of the ClpX zinc finger from the chromosomal DNA of E. coli DH5α using oligonucleotides #HK001 (TAGACCATGGCAGATAAACGCAAAGATG) and #HK002 (TTTCACGATGCGGTGCAAC), ligating the PCR product into pSKDuet12 using the NcoI and AhdI sites. The N-terminal His-Tag and TEV-digestion site was created by inversion PCR using oligonucleotides #HK014 (CATGCGGGGTTCTCATCATCATCATCATCATGAGAATTTGTATTTTCAGTCCATG) and #HK015 (ATGGACTGAAAATACAAATTCTCATGATGATGATGATGATGAGAACCCCG). pEBDuet23A was digested with HindIII and NcoI. The gene encoding the N-terminal precursor A-IntN was inserted into pTMDuet03 to yield pEBDuet28A. Figure S1: A) The plasmid pSABAD92A encodes a fusion protein consisting of the C-terminal 36 residues (IntC) of the DnaE intein from Nostoc punctiforme and the AlgE4 R-module (residue 385533) of Azotobacter vinelandii. The last 20 residues of the wild type R-module were exchanged to a C-terminal His-tag for purification. The construct pSABAD92A has a ColE1 origin for replication, the arabinose promoter and has also the ampilicin resistance gene (ampR) B) The plasmid pEBDuet23A encodes a fusion protein consisting of the A-module (residues 1379) of the alginate epimerase AlgE4 and the N-terminal part (IntN) of the NpuDnaE intein . The vector has also the kanamycin resistance gene (kanR), RSF origin and the expression of the fusion gene is tightly controlled by T7/lac promoter. C) pEBDuet28A has also the kanamycin resistance gene (kanR), RSF origin and the T7/lac promoter. A fusion protein consisting of a N-terminal His-Tag, the A-module of AlgE4 and the N-terminal part (IntN) of the NpuDnaE intein. References 1. Iwaï H, Züger S, Jin J, Tam PH (2006) Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Lett 580: 1853-1858. 2. Caspi J, Amitai G, Belenkiy O, Pietrokovski S (2003) Distribution of split DnaE inteins in cyanobacteria. Mol Microbiol 50: 1569-1577. 3. Aachmann FL, Svanem BG, Valla S, Petersen SB, Wimmer R (2005) NMR assignment of the R-module from the Azotobacter vinelandii Mannuronan C5-epimerase AlgE4. J Biomol NMR 31: 259. 4. Ertesvåg H, Høidal HK, Hals IK, Rian A, Doseth B, et al. (1995) A family of modular type mannuronan C-5-epimerase genes controls alginate structure in Azotobacter vinelandii. Mol Microbiol 16: 719-731.