Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Supplementary Table 1. Primers used for miRNA cloning.1,2 miRNA Forward (Xho-1 RS) Reverse (EcoR1 RS) Size (bp) miR-17-92 miR-34a miR-150 miR-342 miR-680-1 CATGCTCGAGTGACAGAATTTAGAGCTTTGG CATGCTCGAGTGCTAGCGTGCTGGCTTCC CATGCTCGAGCTGCTCGCTTTGATGCAGG CATGCTCGAGTCTTCCATTGTATTGTGCACC CATGCTCGAGTTTAAAATTATTATGACAGAGGAG CATGGAATTCACGAAAGCAATAGAAATCACAG CATGGAATTCGTGCTAACACCAGCCTCCC CATGGAATTCATGGATGTTGGAGTGATGGG CATGGAATTCTGCATCCACAGCTCCTTCC CATGGAATTCGAGATACATTAAATATTTGTGGG 1087 363 369 340 6003 1 miRNA genes were amplified from C57BL/6 male DNA mice and cloned into the retroviral vectors MDH1PGK-GFP 2.0 or MXW-PGK-IRES-GFP as described previously (Mao et al. Methods Enzymol. 2007). In bold are the Xho-1 and EcoR1 restriction sites and in italics are the miRNA gene specific sequences. 2 primer sequences for miR-181a1b1 will be published in a separate publication (manuscript in preparation) Within the amplicon an internal EcoR1 site 58 bp 3’ of the pre-miR-680-1 is present; therefore the final cloned product is 191 bp shorter (409 bp) than the original amplicon. 3 Supplementary Figure 1. FACS plots of apoptosis analysis of stimulated WEHI-231 cells. Cells were stimulated for 24h in duplo (top = experiment 1 and bottom = experiment 2) with 0.1 μg/ml anti-IgM, 0.1 μg/ml anti-IgM and 0.5 μg/ml anti-CD40, 0.5 μg/ml anti-CD40 or left unstimulated. After FACS analysis, debris was gated out based on the FSC x SSC plot. Gates were set on live (Annexin V-PI-), apoptotic (Annexin V+PI-) and necrotic (AnnexinV+PI+) cells. Apoptosis levels as shown in Figure 1a were calculated by dividing the percentage apoptotic cells over the percentage of PI- cells (= live and apoptotic cells). Supplementary Figure 2. Robustness of the GFP competition assay. To confirm the results obtained with the GFP competition assay the assay was repeated once or twice specifically for the miRNAs that show effects on cell growth and the EV control. For the repeats WEHI-231 cells were independently infected with freshly prepared retrovirus. A) Individual repeats of the GFP competition assay for miR-34a, miR-150, miR-18a1b1 and the empty vector (EV) control. B) Shown is the average result of the 2 or 3 independent competition assays as shown in (A). Supplementary Figure 3. FACS plots of anti-IgM stimulated miRNA infected WEHI-231 cells as shown in Figure 2c. WEHI-231 cells were freshly infected with the indicated miRNAs or empty vector (EV) control. Unsorted cells were then stimulated with 0.1 μg/ml anti-IgM antibodies for 24h after which the GFP percentage was determined in stimulated and unstimulated cell cultures. Each stimulation was performed in triplicate within an experiment and all stimulation experiments were repeated twice in separate experiments with independently infected WEHI-231 cells. Shown are the triplicate FACS plots of unstimulated and anti-IgM stimulated WEHI-231 cells of a representative experiment. WEHI-231 cells overexpressing miR-17~92, miR-181a1b1 and miR-150 show lowered GFP percentages upon anti-IgM stimulation in comparison to unstimulated cells. No differences are observed for the EV control or three other overexpressed miRNAs.