Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genomics Medicine: Bioinformatics Short Course, Stanford June 23, 2003
Document related concepts
no text concepts found
Transcript
Genomics & Medicine Doug Brutlag Department of Biochemistry & BioMedical Informatics (by courtesy) Leveraging Genomic Information Novel Diagnostics Microchips & Microarrays - DNA Gene Expression - RNA Proteomics - Protein Novel Therapeutics Drug Target Discovery Rational Drug Design Molecular Docking Gene Therapy Understanding Metabolism Understanding Disease Inherited Diseases - OMIM Infectious Diseases Pathogenic Bacteria Viruses Genomics, Bioinformatics & Computational Biology Genomics Bioinformatics Structural Genomics Computational Molecular Biology Computational Biology Central Paradigm of Molecular Biology DNA RNA Protein Phenotype (Symptoms) Central Paradigm of Medicine DNA RNA Protein Phenotype (Symptoms) Opinions Central Paradigm of Bioinformatics Genetic Information TGCTTTAGCTTT AAACTACAGGCC TCACTGGAGCTA GAGACAAGAAGG TAAAAAACGGCT GACAAAAGAAGT CCTGGTATCCTC TATGATGGGAGA AGGAAACTAGCT AAAGGGAAGAAT AAATTAGAGAAA AACTGGAATGAC GCTTATACCTGG Molecular Structure Biochemical Function Phenotype (Symptoms) Central Paradigm of Bioinformatics Genetic Information TGCTTTAGCTTT AAACTACAGGCC TCACTGGAGCTA GAGACAAGAAGG TAAAAAACGGCT GACAAAAGAAGT CCTGGTATCCTC TATGATGGGAGA AGGAAACTAGCT AAAGGGAAGAAT AAATTAGAGAAA AACTGGAATGAC GCTTATACCTGG Molecular Structure Biochemical Function Phenotype (Symptoms) National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/ NCBI Genes & Disease http://www.ncbi.nlm.nih.gov/disease/ NCBI Human Genome http://www.ncbi.nlm.nih.gov/genome/guide/human/ NCBI Genes & Diseases http://www.ncbi.nlm.nih.gov/disease/ NCBI: Online Mendelian Inheritance in Man http://www.ncbi.nlm.nih.gov/omim/ NCBI: Online Mendelian Inheritance in Man http://www.ncbi.nlm.nih.gov/omim/ Central Paradigm of Molecular Biology DNA RNA Protein • Molecules –Structure –Function • Processes –Mechanism –Specificity –Regulation Symptoms (Phenotype) Genomics, Bioinformatics & Medicine Genomics Molecular Diagnostics Bioinformatics Identify Drug Targets Rational Drug Design Molecular Epidemiology Genetic Therapy Central Paradigm of Molecular Biology DNA RNA Protein Symptoms (Phenotype) DNA Chips & Microarrays Accelerate Genetic Analysis • Parallel Analyses – Analyze entire genomes instead of single genes – Analyze gene expression – Analyze genetic polymorphisms • Miniaturization • Automation Diagnosis Using DNA Arrays Affymetrix Arrays Light Directed Oligonucleotide Synthesis Automated DNA Chip Synthesis Photolithography Masks Hybridization & Detection Cystic Fibrosis Array Diagnosis of Cystic Fibrosis Affymetrix M. tuberculosis Chip (courtesy Tom Gingeras, VP Biology) M. tuberculosis (H37Rv) Array M. tuberculosis Interrogates 4706 genome loci (H37Rv) - 3983 ORFs 4,411,529 bp S.T. Cole, etal (1998) Nature 393 : 537 Single Nucleotide Polymorphisms (SNPs) GCTGTATGACTAGAAGATCGAT GCTGTATGACGAGAAGATCGAT • Individual’s genomes differ from each other by 0.1% • There are 3 million polymorphic sites in the human genome • SNPs an be used for identification • SNPs can be used for diagnosis Single Nucleotide Polymorphisms (SNPs) • Most SNPs are genetically neutral – – – – Used in DNA fingerprints Forensic medicine Paternity Immigration in the United Kingdom • Some SNPs reflect distinguishing characteristics – Often the basis for discrimination or other stigma • Some SNPs cause disease (very rare) • Some SNPs predispose to disease • SNPs can serve as genetic markers for other traits – Clinical trials associate SNPs with drug efficacy – Clinical trials associate SNPs adverse drug reactions Using SNPs to Diagnose Disease Adverse Drug Reactions: Fourth Major Cause of Death in US 1. Heart Disease 734,000 2. Cancer 536,000 3. Stroke 154,000 4. Adverse Drug Reactions 106,000 (1994) Adverse Drug Reactions Estimated Number of Hospital Patients with Adverse Drug Reactions (ADRs) in 1994 • 4,986,000 ADRs of all severities • 2,216,000 serious ADRs • 106,000 fatal ADRs Lazarou J, et al JAMA 1998, 279: 1200-1205 Getting the right medicine to the right patient Patients who respond without a serious side effect Patients who respond but experienced a serious side effect SNP A T TG C A T G C C A G T A G G Profile T A TG A T T G C C G C T A G G Diagnostic Right Medicine Right Patient 010901 Haplotype Map 200 kb Sense genes DNA Antisense genes SNPs Haplotype blocks 1 2 3 4 PharmGKB Database http://www.pharmgkb.org/ Microarrayer in Pat Brown’s Lab http://cmgm.stanford.edu/pbrown/ High Precision DNA Printing Mechanical Spotting Microarrays DNA Microarray cDNA Labeling Microarray: 25,000 Elements Acute Promyelocytic Leukemia Tumor cDNA +Retinoic Acid 24 hrs (Doug Ross & Pat Brown) Breast Cancers Classified by 451 Gene Expression Assays Sorlie et al. 2001 Breast Cancers Classified by 451 Gene Expression Assays Sorlie et al. 2001 Swiss-2D PAGE Proteome Database http://www.expasy.ch/ch2d/ Diagnostics Using Proteomics http://www.expasy.ch/ch2d/ Prof. Denis Hochstrasser Renal Cell Carcinoma (Sarto C. et al, Electrophoresis 1997, 18, 599-604) Normal RCC Normal RCC Public Human Genome Project Strategy http://www.nhgri.nih.gov/ Total Genome Sequence Information Public Genome Assembly Process Celera Sequencing http://www.celera.com/ Celera Scaffolds Celera Assembler Genome Analyses uniSTS A Mapping B Gene Prediction GrailEXP GenScan refSNP FGENESH FGENESH+ DT Human Gene Index UniGene Human RefSeq Human DT Mouse Gene Index UniGene Mouse RefSeq Mouse C Gene Expression D Protein Motifs & Similarity E Gene Expression Motifs nrPRO Motifs TFBS & Promoters Ensembl cDNA Alternative Splicing Generates Distinct Proteins in Different Tissues Promoter Exon Intron Exon Intron Exon Terminator Gene Transcript Splicing 3’ 5’ Alternate Splicing 5’ mRNA-1 Transcript 3’ mRNA-2 Genome Loci Inclusive Exon Prediction NR-Pro UniGene Gene Index GrailEXP FGENESH Genscan DT Locus Metabolic Networks Yeast Metabolic Network Gene Expression Networks Regulatory Neworks Protein-Protein Interaction Networks Signal Transduction Networks NCBI Human Genome Database http://www.ncbi.nlm.nih.gov/genome/guide/human/ Online Mendelian Inheritance in Man http://www.ncbi.nlm.nih.gov/omim/ Ensembl Human Database http://www.ensembl.org/ UCSC Human Genome Database http://genome.cse.ucsc.edu/ TIGR Microbial Database http://www.tigr.org/tdb/mdb/mdbcomplete.html Stanford Microarray Database http://smd.stanford.edu/
Related documents