Download Plant Physiology and Biochemistry

Plant Physiology and Biochemistry 85 (2014) 31e40
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry
journal homepage: www.elsevier.com/locate/plaphy
Research article
Overexpression of codA gene confers enhanced tolerance to abiotic
stresses in alfalfa
Hongbing Li a, b, 1, Zhi Wang a, c, 1, Qingbo Ke a, d, Chang Yoon Ji a, d, Jae Cheol Jeong a,
Haeng-Soon Lee a, d, Yong Pyo Lim c, Bingcheng Xu b, Xi-Ping Deng b, Sang-Soo Kwak a, d, *
a
Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon 305-806, Republic of Korea
State Key Laboratory of Soil Erosion and Dryland Farming on the Loess Plateau, Institute of Soil and Water Conservation, Chinese Academy of Science and
Ministry of Water Resources, Northwest A & F University, Yangling 712100, Shaanxi, PR China
c
Department of Horticulture, Chunnam National University, Daejeon, Republic of Korea
d
Department of Green Chemistry and Environmental Biotechnology, Korea University of Science & Technology, Daejeon, Republic of Korea
b
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 5 September 2014
Accepted 16 October 2014
Available online 18 October 2014
We generated transgenic alfalfa plants (Medicago sativa L. cv. Xinjiang Daye) expressing a bacterial codA
gene in chloroplasts under the control of the SWPA2 promoter (referred to as SC plants) and evaluated
the plants under various abiotic stress conditions. Three transgenic plants (SC7, SC8, and SC9) were
selected for further characterization based on the strong expression levels of codA in response to methyl
viologen (MV)-mediated oxidative stress. SC plants showed enhanced tolerance to NaCl and drought
stress on the whole plant level due to induced expression of codA. When plants were subjected to
250 mM NaCl treatment for 2 weeks, SC7 and SC8 plants maintained higher chlorophyll contents and
lower malondialdehyde levels than non-transgenic (NT) plants. Under drought stress conditions, all SC
plants showed enhanced tolerance to drought stress through maintaining high relative water contents
and increased levels of glycinebetaine and proline compared to NT plants. Under normal conditions, SC
plants exhibited increased growth due to increased expression of auxin-related IAA genes compared to
NT plants. These results suggest that the SC plants generated in this study will be useful for enhanced
biomass production on global marginal lands, such as high salinity and arid lands, yielding a sustainable
agricultural product.
© 2014 Elsevier Masson SAS. All rights reserved.
Keywords:
codA
Glycinebetaine
Alfalfa
SWAP2 promoter
Salt stress
Drought stress
Oxidative stress
Biomass
1. Introduction
Environmental stress, including drought and high salinity, is one
of the most important agricultural problems affecting plant growth
and crop yield. It is estimated that arid and semi-arid regions account for approximately 30% of the total worldwide area and that
nearly half of all irrigated lands are salt-affected (Sivakumar et al.,
2005; Mali et al., 2012). As the world population is increasing
fastly and is expected to reach 9 billion by 2050 (Varshney et al.,
Abbreviations: codA, choline oxidase; GB, glycinebetaine; SWPA2, sweet potato
peroxidase; IAA, indole acetic acid; MS, Murashige and Skoog; MV, methyl viologen; TP, transit peptide; T-nos, nos terminator; NT, non-transgenic; MDA,
malondialdehyde; PCR, polymerase chain reaction; q-RT-PCR, quantitative realtime PCR; ROS, reactive oxygen species; RWC, relative water content; TBA, thiobarbituric acid; TCA, trichloroacetic acid.
* Corresponding author. Plant Systems Engineering Research Center, 125
Gwahak-ro, Yuseong-gu, Daejeon 305-806, Republic of Korea.
E-mail address: [email protected] (S.-S. Kwak).
1
These authors contributed to the work equally.
http://dx.doi.org/10.1016/j.plaphy.2014.10.010
0981-9428/© 2014 Elsevier Masson SAS. All rights reserved.
2011), the amount of available agricultural land is shrinking due
to urbanization, industrialization, desertification, climatic change,
and/or habitat use. Thus, there is a need to utilize salt- and droughtaffected land to meet world food and energy requirements
(Reguera et al., 2012).
Plants have evolved built-in mechanisms to cope with different
types of abiotic and biotic stresses imposed by unfavorable environments (Vij and Tyagi, 2007; Kathuria et al., 2009). One of the
basic strategies adopted by most plants is the accumulation of low
molecular weight water-soluble compounds known as “compatible
solutes” (Yancey et al., 1982; Bohnert et al., 1995; Chen and Murata,
2002). In general, these compounds accumulate to high concentrations under water or salt stress and protect plants from stress
through different modes of action, including contributing to
cellular osmotic adjustment, detoxifying reactive oxygen species
(ROS), protecting membrane integrity, and stabilizing enzymes/
proteins (Yancey et al., 1982; Bohnert and Jensen, 1996).
Among compatible solutes, glycinebetaine (GB) is a particularly
effective protectant against abiotic stresses (Chen and Murata,
32
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
2008). GB is a quaternary amine that accumulates in a variety of
plants, animals, and microorganisms in response to abiotic stress
(Rhodes and Hanson, 1993; Chen and Murata, 2008). Levels of
accumulated GB are generally correlated with the extent of stress
tolerance (Rhodes and Hanson, 1993). GB effectively stabilizes the
quaternary structures of enzymes and complex proteins, and it
maintains the highly ordered state of membranes at nonphysiological temperatures and salt concentrations (Papageorgiou
and Murata, 1995). In photosynthetic systems, GB stabilizes the
oxygen-evolving photosystem II proteinepigment complex under
high NaCl concentrations (Murata et al., 1992; Papageorgiou and
Murata, 1995). GB can accumulate rapidly in GB-synthesizing
plants in response to environmental stresses, including salinity,
drought, and low temperature (Rhodes and Hanson, 1993). Exogenous application of GB improves the growth and survival rate of
plants under a variety of stress conditions (Park et al., 2004; Chen
and Murata, 2008). Studies of GB have focused on GB-mediated
tolerance to various types of stress and at various stages of the
plant lifecycle (Sulpice et al., 2003; Park et al., 2004).
Increasing evidence from a series of in vivo and in vitro studies of
the physiology, biochemistry, genetics, and molecular biology of
plants strongly suggests that GB performs an important function in
plants subjected to environmental stresses (Sakamoto and Murata,
2000, 2002). Therefore, pathways for enhanced production of GB
have been introduced into transgenic plants to impart stress
tolerance (Sakamoto and Murata, 2000; Chen and Murata, 2002,
2008, 2011). The most successful genetic engineering of GB
biosynthesis has been achieved by expressing choline oxidase in
plants, which is encoded by a soil bacterial (Arthrobacter globiformis) codA gene and can directly convert choline into GB and H2O2
(Ikuta et al., 1977; Deshnium et al., 1995). This gene has been
introduced into various plants, such as Arabidopsis (Hayashi et al.,
1997; Alia et al., 1998; Sulpice et al., 2003), Brassica (Prasad et al.,
2000), tomato (Park et al., 2004; Goel et al., 2011), rice (Mohanty
et al., 2002; Su et al., 2006; Kathuria et al., 2009), maize (Quan
et al., 2004), and potato (Ahmad et al., 2008, 2010). Most transgenic plants with the ability to synthesize GB show enhanced
tolerance to various types of environmental stress at all stages of
their lifecycle (Chen and Murata, 2008, 2011).
Alfalfa (Medicago sativa L.) is a perennial forage legume of great
agronomic importance worldwide, which provides abundant
forage for animals and can improve soil fertility. The deep root
system of alfalfa can help prevent soil and water loss in dry lands
(Osborn et al., 1997). As a perennial forage crop, alfalfa is a fairly
hardy species and has a relatively high level of drought and salt
tolerance compared with many food crops. Although alfalfa can be
grown under slightly saline-alkaline conditions and in semi-arid
areas, its productivity is significantly reduced under high salinity
and drought stress conditions. Developing alfalfa germplasm with
increased salt and drought tolerance would provide a long-term
solution to this problem. Genetic engineering has proven to be a
revolutionary technique for generating transgenic plants with
enhanced tolerance to various abiotic stresses, as one can transfer a
desired gene from any genetic resource and alter the expression of
existing gene(s). Since the first report of genetic transformation in
alfalfa (Deak et al., 1986), many transgenic alfalfa plants have been
obtained by gene transfer methods (Avraham et al., 2005; Zhang
n et al., 2009; Tang et al., 2013). However, there
et al., 2005; Ramo
are no reports on the improvement of stress tolerance in alfalfa by
expressing a bacterial codA gene, despite the fact that alfalfa is a GB
accumulating plant (Wood et al., 1991).
A robust expression system with an appropriate promoter is an
important prerequisite for efficient expression of foreign genes in
plant cells. We previously isolated an oxidative stress-inducible
sweet potato peroxidase (SWPA2) promoter from cell cultures of
sweet potato (Kim et al., 2003). The SWPA2 promoter exhibits
higher expression after various stress treatments than the 35S
promoter of the Cauliflower mosaic virus (CaMV 35S promoter) in
transgenic tobacco and potato plants (Kim et al., 2003; Tang et al.,
2006). In previous studies, we used the SWPA2 promoter to
generate various transgenic plants with enhanced tolerance to
various environmental stresses, including sweet potato, potato, tall
fescue, and poplar (Tang et al., 2006; Lee et al., 2007; Lim et al.,
2007; Kim et al., 2011).
In this study, we successfully targeted choline oxidase (codA)
cDNA derived from A. globiformis to alfalfa (cv. Xinjiang Daye)
chloroplasts under the control of the stress-inducible SWPA2 promoter. The overexpression of the codA transgene resulted in
enhanced tolerance to NaCl and drought stress on the whole plant
level. To the best of our knowledge, this is the first report regarding
the engineering of a GB biosynthesis pathway in alfalfa plants.
2. Materials and methods
2.1. Plant material and plant expression vector
The Xinjiang Daye cultivar of alfalfa (Medicago sativa L.), referred
to high stress resistance (Wang et al., 2009a, 2009b), was used for
the generation of transgenic alfalfa plants. Alfalfa seeds (cv. Xinjiang Daye) were provided by Prof. Bo Zhang from Xinjiang Agriculture University, China. The codA gene expression vector was
constructed according to a previous description (Ahmad et al.,
2008). The codA gene was kindly provided by Prof. Norio Murata,
National Institute for Basic Science, Japan. In brief, the plant
expression vector pGAH/codA containing the transit peptide (TP)
and the nos terminator (T-nos) under the control of the CaMV 35S
promoter (Hayashi et al., 1997) was constructed. The TP, codA, and
nos terminator fragments were excised from pGAH/codA and
ligated to the oxidative stress-inducible SWPA2 promoter (Kim
et al., 2003), after which the cassette was cloned into the HindIII
and EcoRI sites of the pCAMBIA2300 binary vector, with the NPTII
gene serving as a selectable marker. The resulting vector was
transformed into Agrobacterium tumefaciens (EHA105 strain) for
alfalfa transformation.
2.2. Plant transformation and regeneration
The alfalfa seeds were surface-sterilized with 0.5% sodium
hypochloride solution for 5 min, thoroughly rinsed 7e8 times with
distilled water and germinated on Murashige and Skoog (MS)
medium (pH 5.7) (Murashige and Skoog, 1962) with half-strength
of vitamins and salt under a 16/8 h light/dark cycle, with a light
intensity of 350 mmol m2 s1 and a relative humidity of 65% at
25 ± 2 C. After 5 days of germination, the hypocotyls were utilized
for plant transformation via A. tumefaciens (EHA105 strain) containing the SWPA2 promoter-codA cassette. The transformed cells
were selected on Schenk and Hildebrandt (SH) medium (Schenk
and Hildebrandt, 1972) containing 2.0 mg L1 2, 4dichlorophenoxyacetic acid (2, 4-D), 0.2 mg L1 kinetin,
250 mg L1 cefotaxime and 50 mg L1 kanamycin. Shoots were
regenerated from the calli by transferring to MS medium containing 1.0 mg L1 benzylaminopurine (BAP), 0.3 mg L1 1naphthylaceticacid (NAA), 250 mg L1 cefotaxime, and 50 mg L1
kanamycin. During the experiments, the cultures were maintained
in a culture room at 25 ± 2 C under a 16 h photoperiod. Regenerated shoots were transferred to MS medium for rooting. The
rooted plantlets were then acclimated in pots in the growth
chamber for 1 week before they were transferred to soil.
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
2.3. Methyl viologen treatment and ion leakage analysis
The oxidative stress tolerance assay was conducted according to
the method of Kwon et al. (2002). Six leaf discs (8 mm in diameter)
collected from alfalfa plants at the same position were floated on a
solution containing 0.4% (w/v) sorbitol and 5 mM MV, incubated in
the dark for 12 h to allow diffusion of the MV into the leaves and
then subjected to continuous light treatment (150 mmol m2 s1) at
25 C. The loss of cytoplasmic solutes following MV treatment
(based on the electrical conductance of the solution) was measured
with an ion conductivity meter (model 455C, Istek Co., Seoul, Korea) over a time period ranging from 0 to 24 h and compared with
the total conductivity of the solution following tissue destruction.
The extent of cellular damage was quantified by ion leakage, which
is a measure of membrane disruption.
2.4. Salt and drought stress treatments
Plants were propagated under sterile conditions in Petri dishes
containing MS medium supplemented 100 mg L1 kanamycin. For
stress tolerance evaluations, plantlets rooted in MS medium were
transferred to pots filled with equal quantities of soil and grown in a
growth chamber under a 16-h photoperiod at a light intensity of
100 mmol m2 s1 and 60% (w/v) relative humidity at 25 C. For salt
and drought stress analysis on the whole plant level, 4-week-old
similarly sized alfalfa plants grown at 25 C in a growth chamber in
10-cm diameter pots were selected for analysis. The selected plants
were irrigated with 250 mM NaCl solution once every 3 days for 2
weeks and then with tap water for 1 week. The tolerance of
transgenic plants to salt stress was estimated based on the contents
of glycinebetaine (GB), chlorophyll, and malondialdehyde (MDA) in
the leaves after treatment.
Drought stress was imposed by withholding the water supply to
the plants, which were maintained at 25 C under a light intensity
of 100 mmol photons m2 s1. Before withholding the water supply,
the plants were irrigated with similar quantities of water from trays
placed underneath the pots for 1 week. After 1 week of water
withholding, the plants were again irrigated and permitted to
recover from the drought conditions. The degree of drought stress
was assessed by measuring the free proline content and relative
water content (RWC) in leaves after 5 days of water withholding.
RWC (%) was measured using the procedures described by Ahmad
et al. (2008). The following formula was utilized: RWC (%) ¼ [(FWDW)/(TW-DW)] 100, in which FW ¼ immediate weight of freshly
collected leaves, TW ¼ turgid weight of leaves after incubation in
water for 6 h at 20 C in the light, and DW ¼ dry weight of the same
leaves after drying at 80 C for 48 h. RWC% was measured in the
fourth fully expanded leaf from the shoot apical meristem.
2.5. PCR and RT-PCR analysis
Genomic DNA was extracted from leaves of alfalfa plants using
the protocol described by Kim and Hamada (2005). The PCR was
33
conducted with purified genomic DNA in PCR premix (Cat. no. K2012, Bioneer, Korea) using two convergent primers complementary to the codA gene (Table 1). The amplification reactions consisted of 94 C for 5 min (1 cycle), followed by 30 cycles (94 C for
30 s, 62 C for 30 s, and 72 C for 1 min) and a final extension cycle
of 7 min at 72 C. The PCR products were separated on a 1% agarose
gel, stained with ethidium bromide, and visualized under UV. All
subsequent experiments were conducted on cloned plants from the
T0-generation of transgenic plants.
Leaves from 4-week-old plants grown in soil were treated with
5 mM MV, 250 mM NaCl solution, or withdrawing water for 1 week
to activate the SWPA2 promoter and induce codA expression. Total
RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad,
CA) and treated with RNase-free DNase I to remove any contaminating genomic DNA. For semi-quantitative and quantitative
expression analysis of codA, the actin gene and various IAA genes
(MsIAA3, MsIAA5, MsIAA6, MsIAA7, and MsIAA16) (Wang et al., 2014)
in alfalfa plants, total RNA (2 mg) was used to generate first-strand
cDNA using an RT-PCR kit (TOPscript™ RT DryMIX) according to the
manufacturer's instructions. For the Semi-quantitative RT-PCR
analysis, the PCR conditions were identical for both codA and actin
as described in the genomic PCR analysis, except for the extension
time 30-s/cycle. And the PCR products were separated and visualized as above description of genomic PCR analysis. Quantitative
real-time PCR (q-RT-PCR) was performed in a fluorometric thermal
cycler (DNA Engine Opticon 2, MJ Research, USA) using the fluorescent dye EverGreen according to the manufacturer's instructions. Transcript levels were calculated relative to the controls.
Data represent means and standard errors of three biological replicates. The expression levels of the codA, actin, and various IAA
genes were analyzed by q-RT-PCR using the gene-specific primers
listed in Table 1. The PCR product of each alfalfa IAA gene was
confirmed by sequencing analysis and further analyzed through
alignment with other known plant IAAs (data not shown).
2.6. Relative chlorophyll content
Chlorophyll contents were measured with a portable chlorophyll meter (SPAD-502, Konica Minolta, Japan) from intact fully
expanded fifth leaves (from the shoot apical meristem) of individual plants. The relative chlorophyll content after salt stress
(250 mM NaCl) was determined via comparison with the chlorophyll content under growth chamber conditions with 16-h photoperiod at a light intensity of 100 mmol m2 s1 and 60% (w/v)
relative humidity at 25 C.
2.7. Glycinebetaine analysis
Four-week-old plants grown in soil were irrigated with 250 mM
NaCl solution or subjected to water withholding for 1 week to
induce the expression of codA. The samples were collected after 3
days and 5 days of salt and drought treatment, respectively. GB
extraction was conducted as described by Park et al. (2004) and GB
Table 1
Gene-specific primers used for genomic and RT-PCR analysis.
cDNA
Forward primer
Reverses primer
Amplicon size (bp)
codA (Genomic PCR)
codA (RT-PCR)
MsIAA3 (KJ996098)
MsIAA5 (KJ955634)
MsIAA6 (KJ955635)
MsIAA7 (KJ955636)
MsIAA16 (KJ955637)
Actin (JQ028730.1)
GCTGCTGGAATCGGGCTA
CACAACTCCTGCATCGCCTT
GCAATTCGCCTGGACTTCCT
TCTGTGCCAGTGGAACAAGGT
TGCTCATCAAACCCAATCATCT
AGCAGTAACAGCAACCATAATC
CACAGTTCCATTGAATGTACGA
TCCTAGGGCTGTGTTTCCAAGT
TGGGCTTATCGCGGAAGT
GTTGGTTTCCAGCCGCTTGTA
CGTCGCCTACAAGCATCCAAT
TGGTGACTCAGAGCCTGGTAA
TTCTGTTTCTGCTGTTGCTACT
CCTTGAAATTGATGAGCCAACA
TGAGGTGGCAATTAGATGAAGA
TGGGTGCTCTTCAGGAGCAA
1000
122
125
119
106
143
149
200
34
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
was measured via UV-VIS spectrophotometry according to Zhou
et al. (2008).
2.10. Statistical analysis
Data were statistically analyzed with Statistical Package for the
Social Sciences (SPSS 16). Means were separated using Duncan's
multiple range test at p ¼ 0.05.
2.8. Malondialdehyde analysis
3. Results
Lipid peroxidation was estimated by measuring malondialdehyde (MDA) contents according to a modified thiobarbituric acid
(TBA) method (Sunarpi et al., 2005). Approximately 0.1 g of leaf
tissue was ground in 0.5 ml 10% trichloroacetic acid (TCA) using a
mortar and pestle. The homogenate was centrifuged at 10,000 rpm
for 20 min. The reaction mixture (containing 0.4 ml extract and
0.6 ml TBA) was heated at 100 C for 30 min, quickly cooled on ice,
and centrifuged again at 10,000 rpm for 20 min. The absorbances at
450, 532, and 600 nm were determined using an ultraviolet spectrophotometer (Spectronic, Genesys™2, USA). Three biological
replicates were performed.
2.9. Free proline analysis
3.1. Generation of transgenic alfalfa plants
Transgenic alfalfa plants overexpressing codA in chloroplasts
under the control of an oxidative stress-inducible SWPA2 promoter
(referred to as SC plants) were successfully generated via Agrobacterium-mediated transformation. The plant expression
construct included a gene encoding a transit peptide (TP), which
facilitates the targeting of choline oxidase to the chloroplast
(Fig. 1A). The putative regenerated alfalfa plants were selected on
SH medium containing kanamycin. An initial screening of the putative transgenic alfalfa plants was implemented by genomic PCR
analysis using codA-specific primers (Table 1). The results revealed
that the recombinant codA gene had been integrated into the genomes of transgenic plants in each of the 12 independent lines,
The free proline content of drought-treated plants was
measured using a spectrophotometer according to the method of
Bates et al. (1973). Leaf tissue (0.1 g) was homogenized in 3 ml of
sulfosalicylic acid (3%) and centrifuged at 10,000 g for 15 min. Then,
1 ml of the supernatant was added to a test tube, along with 1 ml
glacial acetic acid and 1 ml ninhydrin reagent. The reaction mixture
was boiled in a water bath at 100 C for 30 min. After cooling, 2 ml
toluene was added to the reaction mixture, which was then vortexed for 30 s. The upper phase (containing proline) was measured
with a spectrophotometer (UV-2550, Shimadzu, Japan) at 520 nm
using toluene as the blank. The proline content (mg/g FW) was
quantified by the ninhydrin acid reagent method using proline as
the standard (Bates et al., 1973).
Fig. 1. Development of transgenic alfalfa plants expressing the codA gene in chloroplasts. (A) Schematic representation of the T-DNA regions of pScodA used for alfalfa
transformation. SWPA2 pro, sweet potato peroxidase anionic 2 promoter; TP, transit
peptide from the sequence of the small subunit of Rubisco (tobacco); codA, choline
oxidase cDNA; T-nos, termination sequence from the nopaline synthase gene. (B)
Genomic DNA PCR analysis of the codA gene from transgenic plants. M, size markers;
PC, positive control; NT, non-transgenic plant; Numbers (1e12), independent transgenic lines. (C) Semi-quantitative RT-PCR analysis of 12 lines expressing stable codA
gene integration in transgenic plants following MV treatment.
Fig. 2. Plant growth and expression of auxin-related IAA genes in non-transgenic (NT)
and transgenic (SC) plants under normal growth conditions for 1 month. (A) Plant
phenotype. (B) Expression patterns of the various alfalfa IAA genes in leaves. Total RNA
was extracted and purified following the manufacturer's instructions. First-strand
cDNA synthesis and PCR were conducted in accordance with the manufacturer's instructions. The expression levels of the IAA genes were normalized to that of the alfalfa
actin gene as the internal control. Data are expressed as the mean ± SD of three
replicates. Asterisks indicate a significant difference between NT and SC plants at
*p < 0.05 or **p < 0.01 by t-test.
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
whereas no integration was detected in the NT line (Fig. 1B). We
propagated the transgenic plant lines in a plant growth chamber
and subjected them to semi-quantitative RT-PCR analysis with a
codA gene-specific primer using RNA from MV-treated leaf discs.
After stress induction by MV, induced expression of codA was
detected in the leaf disc of all 12 transgenic lines, but not in the NT
35
plants (Fig. 1C). The strongest induction of codA expression was
detected in lines SC7, SC8, and SC9 after MV treatment. Plants from
these three transgenic lines (referred to as SC7, SC8, and SC9 plants)
were selected for further characterization.
3.2. Enhanced growth and increased expression of auxin-related
IAA genes in SC plants
When acclimated NT and SC plants were grown in soil for 1
month in the growth chamber, SC plants exhibited 1.26e1.37-fold
higher plant height than NT plants (Fig. 2A). To determine
whether the increased growth of SC plants was related to auxin
biosynthesis, we investigated the expression of auxin-responsive
IAA genes, including MsIAA3, MsIAA5, MsIAA6, MsIAA7, and
MsIAA16. Under normal conditions, the SC plants showed increased
transcript levels of five auxin-responsive IAA genes (Fig. 2B), indicating that overexpression of codA may play a positive role in an
auxin transport-related signaling pathway.
3.3. Improved tolerance to MV-mediated oxidative stress
To evaluate the methyl viologen (MV) mediated-oxidative stress
tolerance of SC plants, we treated leaf discs of 1 month old SC and
NT plants with 5 mM MV solution for 24 h. MV is a non-selective
herbicide that produces massive bursts of ROS, which disrupt
membrane integrity and lead to cell death (Bowler et al., 1991).
Different extents of visible damage were observed in leaf discs from
SC and NT plants (Fig. 3A). Severe necrosis was observed in NT leaf
discs, whereas SC plants exhibited less necrosis. The ion leakage
level of transgenic SC7, SC8, and SC9 plants was 25%, 21%, and 27%,
respectively, whereas the NT plants exhibited 43% ion leakage after
24 h of MV treatment (Fig. 3B). SC plants displayed significantly
(p ¼ 0.05) less ion leakage than NT plants under MV-stress treatment. Since the heterologous gene was driven by the stressinducible SWPA2 promoter, we examined the expression patterns
of codA after MV-triggered oxidative stress by q-RT-PCR. The
transcript levels of codA were significantly higher in transgenic
lines SC7, SC8, and SC9 than in NT under MV treatment (Fig. 3C),
indicating that overexpression of codA increases the tolerance to
MV-mediated oxidative stress.
3.4. Enhanced tolerance of SC plants to high salinity stress
Fig. 3. Effect of MV-mediated oxidative stress on the ion leakage of non-transgenic
(NT) and transgenic (SC) plants at 0 and 24 h after 5 mM MV treatment. (A) Differential visible damage of leaf discs. (B) Relative membrane permeability. Percentages of
relative membrane permeability were calculated using 100% to represent values obtained after autoclaving. (C) Transcript levels of codA gene expression. Total RNA was
extracted after 0 and 24 h MV treatment. The expression level of codA was normalized
to that of the alfalfa actin gene as the internal control. Data are expressed as the
mean ± SD of three replicates. Asterisks indicate a significant difference between NT
and SC plants at *p < 0.05 or **p < 0.01 by t-test.
To evaluate the tolerance of SC plants to salt stress, we subjected
1-month-old SC and NT plants to 250 mM NaCl treatment for 14
days. This treatment had a significantly smaller impact on the
growth of SC plants versus NT plants. Before salt treatment, the
health status of SC and NT plants were indistinguishable (Fig. 4A).
However, NT plants exhibited severely inhibited growth with
yellowish leaf coloration after salt treatment, and they were dead 2
weeks later, in contrast to the vigorous growth of SC plants (Fig. 4A).
Since the heterologous gene was driven by the stress-inducible
SWPA2 promoter, we examined the expression patterns of codA
after salt treatment by q-RT-PCR. The transcript levels of codA
significantly increased in transgenic SC7, SC8, and SC9 plants after
salt treatment (Fig. 4B). To determine whether overexpression of
codA increased the glycinebetaine (GB) contents after salt treatment, we measured the GB contents in leaves of alfalfa plants
(Fig. 4C). Before salt treatment, the GB content in the NT leaves was
7.89 mmol g1, indicating that alfalfa is a natural accumulator of GB,
whereas that in SC7, SC8, and SC9 plants was 8.8, 9.0, and
7.9 mmol g1 fresh weight, respectively. After salt treatment, SC7,
SC8 and SC9 plants exhibited 1.76-, 1.17-, and 1.21-fold higher GB
levels than NT plants, respectively.
36
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
Fig. 4. Salt stress analysis of non-transgenic (NT) and transgenic (SC) plants. (A) Plant growth before salt treatment (upper panel) and after 250 mM NaCl treatment for 14 days
(lower panel). (B) q-RT-PCR analysis of codA expression in leaves. Total RNA was extracted before salt stress and after 250 m NaCl treatment for 1 day. The expression level of codA
was normalized to that of the alfalfa actin gene as the internal control. (C) Glycinebetaine (GB) content of plant leaves before salt treatment and after 250 mM NaCl treatment for 3
days. (D) Chlorophyll contents of plant leaves before salt treatment and after 250 mM NaCl treatment for 4 days. (E) Malondialdehyde (MDA) contents in leaves before salt treatment
and after 250 mM NaCl treatment for 1 day. Data are expressed as the mean ± SD of three replicates. Asterisks indicate a significant difference between NT and SC plants at *p < 0.05
or **p < 0.01 by t-test.
We then investigated the chlorophyll and malondialdehyde
(MDA) contents in plants before and after salt stress treatment, as
these values represent important stress-related physiological and
biochemical parameters. Before salt stress, there was no significant
difference in chlorophyll content in the leaves of NT versus SC lines.
However, after salt treatment, SC7 and SC8 plants maintained high
levels of chlorophyll (3.5%e5.2% reduction) compared with NT
plants (Fig. 4D), indicating that the photosystem of SC plants is less
affected than that of NT plants during salt stress. To test the
membrane stability of the plant lines, which represents the degree
of cell membrane damage under stress, we determined the MDA
contents in these plants. Before salt stress, the MDA contents in SC
transgenic lines were similar to those of NT plants. Under 250 mM
NaCl treatment for 24 h, the MDA contents of NT plants were
greater than those of SC plants overexpressing codA (Fig. 4E).
3.5. Enhanced tolerance of SC plants to drought stress
To determine whether codA is involved in the drought tolerance
of transgenic alfalfa, we investigated the performance of the codAoverexpressing alfalfa plants under drought stress. Under normal
growth conditions, there were no significant differences in plant
growth between NT plants and the three SC transgenic lines
(Fig. 5A). After drought treatment for 7 days, SC plants grew well
and only some leaves turned yellow, whereas NT plants showed
severe wilting and curling. Following 3 days of rehydration after
drought treatment, the NT plants were nearly dead, with no recovery observed, whereas SC8 and SC9 plants fully recovered from
the dehydration conditions. The survival rates of transgenic plants
after drought treatment were greater than those of NT plants
(Fig. 5A). The transcript levels of codA in SC7, SC8, and SC9 lines
significantly increased after drought treatment (Fig. 5B). The GB
contents in the leaves of SC plants also significantly increased after
drought stress (Fig. 5C). After drought stress, the GB contents in SC
plants exhibited 1.21-, 1.39-, and 1.24-fold increases compared with
those under normal conditions, whereas the GB contents in NT
plants were unchanged.
We analyzed the degree of water loss in plants after drought
stress. SC plants exhibited higher relative water content (RWC)
values than NT plants under drought stress (Fig. 5D), suggesting
that SC plants exhibited less water loss than NT plants during the
dehydration process. We also measured the contents of proline, a
type of compatible osmolyte, in SC and NT plants. Under control
conditions, the free proline contents were not significantly
different between NT and SC plants. However, after withholding
water for 5 days, SC plants accumulated higher free proline levels
than NT plants (Fig. 5E).
4. Discussion
This study demonstrates the successful transformation of an
elite alfalfa cultivar, producing plants harboring the chloroplasttargeted codA gene under the control of the oxidative stressinducible SWPA2 promoter. The transgenic alfalfa plants (SC
plants) exhibited increased tolerance to oxidative stress, as well as
salt and drought stress, via induced expression of codA. This
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
37
Fig. 5. Drought stress analysis of non-transgenic (NT) and transgenic (SC) plants. (A) Plant growth before drought stress (upper panel) and after water withholding for 1 week and
rehydration for 3 days (lower panel). (B) q-RT-PCR analysis of codA expression before drought stress and after water withholding for 5 days. The expression level of codA was
normalized to that of the alfalfa actin gene as the internal control. (C) GB contents of NT and SC plants before drought stress and after water withholding for 5 days. (D) Relative
water content of NT and SC plants before drought stress and after water withholding for 5 days. (E) Proline contents in the leaves of SC and NT plants before drought stress and after
water withholding for 5 days. Data are expressed as the mean ± SD of three replicates. Asterisks indicate a significant difference between NT and SC plants at *p < 0.05 or **p < 0.01
by t-test.
observation is consistent with the results of previous studies of the
heterologous expression of bacterial codA in various transgenic
plants (Hayashi et al., 1997; Alia et al., 1998; Sakamoto and Murata,
2000; Park et al., 2004, 2007; Ahmad et al., 2008, 2010; Kathuria
et al., 2009; Goel et al., 2011). These results indicate that engineering increased GB biosynthesis in alfalfa is a feasible approach to
improving its tolerance to multiple abiotic stresses.
Many approaches have been used to engineer stress tolerance in
plants, with limited success (Park and Chen, 2006). One major
problem that this type of engineering can lead to undesirable or
unfavorable phenotypic changes, such as growth retardation and
decreased yields. To date, only positive effects of GB accumulation
in transgenic plants have been reported, even in plants grown
under non-stress conditions (Sulpice et al., 2003; Chen and Murata,
2011). In addition, exogenous treatment of GB can increase plant
growth and yield (Xing and Rajashekar, 1999). Moreover, the
codAetransgenic plants exhibited increased production of flowers
and seeds, even the size of flower buds and fruit compared with
wild-type plants (Park et al., 2007b; Chen and Murata, 2008). Under
stressful conditions, the performance of many types of transgenic
plants is better than that of untransformed controls, suggesting
that this technique has great potential for agricultural applications
(Park et al., 2007a; Chen and Murata, 2008, 2011). The plant hormone auxin regulates a number of cellular and developmental
processes, including cell division, cell growth, and differentiation
(Friml, 2003). At the molecular level, auxin exerts its function by
regulating the expression of numerous auxin-responsive genes,
including AUX⁄IAA genes. To confirm whether the increased growth
of SC plants was related to the expression of auxin-responsive
genes, we investigate the expression of MsIAA genes in these
plants. Interestingly, the expression of auxin-responsive MsIAA
genes, including MsIAA3, MsIAA5, MsIAA6, MsIAA7, and MsIAA16,
was significantly up-regulated at the transcriptional level under
normal growth conditions (Fig. 2B). However, the relationship of
codA to auxin biosynthesis remains to be clarified to elucidate the
possible mode of action of choline oxidase.
38
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
Transgenic lines harboring codA exhibited enhanced tolerance
to a variety of stresses. As the codA gene was driven by a stressinducible promoter, the induction patterns of codA under
different stress conditions, including MV, salt and drought, verify
the stable integration and transcription of foreign genes in SC
plants (Figs. 3C, 4B and 5B).
Abiotic stresses, such as salinity and drought, which disturb
redox homeostasis in plant cells, can induce oxidative stress by
inducing a burst of ROS. ROS have been implicated in all types of
stresses, as they can damage lipids, proteins, DNA, and carbohydrates. If ROS are not scavenged sufficiently in the proper period of
time, senescence and programmed cell death might occur (Apel
and Hirt, 2004; Miller et al., 2010). On the other hand, scavenging
too many ROS may negatively affect signal transduction. Therefore,
balancing ROS generation and scavenging is essential for the stress
response in plants. Despite the occurrence of GB-mediated
enhancement of stress tolerance in many plants, its mechanistic
influence on stress signaling and perception remains unclear due to
a lack of direct evidence supporting the participation of GB in
antioxidative defense systems. Studies have demonstrated that GB
alone does not have antioxidative activity in vitro (Smirnoff and
Cumbes, 1989). Thus, its ROS-scavenging function must be indirect. The current results, which demonstrate that the transformants
had enhanced stress tolerance, as evidenced by the lower extent of
visible damage in leaf discs and lower levels of ion leakage under
challenging conditions imposed by 5 mM MV-mediated oxidative
stress (Fig. 3), are consistent with previous findings.
Salt stress causes ROS production, which results in the accumulation of MDA in plants due to membrane lipid peroxidation
(Gill and Tuteja, 2010). Oxidative stress-induced membrane damage and cell membrane stability have been used as efficient criteria
to assess the degree of salt tolerance in plants (Meloni et al., 2003;
Sairam et al., 2005). Our results show that the MDA contents were
lower in transgenic alfalfa than in NT plants under salt stress conditions (Fig. 4E). These results imply that the degree of membrane
injury in transgenic plants was less than that of NT plants, which is
consistent with the enhanced salt tolerance phenotype of transgenic alfalfa.
Under stress conditions, alfalfa plants instinctively synthesize
and accumulate more GB, since alfalfa is a natural GB accumulator.
Both the SC and NT plants accumulated GB to similar levels before
stress treatment (Figs. 4C and 5C). The GB content in SC plants
significantly increased under salt and drought stress due to the
anticipated induction of codA transcriptional expression under the
control of stress-inducible SWPA2 promoter. The increased GB
contents in the SC plants contributed to their enhanced tolerance to
oxidative, salt, and drought stresses. A series of studies using
transgenic plants have demonstrated that GB, even at low levels,
can confer transgenic plants with increased tolerance to cold,
freezing, drought, and salt stress (Chen and Murata, 2008, 2011). GB
levels as low as 0.09 mmol g1 FW can impart chilling stress tolerance in tomato plants (Park et al., 2004), and 0.035 mmol g1 FW GB
is sufficient to impart salinity tolerance in transgenic tobacco plants
(Holmstrom et al., 2000). Many studies have demonstrated that GB
synthesized in chloroplasts is more effective at imparting stress
tolerance in transgenic plants that GB synthesized elsewhere (Park
et al., 2007a). We assume that in the current study, codA, which
functions in GB synthesis, was successfully targeted to the alfalfa
chloroplasts, because the same transit peptide was utilized as that
reported by Hayashi et al. (1997) and Ahmad et al. (2008). Mechanistically, GB stabilizes macromolecular activity and membrane
integrity (Sakamoto and Murata, 2002). Indeed, we detected
reduced ion leakage and MDA content in the leaf cells of codA
transgenic alfalfa (Figs. 3B and 4E) in this study, suggesting
improved cell membrane homeostasis in SC plants. Therefore, it can
be assumed that GB protects the cell membrane from stressinduced injuries, likely through alleviating oxidative stress.
Transgenic tomato plants that synthesize GB in the chloroplast
exhibit higher levels of photosynthetic activity than wild-type
plants under salt stress conditions (Park et al., 2007a). Chloroplasts are the major sites of photo oxidative reactions, which
abundantly produce ROS. The protective effect conferred by GB
guards the machinery required for the degradation and synthesis of
D1 protein under stress exerted by high salt conditions (Ohnishi
and Murata, 2006). In the current study, SC transgenic plants
maintained higher levels of chlorophyll and salinity tolerance
during the entire period of salt stress than NT plants (Fig. 4).
Therefore, we can conclude that the higher photosynthetic activity
maintained by SC plants versus NT plants was the result of GB
synthesis in the chloroplasts, indicating that GB synthesized in
chloroplasts protects not only the photosynthetic machinery but
also the antioxidant defense mechanisms of plants.
There is evidence that high levels of salt cause an imbalance of
cellular ions, leading to both ion toxicity and osmotic stress
(Greenway and Munns, 1980). High salt concentrations make it
more difficult for roots to take up water. Additionally, high salt
concentrations within the plant can be toxic due to the disturbance
of essential cellular metabolic pathways, such as protein synthesis
and enzyme activity. Osmotic adjustments by accumulating
osmoprotectants inside the cell are essential for reducing the
cellular osmotic potential against an osmotic gradient between root
cells and the outside saline solution, which eventually restores
water uptake into roots during salinity stress (Greenway and
Munns, 1980). When suffering from abiotic stresses, many plants
accumulate compatible osmolytes, such as free proline and soluble
sugar (Liu and Zhu, 1997; Armengaud et al., 2004). These osmolytes
function as osmoprotectants, allowing the plants to tolerate stress.
In this study, we examined the contents of the osmoprotectant
proline in plants. The results showed that the contents of free
proline were greater under drought stress conditions, and the free
proline levels in codA-overexpressing transgenic plants were
greater than those in NT plants (Fig. 5E). Thus, the increased
accumulation of proline contributes to the increased drought
tolerance of transgenic alfalfa.
GB is a compatible solute, also known as an osmolyte, which
performs an important function in plants, as evidenced by their
enhanced tolerance to osmotic stress. However, the increased level
of GB in transgenic plants indicates that GB plays a role other than
osmoprotection. A variety of studies have demonstrated that GB
exerts protective effects and stabilizes macromolecules, enzyme
activity, and membranes under stressful conditions (Papageorgiou
and Murata, 1995; Chen and Murata, 2002; Sakamoto and
Murata, 2002). Quan et al. (2004) reported that GB-synthesizing
transgenic maize withstood drought conditions better than wildtype (WT) plants, even though the GB contents in the transgenic
plants were significantly lower than those of natural accumulators.
Moreover, transgenic tobacco plants evidencing GB-synthesizing
ability also exhibit enhanced tolerance to polyethyleneglycol
(PEG)-mediated osmotic stress conditions (Shen et al., 2002). According to our data, GB-synthesizing alfalfa plants evidenced
enhanced tolerance to drought stress via the maintenance of higher
relative water contents and higher free proline contents than the
NT plants, and the transgenic plants recovered normal growth after
irrigation (Fig. 5).
In conclusion, GB accumulation in transgenic alfalfa plants by
the heterologous overexpression of codA significantly improved
plant tolerance to oxidative, salt, and drought stress, which was
mediated by the induction or activation of GB synthesis, increased
proline accumulation, and improved protection of membrane
integrity. Thus, this study has increased our understanding of the
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
molecular mechanisms of GB function in plants, although some
aspects are still unclear, such as how ROS affect the biosynthesis of
GB and proline at the molecular level. The relationship between GB
biosynthesis and the expression of auxin-related IAA genes remains
to be studied. Nevertheless, the enhanced performance of these
transgenic alfalfa lines without phenotypic defects demonstrates
that engineering the GB biosynthetic pathway is not only a feasible
approach to improving the economically important crop alfalfa, but
it also holds great promise for breeding programs of other crops. In
this study, transgenic alfalfa overexpressing codA was significantly
more drought and salt tolerant than NT plants. We hope that the
transgenic alfalfa plants generated in this study can be used not
only as a forage crop but also as a crop for covering marginal lands
such as salt-affected or dry lands.
Author contributions
S.S. Kwak, H. Li and Z. Wang: conceived and designed the experiments. Z. Wang, H. Li, Q. Ke, and J.C. Jeong: performed the experiments. J.C. Jeong, H.S. Lee, B. Xu, and Y.P. Lim: analyzed the data.
X. Deng and H.S. Lee: contributed reagents/materials/analysis tools.
H. Li, Z. Wang and S.S. Kwak: wrote the paper.
Acknowledgments
This work was supported by grants from the Korea-China International Collaboration Project, the National Research Foundation
(NRF) of Korea, the National Natural Science Foundation of China
(no.51479189), the 111 project of the Ministry of Education, China
(No. B12007) and the National Center for GM Crops (PJ008097),
Biogreen21 Project for Next Generation, Rural Development
Administration, Korea.
References
Ahmad, R., Kim, M.D., Back, K.H., Kim, H.S., Lee, H.S., Kwon, S.Y., Murata, N.,
Chung, W.I., Kwak, S.S., 2008. Stress-induced expression of choline oxidase in
potato plant chloroplasts confers enhanced tolerance to oxidative, salt, and
drought stresses. Plant Cell. Rep. 27, 687e698.
Ahmad, R., Kim, Y.H., Kim, M.D., Kwon, S.Y., Cho, K., Lee, H.S., Kwak, S.S., 2010.
Simultaneous expression of choline oxidase, superoxide dismutase and ascorbate peroxidase in potato plant chloroplasts provides synergistically enhanced
protection against various abiotic stresses. Physiol. Plant 138, 520e533.
Alia, Hayashi H., Chen, T.H.H., Murata, N., 1998. Transformation with a gene for
choline oxidase enhances the cold tolerance of Arabidopsis during germination
and early growth. Plant Cell. Environ. 21, 232e239.
Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and
signal transduction. Annu. Rev. Plant Biol. 55, 373e399.
, A., 2004. TranArmengaud, P., Thiery, L., Buhot, N., Grenier-de March, G., Savoure
scriptional regulation of proline biosynthesis in Medicago truncatula reveals
developmental and environmental specific features. Physiol. Plant 120,
442e450.
Avraham, T., Badani, H., Galili, S., Amir, R., 2005. Enhanced levels of methionine and
cysteine in transgenic alfalfa (Medicago sativa L.) plants over-expressing the
Arabidopsis cystathionine g-synthase gene. Plant Biotechnol. J. 3, 71e79.
Bates, L., Waldren, R., Teare, I., 1973. Rapid determination of free proline for water
stress studies. Plant Soil 39, 205e207.
Bohnert, H.J., Jensen, R.G., 1996. Strategies for engineering waterstress tolerance in
plants. Trends Biotechnol. 14, 89e97.
Bohnert, H.J., Nelson, D.E., Jensen, R.G., 1995. Adaptations to environmental stresses.
Plant Cell. 7, 1099e1111.
Bowler, C., Slooten, L., Vandenbranden, S., De, R., Botterman, J.R., Synesma, C.J.,
Montagu, M.V., Inze, D., 1991. Manganese superoxide dismutase can reduce
sellular damage mediated by oxygen radicals in transgenic plants. EMBO J. 10,
1723e1732.
Chen, T.H.H., Murata, N., 2002. Enhancement of tolerance to abiotic stress by
metabolic engineering of betaines and other compatible solutes. Curr. Opin.
Plant Biol. 5, 250e257.
Chen, T.H.H., Murata, N., 2008. Glycinebetaine: an effective protectant against
abiotic stress in plants. Trends Plant Sci. 13, 499e505.
Chen, T.H.H., Murata, N., 2011. Glycinebetaine protects plants against abiotic stress:
mechanisms and biotechnological applications. Plant Cell. Environ. 34, 1e20.
Deak, M., Kiss, G., Koncz, C., Dudits, D., 1986. Transformation of Medicago by
Agrobacterium-mediated gene transfer. Plant Cell. Rep. 5, 97e100.
39
Deshnium, P., Los, D.A., Hayashi, H., Mustardy, L., Murata, N., 1995. Transformation
of Synechococcus with a gene for choline oxidase enhances tolerance to salt
stress. Plant Mol. Biol. 29, 897e907.
Friml, J., 2003. Auxin transport-shaping the plant. Curr. Opin. Plant Biol. 6, 7e12.
Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in
abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48, 909e930.
Goel, D., Singh, A.K., Yadav, V., Babbar, S.B., Murata, N., Bansal, K.C., 2011. Transformation of tomato with a bacterial codA gene enhances tolerance to salt and
water stresses. J. Plant Physiol. 168, 1286e1294.
Greenway, H., Munns, R., 1980. Mechanisms of salt tolerance in nonhalophytes. Ann.
Rev. Plant Physiol. 31, 149e190.
Hayashi, H., Alia, Mustardy L., Deshnium, P., Ida, M., Murata, N., 1997. Transformation of Arabidopsis thaliana with the codA gene for choline oxidase;
accumulation of glycinebetaine and enhanced tolerance to salt and cold stress.
Plant J. 12, 133e142.
Holmstrom, K.O., Somersalo, S., Mandal, A., Palva, T.E., Welin, B., 2000. Improved
tolerance to salinity and low temperature in transgenic tobacco producing
glycine betaine. J. Exp. Bot. 51, 177e185.
Ikuta, S., Imamura, S., Misaki, H., Horiuti, Y., 1977. Purification and characterization
of choline oxidase from Arthrobacter globiformis. J. Biochem. 82, 1741e1749.
Kathuria, H., Giri, J., Nataraja, K.N., Murata, N., Udayakumar, M., Tyagi, A.K., 2009.
Glycinebetaine-induced water-stress tolerance in codA-expressing transgenic
indicarice is associated with up-regulation of several stress responsive genes.
Plant Biotechnol. J. 7, 512e526.
Kim, K.Y., Kwon, S.Y., Lee, H.S., Hur, Y., Bang, J.W., Kwak, S.S., 2003. A novel oxidative
stress-inducible peroxidase promoter from sweetpotato: molecular cloning and
characterization in transgenic tobacco plants and cultured cells. Plant Mol. Biol.
51, 831e838.
Kim, S.H., Hamada, T., 2005. Rapid and reliable method of extracting DNA and RNA
from sweetpotato, Ipomoea batatas (L) Lam. Biotechnol. Lett. 27, 1841e1845.
Kim, Y.H., Kim, M.D., Choi, Y.I., Park, S.C., Yun, D.J., Noh, E.W., Lee, H.S., Kwak, S.S.,
2011. Transgenic poplar expressing Arabidopsis NDPK2 enhances growth as well
as oxidative stress tolerance. Plant Biotechnol. J. 9, 334e347.
Kwon, S.Y., Jeong, Y.J., Lee, H.S., Kim, J.S., Cho, K.Y., Allen, R.D., Kwak, S.S., 2002.
Enhanced tolerance of transgenic tobacco plants expressing both superoxide
dismutase and ascorbate peroxidase in chloroplasts against methyl viologenmediated oxidative stress. Plant Cell. Environ. 25, 873e882.
Lee, S.H., Ahsani, N., Lee, K.W., Kim, D.H., Lee, D.G., Kwak, S.S., Kwon, S.Y., Kim, T.H.,
Lee, B.H., 2007. Simultaneous overexpression of both CuZn superoxide dismutase and ascorbate peroxidase in transgenic tall fescue plants confers
increased tolerance to a wide range of abiotic stresses. J. Plant Physiol. 164,
1626e1638.
Lim, S., Kim, Y.H., Kim, S.H., Kwon, S.Y., Lee, H.S., Kim, J.G., Cho, C.Y., Paek, K.Y.,
Kwak, S.S., 2007. Enhanced tolerance of transgenic sweetpotato plants
expressing both superoxide dismutase and ascorbate peroxidase in chloroplasts
against methyl viologen-mediated oxidative stress. Mol. Breed. 19, 227e239.
Liu, J., Zhu, J.K., 1997. Proline accumulation and salt-stress-induced gene expression
in a salt-hypersensitive mutant of Arabidopsis. Plant Physiol. 114, 591e596.
Mali, B.S., Thengal, S.S., Pate, P.N., 2012. Physico-chemical characteristics of salt
affected soil from Barhanpur. India Ann. Biol. Res. 3, 4091e4093.
Meloni, D.A., Oliva, M.A., Martinez, C.A., Cambraia, J., 2003. Photosynthesis and
activity of superoxide dismutase, peroxidase and glutathione reductase in
cotton under salt stress. Environ. Exp. Bot. 49, 69e76.
Miller, G., Suzuki, N., Ciftci-Yilmaz, S., Mtttler, R., 2010. Reactive oxygen species
homeostasis and signalling during drought and salinity stresses. Plant Cell.
Environ. 33, 453e467.
Mohanty, A., Kathuria, H., Ferjani, A., Sakamoto, A., Mohanty, P., Murata, N.,
Tyagi, A.K., 2002. Transgenics of an elite indica rice variety Pusa Basmati 1
harbouring the codA gene are highly tolerant to salt stress. Theor. Appl. Genet.
106, 51e57.
Murata, N., Mohanty, P.S., Hayashi, H., Papageorgiou, G.C., 1992. Glycinebetaine
stabilizes the association of extrinsic proteins with the photosynthetic oxygen
evolving complex. FEBS Lett. 296, 187e189.
Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays
with tobacco cultures. Physiol. Plant 15, 473e479.
Ohnishi, N., Murata, N., 2006. Glycinebetaine counteracts the inhibitory effects of
salt stress on the degradation and synthesis of D1 protein during photoinhibition in Synechococcus sp. PCC 7942. Plant Physiol. 141, 758e765.
Osborn, T., Brouwer, D., McCoy, T., 1997. Molecular marker analysis of alfalfa. In:
McKersie, B., Brown, D. (Eds.), Biotechnology and the Improvement of Forage
Legumes. CABI Publishing, Wallingford, UK, pp. 91e109.
Park, E.J., Chen, T.H.H., 2006. Improvement of cold tolerance in horticultural crops
by genetic engineering. Crop Improv. 17, 69e120.
Park, E.J., Jeknic, Z., Pino, M.T., Murata, N., Chen, T.H.H., 2007a. Glycinebetaine
accumulation is more effective in chloroplasts than in the cytosol for protecting
transgenic tomato plants against abiotic stress. Plant Cell. Environ. 30,
994e1005.
Park, E.J., Jeknic, Z., Sakamota, A., Denoma, J., Yuwansiri, R., Murata, N., Chen, T.H.H.,
2004. Genetic engineering of glycinebetaine synthesis in tomato protects seeds,
plants, and flowers from chilling damage. Plant J. 40, 474e487.
Park, E.J., Jekni
c, Z., Chen, T.H.H., Murata, N., 2007b. The codA transgene for glycinebetaine synthesis increases the size of flowers and fruits in tomato. Plant
Biotechnol. J. 5, 422e430.
40
H. Li et al. / Plant Physiology and Biochemistry 85 (2014) 31e40
Papageorgiou, G.C., Murata, N., 1995. The unusually strong stabilizing effects of
glycinebetaine on the structure and function of the oxygen-evolving photosystem II complex. Photosynth. Res. 44, 243e252.
Prasad, K.V.S.K., Sharmila, P., Kumar, P.A., Pardha, S.P., 2000. Transformation of
Brassica juncea (L.) Czern with bacterial codA gene enhances its tolerance to salt
stress. Mol. Breed. 6, 489e499.
Quan, R., Shang, M., Zhang, H., Zhao, Y., Zhang, J., 2004. Engineering of enhanced
glycinebetaine synthesis improves drought tolerance in maize. Plant Biotechnol. J. 2, 477e486.
n, S., Cecilia, C., Gabriel, I., 2009. Enhanced tolerance to multiple abiotic
Ramo
stresses in transgenic alfalfa accumulating trehalose. Crop Sci. 49, 1791e1799.
Reguera, M., Peleg, Z., Blumward, E., 2012. Targeting metabolic pathways for genetic
engineering abiotic stress-tolerance in crops. Biochim. Biophys. Acta 1819,
186e194.
Rhodes, D., Hanson, A.D., 1993. Quaternary ammonium and tertiary sulfonium
compounds in higher-plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44,
357e384.
Sairam, R.K., Srivastava, G.C., Agarwal, S., Meena, R.C., 2005. Differences in antioxidant activity in response to salinity stress in tolerant and susceptible wheat
genotypes. Biol. Plant 49, 85e91.
Sakamoto, A., Murata, N., 2000. Genetic engineering of GB synthesis in plants:
current status and implications for enhancement of stress tolerance. Exp. Bot.
51, 81e88.
Sakamoto, A., Murata, N., 2002. The role of glycine betaine in the protection of
plants from stress: clues from transgenic plants. Plant Cell. Environ. 25,
163e171.
Schenk, R.U., Hildebrandt, A.C., 1972. Medium and techniques for induction and
growth of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot.
50, 199e204.
Shen, Y.G., Du, B.X., Zhang, W.K., Zhand, J.S., Chen, S.Y., 2002. AhCMO regulated by
stresses in Atriples hortensis, can improve drought tolerance in transgenic tobacco. Theor. Appl. Genet. 105, 815e821.
Sivakumar, M.V.K., Das, H.P., Brunini, O., 2005. Impacts of present and future climate
variability and change of agriculture and forestry in the arid and semi-arid
tropics. Clim. Change 70, 31e72.
Smirnoff, N., Cumbes, Q.J., 1989. Hydroxyl radical scavenging activity of compatible
solutes. Phytochemistry 28, 1057e2060.
Sulpice, R., Tsukaya, H., Nonaka, H., Mustardy, L., Chen, T.H.H., Murata, N., 2003.
Enhanced formation of flowers in salt-stressed Arabidopsis after genetic engineering of the synthesis of glycinebetaine. Plant J. 36, 165e176.
Su, J., Hirji, R., Zhang, L., He, C.K., Selvaraj, G., Wu, R., 2006. Evaluation of the
stressinducible production of choline oxidase in transgenic rice as a strategy for
producing the stress-protectant glycine betaine. J. Exp. Bot. 57, 1129e1135.
Sunarpi, T., Horie, J., Motoda, M., Kubo, H., Yang, K., Yoda, R., Horie, W.Y., Chan, H.Y.,
Leung, K., Hattori, M., Konomi, M., Osumi, M., Yamagami, J.I., Schroeder, N.U.,
2005. Enhanced salt tolerance mediated by AtHKT1 transporter-induced Naþ
unloading from xylem vessels to xylem parenchyma cells. Plant J. 44, 928e938.
Tang, L., Cai, H., Ji, W., Luo, X., Wang, Z., Wu, J., Wang, X., Cui, L., Wang, Y., Zhu, Y.,
Bai, X., 2013. Overexpression of GsZFP1 enhances salt and drought tolerance in
transgenic alfalfa (Medicago sativa L.). Plant Physiol. Biochem. 71, 22e30.
Tang, L., Kwon, S.Y., Kim, J.S., Choi, J.S., Cho, K.Y., Sung, C.K., Kwak, S.S., Lee, H.S.,
2006. Enhanced tolerance of transgenic potato plants expressing both superoxide dismutase and ascorbate peroxidase in chloroplasts against oxidative
stress and high temperature. Plant Cell. Rep. 25, 1380e1386.
Varshney, R.K., Bansal, K.C., Aggarwal, P.K., Datta, S.K., Craufurd, P.Q., 2011. Agricultural biotechnology for crop improvement in a variable climate: hope or
hype? Trends Plant Sci. 16, 363e371.
Vij, S., Tyagi, A.K., 2007. Emerging trends in the functional genomics of the abiotic
stress response in crop plants. Plant Biotechnol. J. 5, 361e380.
Wang, W.B., Kim, Y.H., Lee, H.S., Deng, X.P., Kwak, S.S., 2009a. Differential antioxidation activities in two alfalfa cultivars under chilling stress. Plant Biotechnol. Rep. 3, 301e307.
Wang, W.B., Kim, Y.H., Lee, H.S., Kim, K.Y., Deng, X.P., Kwak, S.S., 2009b. Analysis of
antioxidant enzyme activity during germination of alfalfa under salt and
drought stresses. Plant Physiol. Biochem. 47, 570e577.
Wang, Z., Li, H.B., Ke, Q.B., Jeong, J.C., Lee, H.S., Xu, B.C., Deng, X.P., Lim, Y.P.,
Kwak, S.S., 2014. Transgenic alfalfa plants expressing AtNDPK2 exhibit increased
growth and tolerance to abiotic stresses. Plant Physiol. Biochem. 84, 67e77.
Wood, K.V., Stringham, K.J., Smith, D.L., Volenec, J.J., Hendershot, K.L., Jackson, K.A.,
Rich, P.J., Yang, W.J., Rhodes, D., 1991. Betaines of alfalfa. Characterization by fast
atom bombardment and desorption chemical ionization mass spectrometry.
Plant Physiol. 96, 892e897.
Xing, W., Rajashekar, C.B., 1999. Alleviation of water stress in beans by exogenous
glycine betaine. Plant Sci. 148, 185e192.
Yancey, P.H., Clark, M.E., Hand, S.C., Bowlus, R.D., Somero, G.N., 1982. Living with
water stress: evolution of osmolyte systems. Science 217, 1214e1222.
Zhang, J.Y., Broeckling, C.D., Blancaflor, E.B., Sledge, M.K., Sumner, L.W., Wang, Z.Y.,
2005. Overexpression of WXP1, a putative Medicago truncatula AP2 domaincontaining transcription factor gene, increases cuticular wax accumulation
and enhances drought tolerance in transgenic alfalfa (Medicago sativa). Plant J.
42, 689e707.
Zhou, Q., Wu, Y.M., Hu, X.H., Ni, H.T., 2008. Determination of betaine content in beet
root by colorimetric method sugar crops of China. Sugar Crops China 4, 27e30.