Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Reading Frames and ORF’s 1 Reading Frames • A piece of DNA has 6 possible reading frames • It is read in blocks of 3 nucleotides – a codon 1 2 3 -1 -2 -3 • Symbols used in figure *** >>> <<< ))) ((( stop-codon start-codon in frames 1,2 or 3 start-codon in frames -1,-2 or -3 Alternative start-codon (not important here) Alternative start codon (not important here) http://www.cbs.dtu.dk/services/VirtualRibosome/ 2 Bla A codon. 3 nucleotides Represent a fraction of a codon. 1 or 2 nucleotides Represents an intron 123 DNA sequence c 1 123 1 23 ATG TTC CGA T gtccctagcgtag AC Sequence counter 123 234 Exon 1 567 8910 11 …. mRNA sequence 3 123 stop-codon TCA TAA Intron Exon2 Reading frame and reverse complement Having a piece of DNA like: TGCCATGCATAGCCCCTGCCATATCT Forward strings & reading frames 1 : TGCCATGCATAGCCCCTGCCATATCT 2 : GCCATGCATAGCCCCTGCCATATCT 3 : CCATGCATAGCCCCTGCCATATCT Reverse and complement strings -1: TCTATACCGTCCCCGATACGTACCGT -> AGATATGGCAGGGGCTATGCATGGCT -2: CTATACCGTCCCCGATACGTACCGT -> GATATGGCAGGGGCTATGCATGGCT -3: TATACCGTCCCCGATACGTACCGT -> ATATGGCAGGGGCTATGCATGGCT ORF ORF – Open Reading Frame A piece of DNA going from STOP to STOP There are many ORF in the human genome – NOT all of them are transcribed Within an ORF you can look for a START codon and use prediction tools to guess/predict if a gene or at least an exon is located within that region Removal of intron regions in eukaryotes is a complex process (spliceosome) Prokaryotes do NOT have the small ribonucleoproteins involved in the spliceosome so no intron regions in ex Bacteria, but as always exceptions do occur (self-splicing introns). 5