Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
E. Coli Fluorescing Red Using Cold Temperature Sensor . Prm + I12007 B0032 Team: E Cool I Tina Khoury Jeremy Gerbig Kerwin Dunham Derek Blanchard Goals Achieve E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts). Find optimum temp where color change will be found. ~ 30-37°C Find optimum concentration of Cl. Gene originally from coral. Backup Plan Use high temp parts to make E. coli fluoresce at high temp instead at low using a different gene. Expressing high (green) and low (red) temp. genes in one sequence. How to do it? Part 1 BBa_I12007 82Bp Promoter: modified lambda Prm Promoter (OR-3 obliterated) 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagata tttataaatagtggtgatagatttaacgt Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 BBa_B0032 13Bp Ribosome Binding Site RSB.3 (medium)- derivative of BBa_0030 2010 Kit Plate 1 Well 2I, pSB1A2 tcacacaggaaag Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 3 BBa_E1010 681Bp Gene: highly engineered mutant of red fluorescent protein from Discosoma striata (coral) 2010 Kit Plate 1 Well 18F, pSB2K3 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaac ggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaa actgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacg gttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggt ttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctg caagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttat gcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctga aaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaacc acctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatca cctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccgg tgcttaataa Part 4 & 5 Super Part BBa_B0015 BBa_B0010 doubleT 129 Bp Stop, T1 from E. coli rrn B (Transcriptional Terminator) 2010 Kit Plate 1 Well 13D, pSB1A2 BBa_B0012 Stop, TE from coliophage T7 (Transcriptional Terminator) Source Plate 1000 Well 1B, pSB1A2 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt tcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactg gctcaccttcgggtgggcctttctgcgtttata What’s new? The complete complex Biobricks sequence that works! Combine 3 parts BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator Promoter RBS + Gene Double Terminator Protocol Isolate biobricks out of wells. BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator Transform the bacteria. Grow the transformed bacteria. Isolate & check plasmids. Gel Electrophoresis Protocol cont… Combining biobrick parts by digestion & ligation. BBa_I12007 - Promoter S BBa_I13503 - RBS + Gene X&P BBa_B0015 - Double Terminator X&P Protocol cont…. Transform bacteria with new recombinant plasmid. Observe results Color change dependent on Temp between ~ 30-37°C Cl concentration ~ 1x – 10x References Openwetware.org Partsregistry.org http://filebox.vt.edu/.../biol_4684/Methods/gene s.html http://www.fasebj.org/content/vol20/issue14/im ages/large/z386120661480003.jpeg http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?b ook=mga&part=A1549 http://www.stat.berkeley.edu/users/terry/Classes /s260.1998/Week8b/week8b/node3.html