Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Ppt0000029
Document related concepts
no text concepts found
Transcript
E. Coli Fluorescing Red Using Cold Temperature Sensor . Prm + I12007 B0032 Team: E Cool I Tina Khoury Jeremy Gerbig Kerwin Dunham Derek Blanchard Goals Achieve E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts). Find optimum temp where color change will be found. ~ 30-37°C Find optimum concentration of Cl. Gene originally from coral. Backup Plan Use high temp parts to make E. coli fluoresce at high temp instead at low using a different gene. Expressing high (green) and low (red) temp. genes in one sequence. How to do it? Part 1 BBa_I12007 82Bp Promoter: modified lambda Prm Promoter (OR-3 obliterated) 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagata tttataaatagtggtgatagatttaacgt Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 BBa_B0032 13Bp Ribosome Binding Site RSB.3 (medium)- derivative of BBa_0030 2010 Kit Plate 1 Well 2I, pSB1A2 tcacacaggaaag Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 3 BBa_E1010 681Bp Gene: highly engineered mutant of red fluorescent protein from Discosoma striata (coral) 2010 Kit Plate 1 Well 18F, pSB2K3 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaac ggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaa actgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacg gttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggt ttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctg caagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttat gcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctga aaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaacc acctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatca cctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccgg tgcttaataa Part 4 & 5 Super Part BBa_B0015 BBa_B0010 doubleT 129 Bp Stop, T1 from E. coli rrn B (Transcriptional Terminator) 2010 Kit Plate 1 Well 13D, pSB1A2 BBa_B0012 Stop, TE from coliophage T7 (Transcriptional Terminator) Source Plate 1000 Well 1B, pSB1A2 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt tcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactg gctcaccttcgggtgggcctttctgcgtttata What’s new? The complete complex Biobricks sequence that works! Combine 3 parts BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator Promoter RBS + Gene Double Terminator Protocol Isolate biobricks out of wells. BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator Transform the bacteria. Grow the transformed bacteria. Isolate & check plasmids. Gel Electrophoresis Protocol cont… Combining biobrick parts by digestion & ligation. BBa_I12007 - Promoter S BBa_I13503 - RBS + Gene X&P BBa_B0015 - Double Terminator X&P Protocol cont…. Transform bacteria with new recombinant plasmid. Observe results Color change dependent on Temp between ~ 30-37°C Cl concentration ~ 1x – 10x References Openwetware.org Partsregistry.org http://filebox.vt.edu/.../biol_4684/Methods/gene s.html http://www.fasebj.org/content/vol20/issue14/im ages/large/z386120661480003.jpeg http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?b ook=mga&part=A1549 http://www.stat.berkeley.edu/users/terry/Classes /s260.1998/Week8b/week8b/node3.html
Related documents