Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Bacterial Diseases in Coastal Populations Luz-Andrea Pfister, M.D. Ph.D. student Department of Anthropology & Ethnic Studies University of Nevada Las Vegas Andean Region • Long-term human occupation of the region starting 11,000-13,000 years B.P. at the coast (Keefer et al. 1998, Sandweiss et al. 1998). • Transition from migratory huntergatherers to sedentary populations around 8,000 B.P. (Benfer 1984, Quilter 1989) • Population estimates pre-contact 1520s – 6 million (Rowe 1947, Smith 1970) – 13 million (Cook 1981) • Densely populated coastal valleys Paleopathology • Intestinal parasites – Coprolite samples • Specific Infectious diseases – Tuberculosis and Blastomycosis • Examination of mummified tissue: major cause of death in coastal and mountain cultures (Allison 1984) – Lobar pneumonia – Bronchpneumonia Possible Bacterial Infections • Human reservoir • Animal reservoir • Food borne • Environment Human Reservoir • Airborne - Pneumonia, Otitis, Meningitis – Streptococcus Pneumoniae – Haemophilus influenza • Skin contact - Osteomyelitis, Endocarditis – Staphylococcus – Streptococcus • Gastrointestinal tract (oro-pharynx – intestine) – Oral streptococcus, Enterococcus, E. coli, Animal Reservoir? • Mammals – Yersinia enterocolitica • Pinnipeds – Brucellosis? – Mycobacterium pinniped? • Camelids – Mycobacterium microti? – Shiga-toxin producing E. coli Food borne - seafood V. Cholera non-01 none-0139 serogroups? E. Coli Enterococcus durans Sepsis - Primary site of infection – Pulmonary – abdominal – urinary tract – neuro-meningeal – dental pathology • Where could we look for bacteria that cause death in the absence of bone lesions? – Mummified tissue (only exceptionally available) – Bone marrow Material and Methods Samples • Bone-marrow samples from 30 adult skeletal remains from the coast, the Azapa Valley and Lluta Valleys - Northern Chile • Morro 1-6 4,500-3,500 B.P. • Azapa-140 800-1000 B.P. • Lluta-54 600-800 B.P. Jamshidi Bone Marrow Biopsy Needle Disposable 100mg Bone Marrow DNA Extraction PCR amplification of mDNA PCR amplification of 16s rDNA (229bp) Greisen et al. 1994 Sequencing Blast search Results • 8 out of 30 samples positive for mDNA • 16s rDNA PCR – samples and controls positive • DNAse I and ultracentrifugation • 3 samples positive for 16s rDNA • Bacillus sp. • Staphylococcus epidermidis • Pseudomona aeruginosa / otitidis Bacillus sp. Query 16 Sbjct 1206 Query 76 Sbjct 1266 Query 136 Sbjct 1326 CTGGGCTACACACGTGCTACAATGGTTGGTACAACGAGCAGCAAGACGTCGAGGTGGAGC ||||||||||||||||||||||||| |||||||| | ||||||| || |||||| |||| CTGGGCTACACACGTGCTACAATGGATGGTACAAAGGGCAGCAAAACCGCGAGGTCGAGC 75 GAATCCCACAAAACCATTCTCAGTTCGGATTGTAGGCTGAAATTCGCCTACATGAAGCAG |||||||| |||||||||||||||||||||||||||||| || ||||||||||||||| | GAATCCCATAAAACCATTCTCAGTTCGGATTGTAGGCTGCAACTCGCCTACATGAAGCCG 135 GAATCACTAGTAATCGCGGATCAGAATGCCGCGGTGAATACGTTCCCGGGC ||||| |||||||||||||||||| |||||||||||||||||||||||||| GAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGC 1265 1325 186 1376 • Bacillus organisms are frequently considered a cultural contaminant in clinical samples. • Although serious infections caused by organisms of the genus Bacillus have been reported in the medical literature. Pseudomona aeruginosa Query 12 Sbjct 1181 Query 72 Sbjct 1240 Query 132 Sbjct 1299 TACGACCAGGGCTACACACGTGCTACAATGGATCGGTACAAAGGGTTGCCAAGCCGCGAG |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| TACGGCCAGGGCTACACACGTGCTACAATGG-TCGGTACAAAGGGTTGCCAAGCCGCGAG 71 GTGGAGCTAATCCCATAAAACCGTATCGTAGTCCGGATCGCAGTCTGCAACTCGCCTGCG ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| GTGGAGCTAATCCCATAAAACCG-ATCGTAGTCCGGATCGCAGTCTGCAACTCGACTGCG 131 TGAAGTCGGAATCGCTAGTAATCGTGAATCAGAATGTCACGGTGAATACGTTCCCGGGC ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGAAGTCGGAATCGCTAGTAATCGTGAATCAGAATGTCACGGTGAATACGTTCCCGGGC 1239 1298 190 1357 Worldwide distribution, present in humid and wet places, today mainly nosocomial infections or people suffering from chronic conditions such us chronic pulmonary disease or chronic otitis, cystic fibrosis Staphylococcus epidermidis Query 13 Sbjct 1185 Query 73 Sbjct 1245 Query 133 Sbjct 1305 TTATGATTTGGGCTACACACGTGCTACAATGGACAATACAAAGGGTAGCGAAACCGCGAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTATGATTTGGGCTACACACGTGCTACAATGGACAATACAAAGGGTAGCGAAACCGCGAG 72 GTCAAGCAAATCCCATAAAGTTGTTCTCAGTTCGGATTGTAGTCTGCAACTCGACTATAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTCAAGCAAATCCCATAAAGTTGTTCTCAGTTCGGATTGTAGTCTGCAACTCGACTATAT 132 GAAGCTGGAATCGCTAGTAATCGTAGATCAGCATGCTACGGTGAATACGTTCCCGGG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GAAGCTGGAATCGCTAGTAATCGTAGATCAGCATGCTACGGTGAATACGTTCCCGGG 1244 1304 189 1361 Normal skin flora, may cause pathology when skin no longer intact. In present day common cause of postsurgery infections Acknowledgements Permission for destructive analysis Museo Arqueológico San Miguel de Azapa, Arica Chile Funding Edward and Olswang Scholarship, UNLV 2003 Patricia Rocchio Memorial Scholarship, UNLV 2004 GPSA grant UNLV 2004 Marjorie Barrick Fellowship, UNLV 2004 Colleagues and Collaborators Dr. Bernardo Arriaza, Universidad de Tarapaca, Chile Dr. Dennis O’Rourke, University of Utah, Salt Lake City Dr. Lois Alexander, University of Nevada, Las Vegas