Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Supplemental Information Single-Cell Analysis Reveals that Noncoding RNAs Contribute to Clonal Heterogeneity
Document related concepts
no text concepts found
Transcript
Molecular Cell, Volume 45 Supplemental Information Single-Cell Analysis Reveals that Noncoding RNAs Contribute to Clonal Heterogeneity by Modulating Transcription Factor Recruitment Stacie L. Bumgarner, Gregor Neuert, Benjamin F. Voight, Anna Symbor-Nagrabska, Paula Grisafi, Alexander van Oudenaarden, and Gerald R. Fink Inventory of Supplemental Data and Supplemental Experimental Procedures Figure S1, related to Figure 1. RNA FISH performed with spectrally distinct fluorescent probes enables simultaneous imaging of FLO11 and ncRNA transcripts in individual cells. Provides full microscopy image fields of yeast cells on which RNA FISH was performed using spectrally distinct fluorescent probes that enable simultaneous imaging of (A) FLO11 and PWR1, (A) FLO11 and ICR1, and (C) ICR1 and PWR1 transcripts in individual cells. Figure S2, related to Figure 3. Interrogations of ICR1 function by manipulating upstream sequences. (A‐E) Explains how upstream DNA sequences that control ICR1 transcription were functionally identified and deleted, to support use of the strain cti6 ΔpICR1 in experiments shown in Figure 3. (F) Relates the results from the single‐cell FISH RNA assays, summarized in Figure 3, to results obtained from bulk‐cell Northern blot assays of the ncRNA ICR1 in relevant strains. Figure S3, related to Figure 5. Comparison of empirically obtained FLO11 RNA distributions and the curve fits obtained through mixture modeling. Provides a larger scale view of the information presented in Figure 5E, and also provides these data plotted on a logarithmic scale for an additional comparative view. Supplemental Experimental Procedures: DNA sequences of probes for RNA FISH experiments. This table provides DNA sequences for the probes used in RNA FISH experiments. Supplemental Experimental Procedures: Saccharomyces cerevisiae strains used in this study. This table provides laboratory strain numbers and genotype information for all Saccharomyces cerevisiae strains used in this study. Figure S1, related to Figure 1. RNA FISH performed with spectrally distinct fluorescent probes enables simultaneous imaging of FLO11 and ncRNA transcripts in individual cells. Scale bars = 2μm (A) Merged fluorescence and DIC microscopy images show FLO11 (TMR; green dots) and PWR1 (Cy5; red dots) transcripts in fields of intact individual WT cells. DAPI staining (blue) shows the locations of nuclei. (B) Merged fluorescence and DIC microscopy images show FLO11 (TMR; green dots) and ICR1 (Cy5; red dots) transcripts in fields of intact individual WT cells. DAPI staining (blue) shows the locations of nuclei. (C) Merged fluorescence and DIC microscopy images show ICR1 (TMR; green dots) and PWR1 (Cy5; red dots) transcripts in fields of intact individual WT cells. DAPI staining (blue) shows the locations of nuclei. Figure S2, related to Figure 3. Interrogations of ICR1 function by manipulating upstream sequences. To identify DNA sequences required in cis to promote ICR1 transcription, we deleted regions upstream of the mapped ICR1 initiation site (Bumgarner et al., 2009) using a loxP‐kanMX‐loxP gene disruption cassette, followed by plasmid‐based expression of the Cre recombinase to excise the marker and leave behind a single loxP site (Güldener et al., 1996). It is not possible to perform analogous experiments to interrogate PWR1 without disrupting other known regulatory regions in the FLO11 promoter (Rupp et al., 1999; Bumgarner et al., 2009). (A) Diagram of deleted regions proximal to the 5′ end of ICR1. Deletion Δ250‐pICR1 removes 250 bp and disrupts the 5′ end of gene MRS1, required for mitochondrial function. (B) All proximal deletions but Δ250‐pICR1 restore the Flo11‐dependent crinkly colony morphology (4 days on YPD‐agar at 30°C). Only strain Δ250‐pICR1 displays a petite phenotype, suggesting that little of the intergenic region 5′ of MRS1 is required for its promotion. (C) FLO11 mRNA measured by qPCR in haploid WT, cti6, cti6 Δ50‐pICR1, and cti6 Δ100‐pICR strains, normalized to ACT1 and presented ± SD. The pICR1 deletions recover FLO11 transcription in the cti6 mutant. (D) Diagram of deleted regions distal to the 5′ end of ICR1. (E) Distal deletions of 150 bp or greater recover Flo11‐ dependent crinkly colony morphology (4 days on YPD‐agar at 30°C). (F) ICR1 transcript levels assayed in haploids by northern blot using a 32P‐labeled strand‐specific RNA probe (Bumgarner et al., 2009). Lane 1: WT; lane 2: cti6; lane 3: sfl1; lane 4: WT containing transcriptional terminator T1 (Bumgarner et al., 2009) inserted 3041 bp upstream of the FLO11 ATG with no loss of endogenous DNA sequence; lane 5: cti6 containing T1; lane 6: sfl1 containing T1; lane 7: hda1; lane 8: flo8. Figure S3, related to Figure 5. Comparison of empirically obtained FLO11 RNA distributions and the curve fits obtained through mixture modeling. Panels labeled “DATA” show the experimentally measured FLO11 RNA distributions for WT and mutant cells imaged using RNA FISH. Panels labeled “FIT” show the predictions for FLO11 RNA distributions made using the mixture modeling described in the Materials and Methods section and in the legend for Figure 5. Upper panels are plotted on a linear scale, whereas lower panels are plotted on a logarithmic scale. Supplemental Experimental Procedures: DNA sequences of probes for RNA FISH experiments. FLO11 Probes Probe ID FLO11‐1 FLO11‐2 FLO11‐3 FLO11‐4 FLO11‐5 FLO11‐6 FLO11‐7 FLO11‐8 FLO11‐9 FLO11‐10 FLO11‐11 FLO11‐12 FLO11‐13 FLO11‐14 FLO11‐15 FLO11‐16 FLO11‐17 FLO11‐18 FLO11‐19 FLO11‐20 FLO11‐21 FLO11‐22 FLO11‐23 FLO11‐24 FLO11‐25 FLO11‐26 FLO11‐27 FLO11‐28 FLO11‐29 FLO11‐30 FLO11‐31 FLO11‐32 FLO11‐33 FLO11‐34 FLO11‐35 FLO11‐36 FLO11‐37 FLO11‐38 FLO11‐39 FLO11‐40 FLO11‐41 FLO11‐42 FLO11‐43 FLO11‐44 FLO11‐45 FLO11‐46 FLO11‐47 FLO11‐48 Sequence (5' to 3') cgaatggaaatggtctttgc ggaaaacccaaagctgagta atcctctaggaactagtgca ttacagctagttccttcgga tgggacagccattaacgata ggttcatgtgccaattgaag cggaagtcacatccaaagta gtgttgtcttgaacccaaga gaccagtgacaccaatgatt cgtatagttggacggtatct ccaatcggtattttcgtcgt attttcgtcgcaacgggaaa gtgaaatcagttgggttgtc ggcatagacttcaaaagtgg gacagctgttgacatcttgt ttggaagttaggcatccaca cactaccttgcaaatactcg caagagcatgcatattcagc gttgtcacaaccagtagaca gagagtagccttgattgtca tagaagcctgggaaatctgt ggagcacaattgttgtcaca tagtagagctggatggagtt tactggagcagaagagcttt gtagtagagcttgatggagt tagtagagctggatggagtt tttcagtggtagagctggat ttcagtggtagagctggtta tagtagagctggatggagtt tttcagtggtagagctggat ttcagtggtagagctggtta ttcagtggtagagctggtta ttcagtggtagagctggtta tagtagagctggatggagtt tttcagtggtagagctggat ttcagtggtagagctggtta ttcagtggtagagctggtta ttcagtggtagagctggtta tagtagagctgcatggagtt tagtagagctggatggagtt tttcagtggtagagctggtt ttgatggagttggtactgga gcagaagagctttcagtagt tagtagagctggatggagtt tactggagcagaagagcttt aagagctttcagtggtagag tagtagagctggatggagtt tttcagtggtagagctggat PWR1 Probes Probe ID PWR1‐1 PWR1‐2 PWR1‐3 PWR1‐4 PWR1‐5 PWR1‐6 PWR1‐7 PWR1‐8 PWR1‐9 PWR1‐10 PWR1‐11 PWR1‐12 PWR1‐13 PWR1‐14 PWR1‐15 PWR1‐16 PWR1‐17 PWR1‐18 PWR1‐19 PWR1‐20 PWR1‐21 PWR1‐22 PWR1‐23 PWR1‐24 PWR1‐25 PWR1‐26 PWR1‐27 PWR1‐28 PWR1‐29 PWR1‐30 PWR1‐31 PWR1‐32 PWR1‐33 PWR1‐34 PWR1‐35 PWR1‐36 PWR1‐37 PWR1‐38 PWR1‐39 PWR1‐40 PWR1‐41 PWR1‐42 PWR1‐43 PWR1‐44 PWR1‐45 PWR1‐46 PWR1‐47 PWR1‐48 Sequence (5' to 3') ttatactcaaaatgaagctc ggccagcgacaaatataaac tacttacagttgagcatctc tttatccacacatccgatgt tgcactcgttttccatgttc gctgaaaagtccatctatcg gacacaatttcgccgtttac tgaaaagctcattcacaact cacttcggtacgcaaatgaa cgtactttaggtcgtcagtt gaacttgctttattccgtat ggtcaaactgcagagagtat atgaacagcgccaagtagca cacaaatttacggctaattg cggagattatcttgggatct gataacctctttggaagcaa gctagaaaatgccaactatt tatgccttatagcaaccaag cttcctctcactgcacttca gtctctttccgtgagttccc cccgttgacaaaagtataag aactagcgaattttggaaca gaccgctgctaataaaacgt cagcggggttttggctcaat gatcagattgtgtcgcaacg cgctgcaatgattatgtggt ggctgctagaagttaaaaag ccgccaactaaatctgaata tttactgctgtaaggagtcg cgtttgttactaattcgaat cctatctccacataccaatc tgcttctgctcagtcttcgt gaatacaattacttagcgtg attcttcaggctcccaattc gaaagatgctgagcttgatc gacaaattctcgaagacgct aactttcaaccttccgctca ggggagatcatgcaaaaaaa ctttacagatgacatctggg cgtcttcaattgtcctacta cactgaatcaattgaaagac gaatgatcttaagaaaaggc ctgatctgtgttttgacaag gtcgagacaagaataatatg ttcgacgaaattacggccta acaatgacatagatcatttt atagctggaattgtagatat aattctaacgtgattatcgt ICR1 Probes Probe ID ICR1‐1 ICR1‐2 ICR1‐3 ICR1‐4 ICR1‐5 ICR1‐6 ICR1‐7 ICR1‐8 ICR1‐9 ICR1‐10 ICR1‐11 ICR1‐12 ICR1‐13 ICR1‐14 ICR1‐15 ICR1‐16 ICR1‐17 ICR1‐18 ICR1‐19 ICR1‐20 ICR1‐21 ICR1‐22 ICR1‐23 ICR1‐24 ICR1‐25 ICR1‐26 ICR1‐27 ICR1‐28 ICR1‐29 ICR1‐30 ICR1‐31 ICR1‐32 ICR1‐33 ICR1‐34 ICR1‐35 ICR1‐36 ICR1‐37 ICR1‐38 ICR1‐39 ICR1‐40 ICR1‐41 ICR1‐42 ICR1‐43 ICR1‐44 ICR1‐45 ICR1‐46 ICR1‐47 ICR1‐48 Sequence (5' to 3') gcacacagatgaaaaggtgt ggggacaaaaaggactagta cggtatgaaatgagggatac acgtagttggaaccccaaaa ggggttgttcttaccgtaaa agtattccgcactaaccgat tctgtccaccttaggtgtat cttgtaagggagcaaagatg atctggagatgggttgatac tgttctacagaaatgctggg ggtgagaaccatcaccaatt atgacctcaatgcatgcaag cagcagctcagataaggaaa atgaaacaatgtcccgtctg ttcgtgttagggtccgtttt ggaaataccgattagcgcat ggactgaaaaagtagcaggt ggctacgaatgaattttggg ggaactgagtctaagttgac attcataataccccgtcctg atagaacaaatctcgcccgt gtggtacaaaactccatacc cacacaatccggtattccta agctgtgagaacatactctg caggaaaagatcacgaggaa aagtttaatttgcctgccgg aaagcctttttttcctgccg ccgagaaactgaaaggcaaa ggcacacccaaaaaggattt cgacattctcttgcgacatt ataacggccgaaactctttg aaaaggacccacttcgatag attttgcagtgatcgctagc taactcgtaccagtaaagcc ccccaaagaaaaggatgaca ccactgctgcaacaaagaaa gagcaatcagcagttctttg tctaaacgctcggactgatt ccgcaaagttaatttctgcc gtttgtgcaatgcctgacaa ccagtacgaccgttaaaaag attacggaatcccaaggcat tgagttgtgcccgtattgtt agttctgtccgtgaagatag ttaatcacaccaccgatagg aaatccattccaagctctgc gttggacaatgtcctcaaag ctattctggaacaggcactt Supplemental Experimental Procedures: Saccharomyces cerevisiae strains used in this study. Strain Genotype Reference/Source SBY170 MATx sfl1::KanR ura3-52 leu2::hisG his3::hisG trp1::hisG SBY591 MATx cti6::Tn3::LEU2 ura3-52 leu2::hisG his3::hisG trp1::hisG 5 SBY1160 MATx flo8::KanR ura3-52 leu2::hisG trp1::hisG his3::hisG 5 SBY1182 MATx PFLO11(-3041)::HIS3::TermHIS3::loxP::KanR::loxP cti6::Tn3::LEU2 ura3-52 leu2::hisG trp1::hisG his3::hisG 5 SBY1270 MATx FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG This study R 5 SBY1324 MATx sfl1::Kan SBY1329 MATx cti6::Tn3::LEU2 FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG 5 SBY1523 MATx cti6::Tn3::LEU2 ura3-52 leu2::hisG his3::hisG trp1::hisG Δ100bpPICR1 This study R FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 SBY1615 MATx sfl1::Kan SBY1618 MATx sfl1::KanR ura3-52 leu2::hisG trp1::hisG his3::hisG PTEF::ICR1 R ura3-52 leu2::hisG trp1::hisG his3::hisG PMET25::ICR1 5 This study This study SBY1624 MATx sfl1::Kan This study SBY1627 MATx cti6::Tn3::LEU2 ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study SBY1630 MATx cti6::Tn3::LEU2 ura3-52 leu2::hisG trp1::hisG his3::hisG PTEF::ICR1 This study SBY1636 MATx cti6::Tn3::LEU2 ura3-52 leu2::hisG his3::hisG trp1::hisG PMET25::ICR1 This study SBY1639 MATx ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study SBY1642 MATx ura3-52 leu2::hisG trp1::hisG his3::hisG PTEF::ICR1 This study SBY1648 MATx ura3-52 leu2::hisG trp1::hisG his3::hisG PMET25::ICR1 This study SBY1703 MATx cti6::Tn3::LEU2 FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PMET25::ICR1 This study SBY1705 MATx cti6::Tn3::LEU2 FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG Δ100bpPICR1 This study SBY1715 MATx cti6::Tn3::LEU2 FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PFLO11(-3041)::HIS3::TermHIS3::loxP::KanR::loxP This study SBY1717 MATx cti6::Tn3::LEU2 FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study SBY1720 MATx FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PMET25::ICR1 This study SBY1723 MATx FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study R SBY1726 MATx sfl1::Kan PMET25::ICR1 FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG This study SBY1729 MATx sfl1::KanR FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study SBY1732 MATx SFL1::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG This study SBY1734 MATx cti6::Tn3::LEU2 SFL1::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG This study SBY1737 MATx cti6::Tn3::LEU2 SFL1::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PMET25::ICR1 This study SBY1745 MATx cti6::Tn3::LEU2 SFL1::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study SBY1748 MATx SFL1::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PMET25::ICR1 This study SBY1750 MATx SFL1::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG PGPD1::ICR1 This study 10560-6B MATx ura3-52 leu2::hisG trp1::hisG his3::hisG Fink Laboratory Collection yCW91 MATa ΔPFLO11::KanR ura3-52 leu2::hisG trp1::hisG NUP49::GFP::HIS3MX6 Chia Wu yCW180 MATx FLO8::9MYC::TRP1 ura3-52 leu2::hisG trp1::hisG his3::hisG Chia Wu
Related documents