Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Crossing Divergent Boundaries Adam G. Marsh University of Delaware Environmental Bioinformatics CCGG CGTG GAAG 1. Drill Hole 2. Go Swimming Low Diversity, but high biomass marine invertebrate communities Photo Norbert Wu Food Limitation Photo Norbert Wu ATAT GCCT CATA Photo Photo courtesy Rob robbins Rob Robbins GGCA TCCT CATC Photo courtesy Norbert Wu Photo Norbert Wu Synthetic Biology Computational Platform Directed Evolution Of Genes And Proteins Population-scale evolution in the Cloud • Competition for CPU resources among 1000 genes/proteins drives evolution design efficiency Evolution with Structure Selection Evolution of Color AGCTTCGCGGCTATAGGCTAGGCTATAGGCGCGCG GCTAGGCTAGTGCTGTAGCTGCTGCTGATCCGGGC TATCATATGCTGCTATTATATATACGCCATCGTAGCTA GCTAGCGGCTAGCTATCATTACGGCGGCATTATATA GCCGCGCTATATGCGTAGCTAGCGGCGTAGTCGAT CGTAGCTGGGCTATAGCGCGTAGCTATAGGCTAGCT AGCTGGCGGCGCGCGCGACTATATATGCTAGCTAG CTAGCTGTCGATGTAGCGACTGATCGTAGCTAGCTG ATCGTCGTGCGATGCTAGTC Is this a GENE? Is this ART? Directed Evolution > Pixel color is coded by three channels: R, G, B Babel Color PEPCO: Art in the Air