Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Introductory Genetics http://www.stats.gla.ac.uk/~paulj/intro_genetics.ppt How genes work What is a gene? • A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein) DNA mRNA Protein …GAATTCTAATCTCCCTCTC AACCCTACAGTCACCCATTT GGTATATTAAAGATGTGTTG TCTACTGTCTAGTATCC… Genes are located in the cell nucleus on chromosomes Karyotype Down syndrome karyotype (trisomy 21) DNA (deoxyribonucleic acid) mRNA Protein Transcription movie Translation Translation Translation Translation movie Gene expression movie Summary • A gene is a length of DNA that contains instructions for making a specific protein • Genes are arranged along 23 pairs of chromosomes in the cell nucleus • Genes work by specifying the amino acid sequence of a protein Mendel’s laws Genetic knowledge used for 1000s of years: agriculture Patterns of disease inheritance known for 1000s of years, e.g. haemophilia Mendel deduced the underlying principles of genetics from these patterns 1. Segregation 2. Dominance 3. Independent assortment Mendel’s experiments Mendel’s data Mendel’s law of segregation • • • A normal (somatic) cell has two variants (alleles) for a Mendelian trait. A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles. E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly. Sperm B Eggs b B BB Bb b Bb bb Mendel’s law of dominance • If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Sperm B Eggs b B BB Bb b Bb bb Mendel’s law of dominance • If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Sperm B Eggs b B BB Bb b Bb bb Terminology… • Haploid: containing one copy of each chromosome (n=23) Sperm B Eggs b B BB Bb b Bb bb • Diploid: containing two copies of each chromosome (2n=46) Terminology… • Genotype: the states of the two alleles at one or more locus associated with a trait • Phenotype: the state of the observable trait Genotype Phenotype BB (homozygous) Brown eyes Bb (heterozygous) Brown eyes bb (homozygous) Blue eyes Mendel’s law of independent assortment • Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus S/s SY 25% Y/y Sy sY sy 25% 25% 25% Mendel’s law of independent assortment Gametophytes (gameteproducing cells) S Y s y Segregation Gametes S Y s y A b Recombinants a B Mendel’s law of independent assortment Gametophytes (gameteproducing cells) S Y s y Recombination Segregation Gametes S Y s y S y Recombinants s Y Human eye colour • Simplified view of eye colour inheritance: biallelic Mendelian trait – Brown dominant: BB, Bb – Blue recessive: bb Sperm B Eggs b B BB Bb b Bb bb Human eye colour ? Human eye colour B? B? B? bb bb B? B? ? Human eye colour Bb B? Bb bb bb B? Bb ? Human eye colour Bb Bb B? Bb ? Human eye colour Bb Bb P(BB)=1/3 P(Bb)=2/3 ? Bb Human eye colour Bb Bb P(BB)=1/3 P(Bb)=2/3 P(b)=2/3x1/2=1/3 Bb P(b)=1/2 ? Human eye colour Bb Bb P(BB)=1/3 P(Bb)=2/3 P(b)=2/3x1/2=1/3 Bb P(b)=1/2 ? P(bb)=1/3x1/2=1/6 Non-Mendelian inheritance: Haemophilia • Haemophilia A • Males with a mutant gene are affected • Females with one mutant gene are unaffected carriers Non-Mendelian inheritance: additive traits Brown eye colour is dominant Dominant vs additive inheritance Trait value 100% Dominant 50% Additive 0% 0 1 Number trait alleles inherited 2 Non-Mendelian inheritance: additive traits Snapdragon red colour is additive Dominant vs additive inheritance Trait value 100% Dominant 50% Additive 0% 0 1 Number trait alleles inherited 2 Non-Mendelian inheritance: polygenic traits Distribution of trait measures for single gene additive trait 0.6 0.5 Frequency 0.4 0.3 0.2 0.1 0 0 1 Trait value 2 Non-Mendelian inheritance: polygenic traits For example, height