Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria Cloke CMGS Spring Conference April 2010 Overview • High density dystrophin gene aCGH platform • Validation • Application to specialised testing – Complex mutations – Therapeutic exon skipping trials Principle of aCGH Cy3 labelled patient DNA Cy5 labelled control DNA High density dystrophin array • 4x44K format array designed by Madhuri Hegde’s group at Emory University • 16,248 unique probes for the dystrophin gene region plus their reverse compliments 60bp 100bp 10bp Exons Introns High density aCGH Validation Stage 1: Normal control vs Normal control +1 0 -1 Dystrophin gene High density aCGH Validation Stage 2: Known exonic deletions and duplications Hemizygous male deletion 32.58743Mb 32.719041Mb 32.850653Mb 32.982265Mb +7 +6 +5 +4 +3 +2 +1 0 -1 -2 -3 -4 -5 -6 -7 Dystrophin exons 98 7 6 5 4 3 Deletion dystrophin exons 3-7 2 CNV in intron 2 High density aCGH Validation Stage 2: Known exonic deletions and duplications Heterozygous female deletions and duplications 31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb +2 +1 0 -1 -2 Dystrophin exons 48 31.645784Mb 47 46 45 44 31.71414Mb 31.78250Mb +2 +1 0 -1 Heterozygous deletion dystrophin exon 45 43 42 31.85086Mb 31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb High density aCGH Validation +2 +1 0 Stage 2: Known exonic deletions and duplications -1 Heterozygous female deletions and duplications -2 Dystrophin exons 48 47 46 31.77632Mb 31.645784Mb 45 44 31.936032Mb 31.71414Mb 43 32.095744Mb 31.78250Mb 42 32.255457Mb 31.85086Mb +2 +2 +1 +1 0 0 -1 -1 -2 -2 Dystrophin exons 48 Dystrophin exons 52 31.645784Mb 47 46 45 51 31.71414Mb 50 49 44 31.78250Mb +2 +1 0 -1 Heterozygous duplication dystrophin exons 49-50 48 43 42 31.85086Mb High density aCGH Validation Stage 3: Inversion samples Inversion Exon 45 c.6438+96064_6614+1540 31.827229Mb 31.935944Mb 32. 044659Mb 32.153374Mb +7 +6 +5 +4 +3 +2 +1 0 -1 -2 -3 -4 -5 -6 -7 Dystrophin exons 47 46 45 Deletions in dystrophin introns 44 and 45 44 High density aCGH Validation Stage 3: Inversion samples Inversion Exon 53 –> 79 Dystrophin IL1RAPL1 +7 +6 +5 +4 +3 +2 +1 0 -1 -2 -3 -4 -5 -6 -7 3’ deletion including 11 genes Deletion dystrophin Exon 52 High density aCGH Validation Stage 3: Inversion samples Inversion Ex62 c.9164-10300_c.9224+12600 31.183465Mb 31.217965Mb 31.252466Mb 31.286967Mb +7 +6 +5 +4 +3 +2 +1 0 -1 -2 -3 -4 -5 -6 -7 Dystrophin exons 63 62 Intron 62 deletion 61 Applications of high density dystrophin aCGH Finding mutations in MLPA and point mutation negative patients Dystrophin Exon 44 Applications of dystrophin high density aCGH Informing a exon skipping trial targeting duplications • Difficulties in exon skipping for duplications —Orientation —Structure —Position of breakpoints • Dystrophin aCGH study of 25 duplications —Structure of duplications —Rapid breakpoint mapping —Understanding how dystrophin duplications arise Duplication aCGH results 31.692239Mb 31.741906Mb 31.698543Mb 32.04018Mb 31.704848Mb 32.33846Mb 31.711153Mb 32.63674Mb +2+2 +1+1 00 -1 -1 -2 -2 Dystrophinexons exons Dystrophin 50 - 46 45 51 44 - 17 Duplication of of dystrophin dystrophin exons exon 51 Duplication 17-45 16 - 8 5 4 Duplication breakpoint mapping 45 Exon 5 651 5 5Exon 651 6 Breakpoint sequencing results • Ease of breakpoint mapping – 15/25 breakpoints (60%) needed just one round of PCR and sequencing • 20/25 (80%) central breakpoints amplified and sequenced Tandem orientation Breakpoint sequencing results 32775529 atgggaggcatgtatactatagaacagaaattttagtattctactcagaagc gtattcagaaacttaaatagccatataatacatattttggagcatgtcagaa Intron 1 <<<<<<<< ||||||||||||||||||||||||||| || | || | ||| | Microhomology atgggaggcatgtatactatagaacagggatctaggttgtgtgctccttatg |||||||||||||||||||||||||||| | || ||| | Duplication sequence 1-4 <<<<<<<< nucleotides |gtattcagaaacttaaatagccatataagaattaactgtttgcacaatctac | | ||||||||||||||||||||||||||| || | | || |||||||||||||||||||||||||||| 32850655 aaccctattgtgacctgcgcatgcgagggatctaggttgtgtgctccttatg 14/20 (70%) Intron 4 tctaacacatgcaattttaagaggataagaattaactgtttgcacaatctac Intron 30 32323093 catgaagatgataaatacttatgttaatatgattaggagatggaattaatta Small insertion <<<<<<<< |||||||||||||||||||||||| | | | | | 1-4 nucleotides catgaagatgataaatacttatgtattttaaaaaccggctttgttaagcaat Duplication sequence 4/20 (20%) <<<<<<<< | || | |||||||||||||||||||||||| 32462155 gtattttgttatgtaagtgctagctgactaaaaaccggctttgttaagcaat Intron 17 Clean breakpoint 2/20 (10%) attaaggatctgtgtgagattctgctggatggtgtagattttcttgaaaa Intron 7 ||||||||||||||||||||||||| | | | | || attaaggatctgtgtgagattctgcataaattcagcttatgttaaggaag Duplication sequence | | || ||||||||||||||||||||||||| Intron 2 ggcttttgtgttacattgaacagagataaattcagcttatgttaaggaag Duplication study Comparison with RNA results • Genomic DNA: Duplication Exons 3-37 • Breakpoint close to exon 37 Exon 36 Exon 37 Exon 3 13bp • RNA level: Duplication Exons 3-36 Exon 1-2 Exon 3-35 Exon 4-37 Exon 38-> Duplication study Understanding the mechanism of duplications • Non-allelic homologous recombination (NAHR) – Lack of homology between breakpoints • 34% - 48% (mean 42%) sequence identity • No shared repetitive element homology • Non-homologous recombination (NHR) – Simple tandem structure – Non-recurrent breakpoints – Microhomology and insertions E.g. DNA repair mechanism such as non-homologous endjoining (NHEJ) Replication based mechanism such as fork stalling and template switching (FoSTeS) Conclusions • Array CGH vs MLPA High Density aCGH MLPA Consumable Cost £178 £40 Information provided 44K probes Limited to ~1 probe/exon Reliability Multiple 60nucleotide probes/aberration Risk of false positives Flexibility Custom design Limited kit availability • Array CGH as a specialist test – Solving difficult cases – Rapid breakpoint mapping e.g. to Inform therapeutic strategies Acknowledgements • • • • Dr Steve Abbs Dr Michael Yau Jo McCauley Dr Joo Wook Ahn • Prof Francesco Muntoni • Jihee Kim • Dr Madhuri Hegde • Ephrem Chin