Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
GENETICS OF DEAFNESS CONGENITAL DEAFNESS ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50% environmental 50 % inherited 70% Nonsyndromic ~%22 AD ~%77 AR 29 66 18 Known Genes ~%1 X-linked 30% Syndromic <%1 Mitochondrial •Ototoxic drugs •Acustic trauma •Infections •Usher •Alport •Pendred •Norrie •Waardenburg •Branchio-Oto-Renal •Jervell and Lange-Nielsen WHY IS IT IMPORTANT TO ELUCIDATE GENETIC DEFECTS UNDERLYING HEREDITARY DISORDERS? Diagnosis To answer the question on heredity of their disease or the disease in the family Adequate mutation based genetic counseling Early diagnoses for family members Insight in genes/proteins essential for development and function of the inner ear Handles for therapy DAILY PRACTICE I:2 I:1 III:2 III:1 IV:1 IV:2 III:3 III:4 III:5 III:6 IV:3 II:4 II:3 II:2 II:1 III:7 III:8 III:9 III:10 III:11 III:12 Threshold (dB) AUDIOGRAMS -10 0 Cros W02011 -10 0 20 20 40 40 20 30 40 50 60 60 80 60 80 100 100 120 .25 120 .25 .5 1 2 4 Frequency 8 kHz Cros Tamagawa 70 .5 1 2 4 8 Threshold (dB) ARTA -10 0 Cros W02011 -10 0 20 20 40 40 20 30 40 50 60 60 80 Cros Tamagawa -10 0 20 0 10 20 30 40 50 60 60 80 70 40 20 60 30 40 50 80 60 100 100 100 120 .25 120 .25 120 .25 .5 1 2 4 Frequency 8 kHz Cros Street .5 1 2 4 8 kHz .5 1 2 4 8 kHz Myosin VIIa Asn458Ile THE INNER EAR LESSONS FROM DEAFNESS GENES Kazmierczak et al 2007 IDENTIFICATION OF DISEASE GENES • Familystudies – good clinical characterization • Identification of the chromosomal location of the genetic defect - Linkage analysis – homozygosity mapping • Identification of the mutated gene - Which genes are in the linkage interval – genome browsers? - Which of those genes are good candidates? - databases * Expression pattern * Function of the gene * Animal models * Selection of genes for mutation analysis - Mutation analysis - Interpretation of sequence variants • Alternative: Next Generation sequencing TURKISH FAMILIES - CONSANGUINITY - Homozygous mutations - Homozygosity mapping – linkage analysis mutation NM NM NM x NM NM x MM HOMOZYGOSITY MAPPING Single Nucleotide Polymorphisms - SNPs Person A: Person B: …cctcctagggttgcaaagcctccttggctatg… …cctcctagggttgcatagcctccttggctatg… …cctcctagggttgcatagcctccttggctatg… …cctcctagggttgcatagcctccttggctatg… ~ 500,000 SNPs G T A C C C T G A T A A A T T G C T T G G C A G A T A A A T T A FAMILY TR57 Linkage interval: 11q13.2–q13.4, ~ 59 known genes , 18 hypothetical gene DFNB63 LOCUS 15.5 15.4 DFNA32 12 D11S987 D11S1337 D11S4113 MYO7A DFNB63 DFNB63 D11S4136 D11S4139 FGF3 D11S1314 D11S916 D11S2371 D11S1291 DFNB24 23.3 24.1 24.2 24.3 25 26 known or predicted genes DFNB51 11.2 11.12 11.11 11 12.1 12.2 12.3 13.1 13.2 13.3 13.4 13.5 14.1 14.2 14.3 21 22.1 22.2 22.3 23.1 23.2 Fam Fam FT2 PKDF702 USH1C 14.3 14.2 14.1 13 Fam FT1A-G TECTA DFNB20 D11S4179 ~5.29 Mb 15.3 15.2 15.1 Fam TR57 1.03 Mb LRTOMT CHARACTERISATION Genome browser build 36.1 LRTOMT1 LRTOMT2 EFFECT OF MUTATIONS 3’ UTR A215A R81Q W105R 3’ UTR G163VfsX4 (c.358+4G>A) A29SfsX54 (c.358+4G>A) E110K Catechol-O-methyltransferase domein MOLECULAR MODELING EFFECT OF MISSENSE MUTATIONS LRTOMT IN THE MOUSE INNER EAR SUMMARY Applied bioinformatics is essential for several steps in disease gene identification and analyses The structure and function of the human genome and genes is not completely characterized yet LRTOMT is the causative gene for DFNB63. The precise effect of the mutations on inner ear function needs to be elucidated.