Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Chapter 13 An Introduction to Cloning and Recombinant DNA Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique • Used to determine the structure of a gene or DNA sequence of interest • May be used to analyze different alleles, related genes, and gene evolution Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique • Steps – Isolate genomic DNA – Cut DNA with restriction enzymes – Separate DNA by size using electrophoresis – Transfer DNA to a membrane – Probe with sequence of interest that is radioactively labeled – Visualize with X-rays Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning The Southern Blot Technique Fig. 13.19 Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Credit: © Inga Spence/Visuals Unlimited Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning 212643 DNA Sequencing Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC + primer CATGT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G GTACACTTACGTACTCCTCAACGGATC CATGTGAATGCATGAGGAGTTGCGTAG Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning OO- -P = O O 5’ end 5’ DNA polynucleotide chain Base CH2 O H 3’ H H H OO- -P = O O 5’ Base O CH2 3’ H H H H 3’ end Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning OH OO- -P = O O 5’ end 5’ DNA polynucleotide chain Base CH2 O 3’ H H H H OO- -P = O O 5’ chain termination Base O CH2 3’ H H H dideoxy base H 3’ end Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning H DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTG Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGA Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAA Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAAT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCAT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCATGAGGAGT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G +T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCATGAGGAGT Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + DNA pol + DNA pol + DNA pol + A, C, T, G + A, C, T, G + A, C, T, G + A, C, T, G +C +G +A +T Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C A G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C A A G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C T A A G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C A G T A C G T A A G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGTGAATGCATGAGGAGTTGCCTAG Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing T A G C A G T A C G T A A G T C A T G C A T T C Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Improvements in Sanger Sequencing • Four-color fluorescent dyes • Use of scanners to read laser-induced fluorescence as products run off • Improvements in sequencing reaction enzymes • Replacement of slab gel electrophoresis with capillary gel electrophoresis Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + DNA pol + DNA pol + DNA pol + A, C, T, G + A, C, T, G + A, C, T, G + A, C, T, G +C +G +A +T Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + DNA pol + DNA pol + DNA pol + A, C, T, G + A, C, T, G + A, C, T, G + A, C, T, G +C +G +A +T Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + A, C, T, G Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Automated DNA Sequencing Fig. 13.20 Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Automated Sequencer Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Sequencing is just the start… Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays Goal: To get at complete expression profile in a cell/tissue at given time Step 1: Make or purchase microarray Need gene sequences and sequenced genomes PCR up real and predicted ORFs Spot on glass slide/chip Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays Step 2: Isolate and label RNA Isolate RNA from 2 different kinds of cells to be compared Cell 1 - RNA labeled with red fluorescent tag Cell 2 - RNA labeled with green fluorescent tag Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays Step 3: Hybridize RNA to Microarray Hybridize chip with red and green RNA Use scanner to examine fluorescence Red - RNA present in Cell 1 but not Cell 2 Green - RNA present in Cell 2 but not in Cell 1 Yellow - RNA present in both Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Microarray Results Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Stem cells Prenatal genetic testing Cloning of animals/humans Brower Gorenkoff Kwak Cho Damiano Cheis Bondurant Lapides Simon Vigneron Prada Siegel Saunders Magee Shriner-Cahn Chatterjee Lawrence Olson Genetically modified plants/animals Powers Rosenblum Le Sotomil Coyle Kropp Too much technology? Spiwak Davidson Fei Grossman Marwell Roth Behavioral genes Seplowitz Rich Lenard Collins Dionne Rudberg Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning