Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
A ChIP efficiency (%input) 0.15 H2AX 0.1 0.05 0 4OHT Primers AsiSI site B mock - + Prox - + Dist chr22: 19180307 - + - + Prox - + - + - + Dist Prox Prox chr21: 21292316 Chr6 chr6: chr6: 90404606 135861040 Chr1 Gene density 0.4 Log2 0 (H2AX/input) -0.4 0.4 Log2 (mock/input) 0 -0.4 C Chr6 p11.2 Chr1 q32.1 0.3 0.2 Log2(H2AX/input) Log2(H2AX/input) 0.3 0.2 0.1 0 -0.1 0.1 0 -0.1 -0.2 -0.2 53 MB 55 MB 57 MB 200 MB 202 MB 204 MB 206MB Figure S1: H2AX distribution on human chromosomes. A, ChIP was performed on AsiSI-ER-U20S cells after 4OHT treatment using an anti-H2AX antibody (black bars) or no antibody (mock, white bars), followed by real time Q-PCR amplification with the indicated primers to assess H2AX distribution. A representative experiment is shown. B, Global H2AX (black, top) and mock (dark grey, bottom) profiles are shown across chromosomes 1 and 6. Enrichment is expressed as log2 relative to the input, and smoothed using a sliding window of 500 probes. A representative experiment is shown. The low enrichment of H2AX observed by ChIP-chip, is not due to low ChIP efficiency (since we could detect high levels of H2AX when analysing H2AX ChIP by Q-PCR) but reflects a general incorporation of H2AX along chromosome arms (as ChIP-chip experiments do not assess the absolute level of a protein on chromatin, but rather its change in distribution along the genome). Note however that, we can observe a increased presence of H2AX in regions harboring high gene density (light grey, upper panel). C, Detailed view of H2AX distribution across two genomic regions. The pericentromeric region of chr6p (left panel) is depleted in H2AX, whereas the q32.1 cytogenetic band of the chr1 (right panel) is enriched. A B 0.3 Log2(gH2AX Abcam/input) Log2(gH2AX Upstate /input) 0.35 0.25 0.15 0.05 -8 -4 0 4 0.2 0.1 0 8 -8 Distance from the AsiSI site (kb) C -4 0 4 8 Distance from the AsiSI site (kb) Log2(gH2AX Epitomics /input) 0.4 0.3 0.2 0.1 0 -8 -4 0 4 8 Distance from the AsiSI site (kb) Figure S2: gH2AX is depleted around AsiSI sites. A. The log2 gH2AX/input signal (average of two gH2AX ChIP-chips after 4OHT treatment, performed with the Upstate 07-164 gH2AX antibody) was calculated using a 1000 bp sliding window and is shown over a 20kb window centered on all AsiSI sites contained in gH2AX domains. B. Same as in A except that the log2 gH2AX /input was obtained using a different gH2AX antibody (Abcam ab2893). C. Same as in A except that the log2 gH2AX /input was obtained using a third gH2AX antibody (Epitomics 2212-1). Chr 1_6 Chr 6_4 Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.8 0.6 Log2 Log2 0.6 0.4 0.4 0.2 0.2 88 500 000 0.8 89 500 000 Chr 1_8 90 500 000 Log2(gH2AX/H2AX) Log2(gH2AX/input) 30 000 000 0.8 0.4 32 000 000 Chr 6_5 Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.4 0.2 0.2 37 000 000 108 500 000 109 500 000 Chr 1_12 38 000 000 39 000 000 110 500 000 Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.8 0.6 Chr 6_7 Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.6 Log2 Log2 31 000 000 0.6 Log2 Log2 0.6 0.8 Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.8 0.4 0.2 0.4 0.2 228 000 000 229 000 000 230 000 000 89 500 000 90 500 000 91 500 000 Figure S3: The gH2AX profile is very similar when analyzed over H2AX or input. Detailed views around selected AsiSI sites (indicated by arrows) of the gH2AX enrichment over H2AX (in light red) or input (in dark red), expressed as log2 and smoothed using a 500 probe sliding window. ChIP-chip analysis was performed using chromatin from AsiSI-ER-U20S cells treated with 4OHT. A representative experiment (performed with the Upstate 07-164 gH2AX antibody) is shown. Note the strong similarity between the two profiles. Abcam ab2893 Upstate 07-164 Epitomics 2212-1 Log2(gH2AX/input) Chr 1_6 Abcam ab2893 Upstate 07-164 1 0.6 0.2 89 000 000 90 000 000 91 000 000 Chr 1_8 Log2(gH2AX/input) Chr 1_8 1 0.6 0.2 109 000 000 110 000 000 111 000 000 Figure S4: The gH2AX profile is consistent between three gH2AX antibodies. Detailed views, around selected AsiSI sites (indicated by arrows), of the gH2AX enrichment over input obtained with the Upstate gH2AX antibody (in red), with the Abcam gH2AX antibody (in black), or with the Epitomics antibody (in orange) expressed as log2 and smoothed using a 500 probe sliding window. ChIP-chip analyses was performed using chromatin from AsiSI-ER-U20S cells treated with 4OHT. Representative experiments are shown. Note the strong similarity between the three profiles. U20S T98G_G2 T98G_G1 88 500 000 89 500 000 Log2 gH2AX/input chr1_6 0.8 0.4 0 0.8 0.4 0 0.8 0.4 0 chr6_7 U20S T98G_G2 T98G_G1 90 000 000 90 500 000 91 000 000 92 000 000 chr6_4 Log2 gH2AX/input Log2 gH2AX/input 0.8 0.4 0 0.8 0.4 0 0.8 0.4 0 0.8 0.4 0 0.8 0.4 0 0.8 U20S T98G_G2 T98G_G1 0.4 0 30 000 000 31 000 000 32 000 000 Figure S5: gH2AX profiles are consistent between cell lines and cell cycle phases. Detailed views of gH2AX enrichment over input (expressed as log2 and smoothed using a 500 probe sliding window), across several domains of chromosome 1 and 6. ChIP-chip was performed using chromatin from AsiSI-ER-U20S cells (dark red), or AsiSI-ER-T98G in G1 phase (orange), and AsiSI-ER-T98G in G2 phase (red) treated with 4OHT for 4 hours. Representative experiments (performed with the Epitomics antibody) are shown. Arrows indicate AsiSI site positions. B A C 0.35 0.25 0.15 0.05 Log2(gH2AX Epitomics/input) gH2AX Upstate Log2(gH2AX Upstate/input) 0.28 0.24 0.2 0.16 0.12 0.08 -8 -4 0 4 -8 8 Distance from the TSS (kb) -4 0 4 0.25 0.2 0.15 0.1 -8 -4 0 4 8 E 14 0.15 10 gH2AX Pol II 0.05 6 2 -8 -4 0 4 Distance from the TSS (kb) 8 PolII enrichment (ChIP-seq) 0.25 H2AX 0.08 18 Log2(gH2AX/H3) 0.3 Distance from the TSS (kb) Distance from the TSS (kb) D gH2AX Epitomics 0.05 8 Log2(H2AX/input) Log2(gH2AX Abcam/input) gH2AX Abcam 0.04 0 -0.04 -8 -4 0 4 8 Distance from the TSS (kb) Figure S6: Profiles of gH2AX and H2AX across transcription start sites (TSS). A, The 368 genes contained within the gH2AX domains were oriented with respect to transcription start sites (with the transcribed region on the right). The log2 gH2AX/input signal obtained with the gH2AX antibody from Abcam was calculated using a 200 bp sliding window and is shown over a 20kb window centered on the TSS. B, Same as in A, except that the log2 gH2AX/input signal was obtained with the gH2AX antibody from Upstate. C, Same as in A, except that the log2 gH2AX/input signal was obtained with the gH2AX antibody from Epitomics. D, Same as in A, except that the log2 gH2AX/H3 signal is plotted. E, Same as in A, except that the log2 H2AX/input signal is plotted. 4 Log2(pol II/input) Log2(pol II/input) A 2 0 ( + Strand (-) ) 4 2 0 67 600 000 67 800 000 4 Log2(pol II/input) Log2(pol II/input) Strand (+) 2 0 ( + Strand (-) ) 154 700 000 154 900 000 120 250 000 120 450 000 4 2 0 Strand (+) 119 500 000 119 300 000 B Log2(pol II/input) 0.5 0.4 0.3 0.2 0.1 -8 -4 0 4 8 Distance to the TSS (kb) Figure S7: Pol II is enriched on genes and at gene promoters. A, Detailed view of PolII binding (in untreated AsiSI-ER-U20S) on selected genes from chromosome 1. Note that PolII can bind over the entire gene locus or can be restricted to the promoter region. B, 3072 genes, located on chromosome 1 and 6, were oriented with respect to transcription (with the transcribed sequence on the right) and the log2 PolII/input signal was calculated using a 200 base sliding window and is shown over a 20kb window centered on the TSS position. Note that, as expected (Barski et al, 2007), PolII is mainly enriched at promoters on a genome wide scale. A B 0.05 Pol II -4OHT Log2(Pol II/input) Log2 (Pol II/ input) 4 0.02 3 2 1 0 -0.02 -5 -1 0 +5 Distance from the border (kb) 0.5 0 0.5 1 1.5 Log2(gH2AX/H2AX) -2.5 D 1.5 0.9 Mean log2( gH2AX/H3) on genes Mean log2( gH2AX/input) on genes C 0.5 -0.5 1.5 -0.5 Mean log2( Pol II/input) on genes 3.5 0.7 0.5 0.3 0.1 -1 -0.1 0 1 2 3 -0.3 -0.5 Mean log2( Pol II/input) on genes Figure S8: gH2AX and Pol II binding are mutually exclusive. A, The 534 “hole” borders previously identified were aligned and overlaid (right and mirror left borders are combined). The white part of the graph corresponds to gH2AX “holes” (as on Figure 6A). The profile of PolII over a 10kb window centered on the hole border and averaged using a 500 base window size is shown. Note that PolII levels are higher in gH2AX holes. B, The log2 (PolII/input) from two independent experiments was averaged, and for each probe encompassed by the previously defined gH2AX domains, the log2 PolII/input (y axis) was plotted against the log2 gH2AX/H2AX (x axis). The probes showing a high value for gH2AX/H2AX have a low value for PolII, and vice versa, indicating that PolII and gH2AX are mutually exclusive. C, The log2 (Pol II/input) (x axis) and log2 (gH2AX /input) (y axis) signals were averaged on each of the 368 genes encompassed in gH2AX domains (from the TSS to the end of the gene), and plotted against each other. Genes showing high Pol II value show low gH2AX level. D, Same as in C, except that the gH2AX/H3 signal is used in y axis. A 9.82 RNA(+) -4OHT Transcription on (-) strand Transcription on (+) strand 9.77 9.65 9.52 -5 0 +5 Distance from the border (kb) RNA(-) -4OHT 9.71 9.60 -5 0 +5 Distance from the border (kb) 0.8 0.6 0.4 0.2 0 -0.2 8 10 12 14 16 18 Mean sense RNA on genes 1 0.8 0.6 0.4 0.2 0 -0.2 8 13 -0.4 Mean sense RNA on genes 18 Mean Log2(gH2AX/input) on genes 1 Mean log2( gH2AX/H3) on genes Mean log2( gH2AX/H2AX) on genes B 1.5 1 0.5 0 8 13 -0.5 Mean Sense RNA on genes Figure S9: High RNA levels and gH2AX are mutually exclusive . A, RNA were extracted from AsiSI-ER-U20S cells (without 4OHT), and reverse transcribed using a protocol that keeps strand information, in order to analyze (+) and (-) strand expression (see Material and Methods). cDNAs were hybridized on the Affymetrix Human Tilling 2.0 A array in order to generate high resolution strand specific expression maps. The 534 borders of gH2AX “holes” previously identified were aligned and overlaid (right and mirror left borders are combined). The profile of the RNA transcribed from the (+) strand (upper panel) and the (-) strand (lower panel), are shown over a 10kb window centered on the hole’s border, and averaged using a 500 base window size. As for PolII binding, RNA levels are increased in gH2AX holes. B, The sense RNA signal for each genes (obtained from the (-) or (+) strand signal depending on gene orientation, see Material and Methods), obtained by the strand specific expression profiling experiment were averaged on each of the 368 genes encompassed in gH2AX domains (from the TSS to the end of the gene). For each of these genes the log2 (gH2AX Upstate/H2AX) (left panel), the lod2 (gH2AX Upstate/H3) (middle panel), or log2 (gH2AX Upstate/input) (right panel) were averaged as well. gH2AX (y axis) and RNA value (x axis) were plotted against each other. As for Pol II binding, the genes showing high expression levels show low gH2AX levels, irrespective of the normalization against H2AX,H3, or input. 18 % of cleveage efficiency 100 90 -OHT 80 +OHT 70 60 50 40 30 20 10 0 1 chr1_6 2 chr1_8 3 chr6_7 4 chr22_ctrl 5 gapdh Figure S10: Cleavage efficiency on AsiSI sites Genomic DNA was extracted before and after 4OHT treatment and assayed for cleavage at AsiSI sites as described in the Material and Methods section. In these experiments, an AsiSI linearized plasmid was added to each sample before performing ligation, as a normalization control. Pulled down DNA was analyzed by quantitative PCR amplification using primers close to three cleaved AsiSI sites, and two control (uncleaved) sequences. Cleavage efficiency (as a percentage) was calculated relative to the signal obtained with primers located on the AsiSI linearized plasmid. Data shown correspond to the mean and standard deviation from three independent experiments. Mean sense RNA + 4OHT 17 15 13 11 9 7 7 9 11 13 15 17 Mean sense RNA – 4OHT Figure S11: Gene Transcription in gH2AX domains is not effected by DSB induction RNA levels were assessed by strand expression profiling with or without 4OHT treatment (see Material and Methods). For each of the 368 genes located within gH2AX domains, sense expression was analyzed by averaging the signal over the gene from either the cDNA1 or cDNA2 array experiments, depending on each gene’s orientation. transcription factory gH2AX foci gH2AX foci Figure S12: Model of 3D gH2AX spreading. The current model of chromosome organization in the nucleus is based on the existence of clusters of chromatin loops aggregated into 3-dimensional domains (Dorman et al, 2007). Large chromosomal domains may be delimited by elements (depicted in blue) that could therefore block the spreading of gH2AX. Inside gH2AX foci (in red), some loops could be withdraw from the foci, for example to be transcribed in transcription factories (in green), therefore leading to “holes” within the gH2AX domain (as seen when depicted linearly). In addition, some regions distant from the break (but still encompassed in the same large chromosomal domain) may be physically proximal to the break within the nucleus, and therefore covered by gH2AX. This model also explains how the state of gene transcription can be maintained even upon DSB induction and gH2AX focus formation. 4OHT + + + + + + + + + + + + + + + + + + + + + + + + + + + + - chr N° 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 6 6 6 6 6 6 6 6 6 6 6 6 6 1 1 6 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 2 3 4 Left boundary 1667 8856659 13330738 19176113 25170848 40193077 88787251 91621723 108792296 202097763 202903944 206062519 221760623 228483320 240620585 5015 15710622 20147573 26312797 30371674 36827745 38256019 49406313 89662279 135373970 144227252 149304066 170729773 1667 222110520 5015 170727437 Right boundary 769796 10458126 15001758 20477024 25647232 41223898 90495397 92216354 110684622 202793777 203068866 206905465 222406738 229892463 241313672 160606 16477575 20707680 28189029 31706388 37905795 38889459 50944027 91549544 136997035 144995161 150720204 170896781 737291 222287958 153485 170896781 Annotation Score Telomere AsiSI AsiSI AsiSI AsiSI AsiSI AsiSI AsiSI AsiSI AsiSI Prox AsiSI AsiSI AsiSI AsiSI AsiSI Telomere AsiSI AsiSI AsiSI AsiSI AsiSI Prox AsiSI AsiSI AsiSI AsiSI AsiSI AsiSI Telomere Telomere Prox AsiSI Telomere Telomere 0.21065718 0.1815597 0.11594671 0.17012137 0.12276864 0.20742705 0.36496324 0.14798611 0.31235426 0.15728331 0.1146983 0.10589541 0.13346664 0.24552357 0.17528072 0.13853534 0.11982131 0.10790963 0.12851565 0.26693177 0.22907432 0.1109641 0.16586761 0.22628273 0.13061982 0.20552018 0.12267045 0.2488081 0.22899012 0.12393546 0.14786207 0.20948009 Table S1: Positions of gH2AX-enriched domains. Domains were demarcated using the average of gH2AX over H2AX signal from two independent experiments by an in house algorithm (see Materials and Methods). Positions are according to the UCSC hg18 release. N° chr1_1 Left boundary Right boundary AsiSI position (hg18) 8856659 10458126 9572031-9634451 symmetry left right Domain (ratio right/left spreading spreading size (bp) spreading (bp) (bp) distance) chr1_2 13330738 15001758 13948767-14015273-14797808 chr1_3 19176113 20477024 19684740-19845677 chr1_4 25170848 25647232 25445640 476384 274792 201592 0.733616699 chr1_5 40193077 41223898 40747229 1030821 554152 476669 0.860177352 chr1_6 88787251 90495397 89231183 1708146 443932 1264214 2.847764973 chr1_7 91621723 92216354 91970661-92144412-92156699 chr1_8 108792296 110684622 109838221-110120612110329096 chr1_9 202097763 203068866 202098047-202647074 chr1_10 206062519 206905465 206483409 842946 420890 422056 1.00277032 chr1_11 221760623 222406738 222099269 646115 338646 307469 0.907936311 chr1_12 228483320 229892463 229070855 1409143 587535 821608 1.398398393 chr1_13 240620585 241313672 240754400 693087 133815 559272 4.179441767 chr6_1 15710622 16477575 16237016 766953 526394 240559 0.456994191 chr6_2 20147573 20707680 20320298-20664300 chr6_3 26312797 28189029 26768137-27253344-27769878 chr6_4 30371674 31706388 31213405 1334714 841731 492983 0.58567761 chr6_5 36827745 38889459 37184118-37429778 chr6_6 49406313 50944027 50025540 1537714 619227 918487 1.48327996 chr6_7 89662279 91549544 89764157-90404906 chr6_8 135373970 136997035 135861039 1623065 487069 1135996 2.332310207 chr6_9 144227252 144995161 144649260 767909 422008 345901 0.819655078 chr6_10 149304066 150720204 149929798 1416138 625732 790406 1.263170175 Table S2: Final set of gH2AX domains used in our analyses. A select set of the previously identified gH2AX domains (Supplementary Table S1) were merged in cases where multiple domains corresponded to a single AsiSI site. These domains were used for the further studies (i.e., “holes” detection, and gH2AX signal across genes). Size and symmetry were however analyzed only for domains that contain a single AsiSI site. Note that domains can be quite asymmetrical relative to the DSB position. Primers used for the Q-PCR chr22:19180307_dist_FW: CCCATCTCAACCTCCACACT chr22:19180307_dist_REV CTTGTCCAGATTCGCTGTGA chr22:19180307_prox_FW :CCTTCTTTCCCAGTGGTTCA chr22:19180307_prox_REV: GTGGTCTGACCCAGAGTGGT chr22: 21292316_dist_FW: TGGCTGGAACTGCTTTCTTT chr22: 21292316_dist_REV: GGTGAGTGAATGAGCTGCAA chr22: 21292316_prox_FW: ATGCCATGTGTCCTGATGAA chr22: 21292316_prox_REV CTGACTGGTGGCTTTTCCAT chr1_6:89231183_FW: GATTGGCTATGGGTGTGGAC chr1_6:89231183_REV CATCCTTGCAAACCAGTCCT chr1_8:109838221_FW CCCTGGAGGTAGGTCTGGT chr1_8:109838221_REV CGCACACTCACTGGTTCCT chr6_12_90404906_FW TGCCGGTCTCCTAGAAGTTG chr6_12_90404906_REV GCGCTTGATTTCCCTGAGT chr6:101505264_FW : ACCTGGGATGGGACATATCA chr6:101505264_REV: TACCAAGCCTGTCCCTGAAC chr6: 40663811_FW: CAAACACACTCCCCCGTACT chr6: 40663811_REV: CTGGGTTTTCTCCACTGCTG chr1:3092903_FW CGAGATCCAAGGAAGTCGTG chr1:3092903 _REV CCCCGGACACTTTAAAAGGA ARV1_FW AACCAGGAGGCCAAAGAGTT ARV1_REV CCACCACCTCAGGTATGCTT SARS_FW CTGGCCTGTCTACCTGCTTC SARS_REV CTGGCAGCATGATTCAAAGA CELSR2_FW GTGACTCAAACCCGTGTCCT CELSR2_REV CTCACAGTATGGCCCAAGGT AMPD2_FW CGTAGTGCCCCGTATGAGTT AMPD2_REV CGAGTCACTGTCCGTCTTCA C6ORF129_FW GAGGAGAAGCTGTCCCAGTG C6ORF129_REV ATAGACGAGCGTCAGGAGGA ZFAND3_FW GGAGGAAGCCATCATGAAAA ZFAND3_REV TGGCTGGCTAAAGAAAGGAA Primers used for the Double Strand oligonucleotide in cleavage assay: FW CGC AAG CTT TAA-TAC-GAC-TCA-CTA-TAG-GG REV Biot-CC CTA TAG TGA GTC GTA TTA AAG CTT GCG AT Table S3: Sequence of primers used for Q-PCR amplification and Cleavage assay