Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
B CELL DEVELOPMENT IN THE BONE MARROW ORDERED B-CELL DEVELOPMENT immature B cell pre B cell ANTIGEN RECOGNIZING RECEPTOR H-chain + surrogate L-chain pro B cell H2L2 SIGNALING RECEPTOR NO ANTIGEN RECOGNIZING RECEPTOR Stages of differentiation in the bone marrow are defined by Ig gene rearrangement B CELL STAGE Stem cell Early pro-B IgH GENE CONFIGURATION Germline DH to JH Late pro-B Large pre-B VH to DHJH VHDHJH Pre-B cell receptor expressed Ig Light chain gene has not yet rearranged Bone marrow stromal cells nurture developing B cells 1. Specific cell-cell contacts between stromal cells and developing B cells 2. Secretion of cytokines by stromal cells Cell-cell contact B Secreted Factors - CYTOKINES Stromal cell Types of cytokines and cell-cell contacts needed at each stage of differentiation are different Maturing B cells Bone marrow stromal cell B B Stromal cell Cytokines and cell-cell contacts at each stage of differentiation are different VLA-4 Early pro-B Stem (Integrin) Receptor Tyrosine kinase Stem cell factor VCAM-1 (Ig superfamily) Cell adhesion molecules c-Kit Cell-bound growth factor Stromal cell Cytokines and cell-cell contacts at each stage of differentiation are different Interleukin-7 receptor Interleukin-7 Growth factor Early pro-B Late pro-B VLA-4 (Integrin) VCAM-1 (Ig superfamily) Stromal cell Pre-B Pre- B cell receptor Heavy chain VHDHJH V-preB CHm l5 Iga & Igb signal transduction molecules Transiently expressed when VHDHJH CHm is productively rearranged VpreB/l5 - the surrogate light chain, is required for surface expression Ligand for the pre-B cell receptor is unknown Ligation of the pre-B cell receptor 1. Suppresses further H chain rearrangement 2. Triggers entry into cell cycle Large Pre-B Unknown ligand of pre-B cell receptor 1. Ensures only one specificty of Ab expressed per cell Stromal cell 2. Expands only the pre-B cells with in frame VHDHJH joins ALLELIC EXCLUSION Large pre-B cells need in frame VHDHJH joins to mature Human IgG3 Heavy Chain nucleotide sequence Translation in frame 1 ATGAAACANCTGTGGTTCTTCCTTCTCCTGG TGGCAGCTCCCAGATGGGTCCTGTCCCAGG TGCACCTGCAGGAGTCGGGCCCAGGACTGG GGAAGCCTCCAGAGCTCAAAACCCCACTTGG TGACACAACTCACACATGCCCACGGTGCCCA GAGCCCAAATCTTGTGACACACCTCCCCCGT GCCCACGGTGCCCAGAGCCCAAATCTTGTG ACACACCTCCCCCATGCCCACGGTGCCCAG AGCCCAAATCTTGTGACACACCTCCCCCGTG CCCNNNGTGCCCAGCACCTGAACTCTTGGG AGGACCGTCAGTCTTCCTCTTCCCCCCAAAA CCCAAGGATACCCTTATGATTTCCCGGACCC CTGAGGTCACGTGCGTGGTGGTGGACGTGA GCCACGAAGACCCNNNNGTCCAGTTCAAGT GGTACGTGGACGGCGTGGAGGTGCATAATG CCAAGACAAAGCTGCGGGAGGAGCAGTACA ACAGCACGTTCCGTGTGGTCAGCGTCCTCAC CGTCCTGCACCAGGACTGGCTGAACGGCAA GGAGTACAAGTGCAAGGTCTCCAACAAAGCC CTCCCAGCCCCCATCGAGAAAACCATCTCCA AAGCCAAAGGACAGCCCGAGGAGATGACCA AGAACCAAGTCAGCCTGACCTGCCTGGTCAA AGGCTTCTACCCCAGCGACATCGCCGTGGA GTGGGAGAGCAATGGGCAGCCGGAGAACAA CTACAACACCACGCCTCCCATGCTGGACTCC GACGGCTCCTTCTTCCTCTACAGCAAGCTCA CCGTGGACAAGAGCAGGTGGCAGCAGGGGA ACATCTTCTCATGCTCCGTGATGCATGAGGC TCTGCACAACCGCTACACGCAGAAGAGCCTC TCCCTGTCTCCGGGTAAATGA MKXLWFFLLLVAAPRWVLSQV HLQESGPGLGKPPELKTPLGD TTHTCPRCPEPKSCDTPPPCP RCPEPKSCDTPPPCPRCPEPK SCDTPPPCXXCPAPELLGGPS VFLFPPKPKDTLMISRTPEVTC VVVDVSHEDXXVQFKWYVDG VEVHNAKTKLREEQYNSTFRV VSVLTVLHQDWLNGKEYKCKV SNKALPAPIEKTISKAKGQPEE MTKNQVSLTCLVKGFYPSDIAV EWESNGQPENNYNTTPPMLD SDGSFFLYSKLTVDKSRWQQG NIFSCSVMHEALHNRYTQKSLS LSPGK* Translation in frame 2 (no protein) Development continues Large pre-B Pre-B cell receptor can ligate to stromal cell Development arrests * Translation in frame 3 ETXVVLPSPGGSSQMGPVPGA PAGVGPRTGEASRAQNPTW* Development arrests Stages of B cell development Stem Cell Early pro-B cell Late pro-B cell Large pre-B cell Nagy pre-B sejt Peripheral Pre-receptor Immature B cell Y Small pre-B cell Mature B cell Receptor H+L Each stage of development is defined by IgH and IgL chain genes, expression of adhesion molecules and cytokine receptors Ligation of the pre-B cell receptor triggers entry into the cell cycle Proliferation Large Pre-B Large Large Pre-B Large Pre-B Large Pre-B Pre-B Small Large pre-B Proliferation stops Pre-receptor not displayed Many large pre-B cells with identical pre-B receptors IgM Intracellular VDJCH chain VL-JL rearranges Y Large pre-B Large Pre-B Large Large Pre-B Large Pre-B Large Pre-B Pre-B Immature B cell Light chain expressed IgM displayed on surface B cell receptor Heavy chain VHDHJH Light chain VLJLCL CHm Iga & Igb signal transduction molecules L chain is rearranged ORDER OF REARRANGEMENTS OF IMMUNOGLOBULIN GENE SEGMENTS D – J recombination V – DJ recombination VDJ – mδ transcription Surrogate light chain V – J recombination VJ – (or VJ - l) transcription mδ translation or l translation B-sejt mIgD mIgM Secreted IgM DEVELOPMENT OF B-LYMPHOCYTES IN THE BONE MARROW Limphoid precursor B cells recognizing self structures Cell surface molecules MHC proteins Common molecules of haemopoetic cells c-kit/CD44 RAG-1/RAG-2 H H rearrrangement átrendeződés m apoptosis, clonal deletion Soluble molecules House keeping genes Metabolites Surrogate L L rearrangement B functional unresponsiveness anergia Other specificites Selection clonal deletion B B B PERIPHERAL LYMPHOID TISSUES B cells have several chances to successfully rearrange Ig genes Early Pro B DH-JH On first chromosome NO DH-JH On second chromosome Late Pro B YES YES VH-DJH On first chromosome NO VH-DJH On second chromosome Pre B YES on first YES chromosome Y B YES l on first chromosome IgMl on second chromosome NO NO NO NO B IgM YES NO YES Immature B l on second chromosome NO YES Y B RECEPTOR EXPRESSION DURING B-CELL DEVELOPMENT Negative selection of immature B-cells in the bone marrow BONE MARROW 1 2 3 4 5 n Potential B-cell repertoire Self recognition Clonal deletion Self structure PERIPHERAL LYMPHOID ORGANS RNA editing Foreign antigen independent Available B-cell repertoire About 30 billion mature naive B cells leave the bone marrow per day to circulate in blood RESULT OF SOMATIC GENE REARRANGEMENT AND ALLELIC EXCLUSION 1. Somatic rearrangement of Ig gene segments in a highly controlled manner 2. Single B-cells become committed to the synthesis of one unique H-chain and one unique L-chain variable domain, which determine their specificities 3. In one individual a huge B-cell repertoire is generated consisting of B-cell clones with different H- and L-chain variable domains 4. This potential B-cell repertoire is able to recognize a wide array of various antigens 5. Immature B-cells express IgM and IgD surface Ig with the same variable domains MECHANISMS INDEPENDENT ON THE PRESENCE OF ANTIGEN OCCUR IN THE BONE MARROW DURING B-CELL DEVELOPMENT SYNTHESIS OF IMMUNOGLOBULINS Secreted Ig Membrane Ig Golgi ER H and L chains are synthesized on separated ribosomes CHAPERONES Leader sequence Ribosome mRNA HOW CAN IMMATURE B CELLS EXPRESS SURFACE IgM AND IgD IMMUNOGLOBULINS Splicing of IgM and IgD RNA VD J VD J Cm1 Cm2 Cm Cm3 Cd Cg3 Cd1 Cm4 Cg1 Cd2 DNA Cd3 pA2 pA1 Two types of mRNA can be made simultaneously in the cell by differential usage of alternative polyadenylation sites and splicing of the RNA VD J Cm1 Cm2 Cm3 Cm4 AAA Cd1 V D J Cm Cd2 Cd3 RNA cleaved and polyadenylated at pA1 IgM mRNA RNA cleaved and polyadenylated at pA2 VD J Cm1 Cm2 Cm3 Cm4 Cd1 Cd2 Cd3 pA1 V D J Cd IgD mRNA AAA Co-expression of cell surface IgM and IgG on mature B-cells is controlled by alternative RNA processing SYNTHESIS OF IMMUNOGLOBULINS Secreted Ig Membrane Ig Golgi ER H and L chains are synthesized on separated ribosomes CHAPERONES Leader sequence Ribosome mRNA