Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Isaiah 40:11 11 He shall feed his flock like a shepherd: he shall gather the lambs with his arm, and carry them in his bosom, and shall gently lead those that are with young. ©1999 Timothy G. Standish Vectors Timothy G. Standish, Ph. D. ©1999 Timothy G. Standish Transformation Of Bacteria The Griffith Experiment OUCH! + Control - Control - Control Experimental ©1999 Timothy G. Standish Vectors If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then make many copies of it Vectors are typically plasmids or viruses that have been engineered to both accept DNA insertions and reproduce inside cells Cloning is the process of inserting DNA encoding a gene of interest into a vector, then establishing it as a stable part of a cell line. ©1999 Timothy G. Standish pUC 18 A Typical Plasmid Ampr Gene aagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattc HindIII SphI PstI SalI XbaI BamHI XmaI KpnI SstI EcoRI AccI SmaI BanII HincII BspMI 2,686 bp Origin of Replication Multiple Cloning Site Lac Z Gene ©1999 Timothy G. Standish pUC 18 Sequence tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcaggg cgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgt aaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaaggg ggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactctaga ggatccccgggtaccgagctcgaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtg taaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcca acgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaa ggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctgg cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg gaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaaagctcacgctgtaggtatct cagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaa gacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctaca ctagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttt tgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggatttt ggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaa tcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgc tgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcct ccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgttt ggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagt aagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattct gagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcg gggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagc aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgt ctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatga cattaacctataaaaataggcgtatcacgaggccctttcgtc ©1999 Timothy G. Standish R. E.s and DNA Ligase Can be used to make recombinant DNA EcoRI EcoRI GAATTC CTTAAG GAATTC CTTAAG G CTTAA 1 Digestion AATTC G 2 Annealing of sticky ends Ligase G AATTC CTTAA G 3 Ligation 4 Recombinant DNA G AATTC CTTAA G ©1999 Timothy G. Standish Cloning Into pUC18 Ampr pUC18 R. E. Digestion R. E. Digestion LacZ Matching sticky ends anneal Host Cell Transformation of cells with the recombinant plasmid Addition of ligase joins nicks and makes a single recombinant plasmind ©1999 Timothy G. Standish So How Do You Know If You Cloned Something? IPTG - Induces expression of lacZ X-Gal - A lactose analog which turns blue when split by b-galactosidase Ampicillin - Kills all bacteria that lack the plasmid ©1999 Timothy G. Standish X-Gal 5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside HOCH2 HOCH2 O O Galactose HO HO Glucose O OH HO OH OH Lactose O-b-D-galactopyranosyl-(1->4)-b-D-glucopyranose ©1999 Timothy G. Standish X-Gal 5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside b-Galactosidease Lac Z gene product HOCH2 O Galactose HO HO O H2O Cl Br OH X-Gal N H (Colorless) ©1999 Timothy G. Standish X-Gal 5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside b-Galactosidease HOCH2 O Cl Galactose HO HO OH HO Br OH N H Blue ©1999 Timothy G. Standish So How Do You Know If You Cloned Something? Blue colonies - Express b-galatosidase IPTG - Induces expression of lacZ which metabolizes colorless X-gal to blue and turn blue thus lacZ is not disrupted Cloned fragments and there is no foreign DNA cloned disrupt lacZ thus make no b-galactosidase and colonies remain white X-Gal - A lactose analog which turns blue when split by b-galactosidase Ampicillin - Kills all bacteria that lack the plasmid ©1999 Timothy G. Standish Libraries If all the DNA from an organism is digested with a restriction enzyme and cloned into a plasmid, many different recombinant plasmids will be made, each with a different fragment of DNA cloned into it Once inserted into host cells or viruses, this collection of many different recombinant plasmids is called a “library” When the whole genome of an organism is used as the starting point for cloning, it is called a “shotgun clone” A library constructed using shotgun cloning may contain hundreds of thousands of different recombinant plasmids Screening is the process of sifting through the library to find the clone of interest ©1999 Timothy G. Standish A Library The clone of interest ©1999 Timothy G. Standish Library Screening Libraries tend to have a lot of clones only one of which has the sequence of interest Screening a library is the process of eliminating those clones that do not contain the sequence of interest and locating the clone that does There two major techniques are used for screening: Hybridization screening - In which DNA from a library is bound to a membrane, then the membrane is exposed to a probe that should base pair (hybridize) to the sequence of interest Expression vectors may be used so that if the gene for a protein is cloned, the protein is made. To do this, you must be able to detect the protein ©1999 Timothy G. Standish cDNA Libraries Because of the large size of libraries and the tedium of screening, anything that can be done to limit library size is a good thing Protein coding regions of most eukaryotic genomes make up only a small percentage of the total DNA (3% in humans) Most cells only express a small subset of an organism’s genes By using reverse transcriptase, a cDNA copies of the mRNA being produced in a group of cells can be made Cloning cDNA to make a library produces a much smaller library enriched with the part of an organism’s genome that is of most interest ©1999 Timothy G. Standish An Expression Vector Myc tag EK site MCS AatII II Cmr I XbaI T1 pPROTet.E II t0 • pPROTet.E is a commercially available plasmid sold by Clontech • It is specifically designed to allow efficient control of expression ColE1 SacI ©1999 Timothy G. Standish cDNA Library Construction mRNA 5’ Reverse transcription 5’ mRNA Rev. cDNA Trans. hybrid 5’ 5’ AAAAAAAAAAA3’ TTTTTTTTTTTT5’ AAAAAAAAAAA3’ TTTTTTTTTTTT5’ AAAAAAAAAAA3’ cDNA after RNase treatment 5’ RN TTTTTTTTTTTT5’ ase Double-stranded cDNA after DNA polymerase 5’ 5’ DNA Pol TTTTTTTTTTTT5’ AAAAAAAAAAA3’ Insert into vector ©1999 Timothy G. Standish ©1999 Timothy G. Standish