Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA Technology - Grayslake Central High School
Document related concepts
no text concepts found
Transcript
Difficulties with DNA 1. One cell normally provides too little material for study • Gene cloning • Polymerase Chain Reaction (PCR) 2. There are often thousands of genes on a DNA molecule • Electrophoresis Restriction Enzymes • Bacterial defense against viral DNA • Excise DNA at specific sequences Desired Gene CCTTTGAATTCGGCCATATACGAATTCCCAGAATC GGAAACTTAAGCCGGTATATGCTTAAGGGTCTTAG Target Sites for EcoRI Gene Cloning Recombinant plasmid Recombinant bacterium Gene of interest Polymerase Chain Reaction • In vitro amplification of a select length of DNA Denaturation Priming Elongation Desired Gene Electrophoresis • Separation of molecules based on size • Negatively charged DNA molecules are pulled through a gel by an electrical field • Smaller molecules travel faster and farther Poop Walter Jordan Restriction Fragment Length Polymorphisms A B AAGAATTCCCTGATCCATATATATATATCGGATCTAGAATTCGAT TTCTTAAGGGACTAGGTATATATATATAGCCTAGATCTTAAGCTA AAGAATTCCCTGATCCATATATCGGATCTAGAATTCGATTGACTG TTCTTAAGGGACTAGGTATATAGCCTAGATCTTAAGCTAACTGAC AAGAATTCCCTGATCCATATATCGGATCTAGAATTCGATTGACTG TTCTTAAGGGACTAGGTATATAGCCTAGATCTTAAGCTAACTGAC AAGAATTCCCTGATCCATATATATCGGATCTAGAATTCGATTGAC TTCTTAAGGGACTAGGTATATATAGCCTAGATCTTAAGCTAACTG Variations in DNA A Variations in fragment sizes B Variations in electrophoresis bands Restriction Mapping Uncut plasmid Cut with EcoRI Cut with BamH3 Cut with Both DNA Marker 10 8 6 4 2 (kilobases)
Related documents