Download DNA Fingerprinting - Biology Resources

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts
no text concepts found
Transcript
Restriction enzymes
DNA molecules are very long
They may consist of millions of base pairs
In order to study the structure of DNA, the
molecules are broken up into smaller fragments
by enzymes called restriction enzymes
Restriction enzymes do not break up the DNA
molecule randomly but ‘cut’ it at particular sites
2
Restriction fragments
3
For example, a restriction enzyme called EcoR1*
‘recognises’ the base sequence CAATTC and cuts it
between the two As
recognised
--C-C-G-C-A-G-C-T-G-T-C-A-A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A
cut
--C-C-G-C-A-G-C-T-G-T-C-A
A-T-T-C- T-C-T-C-C-G-G-A-T-C-C-A-
Other restriction enzymes cut the DNA in different places
and so produce fragments which are easier to analyse
--C-C-G-C-A-G-C-T-G-T-C-A
--C-C-G-C-A-G
C-T-G-T-C-A
A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-C-A-
A-T-T-C-T-C-C-G
G-A-T-C-C-C-A-
4
The fragments cut by the restriction enzymes are called
restriction fragments
The fragments can be separated using gel electrophoresis
(See slides 7 – 11)
Genetic fingerprinting
90% or more of DNA does not carry nucleotide triplets that code
for proteins
The non-coding DNA is often called ‘junk DNA’ but this only
means that its functions have not yet been discovered
Some of the non-coding regions consist of repeated sequences
of nucleotides
For example -C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G- *
The number of repeats in any one section of DNA varies
from one individual to the next
Since these sections do not code for proteins (and, therefore are
not genes) there is no observable difference in these individuals
Genetic fingerprinting
5
6
Restriction enzymes
Particular repeat sequences can be ‘cut out’ by restriction enzymes
For example
restriction enzyme cuts
here……………and…..….…..here
-CATCCACGACATGCATGCATGCATGCCACATCCAor
here…….…..…..………and…...….…………..here
-CCACGACATGCATGCATGCATGCATGCATGCCACAT-
7
Gel electrophoresis
The different sized fragments are separated by a process
called gel electrophoresis
The separation takes place in a sheet of a firm but
jelly-like substance (a ‘gel’)
Samples of the DNA extracts are placed in shallow
cavities (‘wells’) cut into one end of the gel
A voltage is applied to opposite ends of the gel
DNA has a negative charge and moves slowly towards
the positive end
The shorter fragments travel through the gel faster than the
longer fragments
Gel electrophoresis
8
Gel electrophoresis
DNA extract
added
well
gelatinous sheet
solution
Gel electrophoresis
thin slab of
gel
9
DNA samples placed in
wells cut in gel
Voltage supply
negative electrode
positive
electrode
+
DNA fragments
Move from negative
To positive
10
A sample with the
shorter DNA fragments
travels through the gel
faster than a sample
with the larger fragments
11
Next slide
12
Appearance of separated fragments on gel
These bands will
contain the shorter
DNA fragments
These bands will
contain the longer
DNA fragments
Prof.E.J.Wood
E. Wood
©©Prof.
starting positions
Appearance of bands
13
Genetic fingerprinting
DNA analysis can be used for catching criminals, establishing
parentage, finding how closely organisms are related and many other
applications.
The pattern of bands in a gel electrophoresis is known as a
genetic fingerprint or a ‘genetic profile’
If a genetic fingerprint found in a sample of blood or other tissue
at the scene of a crime matches the genetic fingerprint of a suspect,
this can be used as evidence
A DNA sample can be obtained from the suspect using blood, cheek
epithelial cells taken from the mouth lining or even the cells clinging
to the root of a hair
Genetic fingerprinting
Chances of a match
Suppose that…………
….there is a chance of 1 in 10 that this
fragment occurs in many individuals…
…and.there is a chance of 1 in 20 that this
fragment occurs in many individuals…
…and.there is a chance of 1 in 10 that this
fragment occurs in many individuals…
…and.there is a chance of 1 in 30 that this
fragment occurs in many individuals, but…
14
15
Probability of a match
…the probability of all 4 bands matching in any person other than
the suspect is
1 in 10
x
1 in 20
x 1 in 10
x
1 in 30
= 1 in 10 x 20 x 10 x 30 That is 1 in 60,000
When a larger number of bands is involved, the probability that
the suspect is not guilty becomes one in many thousands*
V
S
S1
S2
S3
DNA profiles
V Victim
S Sample from crime scene
S1 Suspect 1
S2 Suspect 2
S3 Suspect 3
More than 20 fragments
from Suspect 1 match those
taken from the crime scene
16
17
Evidence from genetic fingerprinting
Genetic fingerprinting is powerful evidence in criminal trials but…
Many restriction fragments may be crowded into a single band
There may be variability in the speed with which a fragment travels
through the gel
There is a chance of contamination with ‘foreign’ DNA
e.g. from bacteria
The jury may not understand the significance of genetic
fingerprinting and may be dependent on conflicting claims from
‘expert’ witnesses
There may be arguments about the statistical significance of a
match between DNA profiles
Evidence from genetic fingerprinting
Limitations of DNA evidence
18
Even if there is agreement about a match between the suspect’s
DNA profile and forensic samples, it shows only that the suspect
was present at the scene of the crime and does not prove that he or
she committed the crime
DNA evidence should be considered as conclusive proof of guilt
only if there is other supporting evidence
In cases of paternity disputes, the genetic evidence can be conclusive
Paternity can be decided on the basis of a single restriction site
Paternity test
position of
restriction
fragment
19
mother
father
part of DNA strand
child
Child will receive one copy of the restriction fragment from the
mother and one from the father. It could be any one of these
combinations
20
Genetic fingerprint of …
1 mother
2 child
3 possible father A
4 possible father B
There is a match between one of
the child’s restriction fragments
and one of the mother’s.
There is also a match between the
child’s other fragment and one from
possible father A.
1
2
3
4
Starting position of sample
Neither of the child’s restriction
fragments match those of possible
father B
Paternity test
The Human Genome Project
21
An organism’s genome is its entire genetic make-up
The genome includes …
all the chromosomes
all the genes on the chromosomes
and all the DNA of the chromosomes
The human genome project set out to …
identify the genes in the human genome (about 25,000*)
discover the sequence of the base pairs (about 2.8 billion)
99% of the gene-containing part of human DNA had been
analysed by 2003
Human genome project
22
Mapping is the identification of genes and their positions in
the chromosome
Modern biochemical techniques are used to identify genes
and their positions in the chromosome
Special staining methods reveal bands in the chromosomes
These do not necessarily represent genes but help to identify
the position of genes
Chromosome 7
position of gene for cystic fibrosis
Chromosome 11
position of gene for sickle cell anaemia
Mapping
Giant chromosomes
23
By special staining techniques, bands appear in
the ‘giant chromosome’ of the fruit-fly (Drosophila)
© Biophoto Associates
24
The bands do not necessarily represent genes but if, in mutant
flies, some of the bands are missing, there is a corresponding
defect in the fly
If bands are missing from this
region, the fly has no colour
in its eyes (normally red)
Loss of this band leads to a change
in the texture of the eye surface
Chromosome banding
If this band is missing there
is an irregularity in the wing
One or more of the bands in
this region controls the normal
development of bristles
25
Sequencing
Sequencing aims to find out the sequence of nucleotides in a
stretch of DNA
The process can be automated to give results relatively quickly
Analysis of a small piece of DNA might give results something
like this
GCTTATCGATTCGGTGATACCATAGTGTAGTGTAGTCGCT
ATCCATCGCTTACGAGTCTGATGCGCATTAGCTAGCTAGCT
AGCTAGCCTCAGTTGATCATCGAGTGAGTACTGGACCATGC
Further analysis is needed to decide which sequences code for
proteins and represent genes
Sequencing
26
Applications of results from the Human Genome Project
It is hoped that a knowledge of the human genome will enable…
identification of defective genes and the chance of early treatment
identification of genes which could make a person susceptible to
certain diseases, and so lead to preventative measures
prediction of the proteins that genes produce, giving the opportunity
to enhance or inhibit these proteins by specially designed drugs
Among the possible drawbacks are the possibilities that …
insurance companies may refuse cover for people at risk of
developing a genetic disability or disease
prediction of a disease or disability could blight a person’s life
Application
27
Question 1
A restriction enzyme cuts DNA
(a) at random sites
(b) at sites with repeat nucleotides
(c) into single nucleotides
(d) at specific sites
28
Question 2
The proportion of human DNA which codes for proteins is
(a) 3-10%
(b) 10-20%
(c) 50-80%
(d) 80-90%
29
Question 3
Junk DNA is DNA which
(a) is functionless
(b) does not code for proteins
(c) codes for harmful genes
(d) may have functions not yet discovered
30
Question 4
A restriction fragment is a piece of DNA which
(a) contains a gene
(b) contains repeated nucleotide sequences
(c) breaks up DNA at specific sites
(d) codes for a protein
31
Question 5
In gel electrophoresis, the restriction fragments are separated
(a) by heat
(b) by chemicals
(c) by electricity
(d) by X-rays
32
Question 6
In gel electrophoresis
(a) short DNA fragments move faster than long fragments
(b) long DNA fragments move faster than short fragments
(c) the fragments move towards the positive end
(d) the fragments move towards the negative end
33
Question 7
If, in electrophoresis, specific bands appear in the same place
in 10% of the population, what are the chances of 5 of these bands
occurring in one individual?
(a) 1 in 100
(b) 1 in 1000
(c) 1 in 10,000
(d) 1 in 100,000
34
Question 8
In slide 19, each individual has two bands in the electrophoresis
separation. This is because
(a) only two fragments are being analysed
(b) DNA is double stranded
(c) in each individual, one of their fragments is inherited
from the father and one from the mother
(d) the results are intended to distinguish between two
possible fathers
35
Question 9
The human genome includes
(a) all the genes
(b) all the DNA
(c) all the nucleotides
(d) all the bases
36
Question 10
Mapping is
(a) identifying the genes
(b) finding the position of genes in the chromosome
(c) finding the sequence of nucleotides
(d) finding the number of genes in a chromosome
37
Question 11
Sequencing aims to find
(a) the sequence of nucleotides in DNA
(b) the sequence of genes in DNA
(c) the sequence of events in DNA replication
(d) the timing of the stages in replication
Answer
Correct
Answer
Incorrect
Related documents