Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Restriction enzymes DNA molecules are very long They may consist of millions of base pairs In order to study the structure of DNA, the molecules are broken up into smaller fragments by enzymes called restriction enzymes Restriction enzymes do not break up the DNA molecule randomly but ‘cut’ it at particular sites 2 Restriction fragments 3 For example, a restriction enzyme called EcoR1* ‘recognises’ the base sequence CAATTC and cuts it between the two As recognised --C-C-G-C-A-G-C-T-G-T-C-A-A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-A cut --C-C-G-C-A-G-C-T-G-T-C-A A-T-T-C- T-C-T-C-C-G-G-A-T-C-C-A- Other restriction enzymes cut the DNA in different places and so produce fragments which are easier to analyse --C-C-G-C-A-G-C-T-G-T-C-A --C-C-G-C-A-G C-T-G-T-C-A A-T-T-C-T-C-T-C-C-G-G-A-T-C-C-C-A- A-T-T-C-T-C-C-G G-A-T-C-C-C-A- 4 The fragments cut by the restriction enzymes are called restriction fragments The fragments can be separated using gel electrophoresis (See slides 7 – 11) Genetic fingerprinting 90% or more of DNA does not carry nucleotide triplets that code for proteins The non-coding DNA is often called ‘junk DNA’ but this only means that its functions have not yet been discovered Some of the non-coding regions consist of repeated sequences of nucleotides For example -C-A-T-G-C-A-T-G-C-A-T-G-C-A-T-G- * The number of repeats in any one section of DNA varies from one individual to the next Since these sections do not code for proteins (and, therefore are not genes) there is no observable difference in these individuals Genetic fingerprinting 5 6 Restriction enzymes Particular repeat sequences can be ‘cut out’ by restriction enzymes For example restriction enzyme cuts here……………and…..….…..here -CATCCACGACATGCATGCATGCATGCCACATCCAor here…….…..…..………and…...….…………..here -CCACGACATGCATGCATGCATGCATGCATGCCACAT- 7 Gel electrophoresis The different sized fragments are separated by a process called gel electrophoresis The separation takes place in a sheet of a firm but jelly-like substance (a ‘gel’) Samples of the DNA extracts are placed in shallow cavities (‘wells’) cut into one end of the gel A voltage is applied to opposite ends of the gel DNA has a negative charge and moves slowly towards the positive end The shorter fragments travel through the gel faster than the longer fragments Gel electrophoresis 8 Gel electrophoresis DNA extract added well gelatinous sheet solution Gel electrophoresis thin slab of gel 9 DNA samples placed in wells cut in gel Voltage supply negative electrode positive electrode + DNA fragments Move from negative To positive 10 A sample with the shorter DNA fragments travels through the gel faster than a sample with the larger fragments 11 Next slide 12 Appearance of separated fragments on gel These bands will contain the shorter DNA fragments These bands will contain the longer DNA fragments Prof.E.J.Wood E. Wood ©©Prof. starting positions Appearance of bands 13 Genetic fingerprinting DNA analysis can be used for catching criminals, establishing parentage, finding how closely organisms are related and many other applications. The pattern of bands in a gel electrophoresis is known as a genetic fingerprint or a ‘genetic profile’ If a genetic fingerprint found in a sample of blood or other tissue at the scene of a crime matches the genetic fingerprint of a suspect, this can be used as evidence A DNA sample can be obtained from the suspect using blood, cheek epithelial cells taken from the mouth lining or even the cells clinging to the root of a hair Genetic fingerprinting Chances of a match Suppose that………… ….there is a chance of 1 in 10 that this fragment occurs in many individuals… …and.there is a chance of 1 in 20 that this fragment occurs in many individuals… …and.there is a chance of 1 in 10 that this fragment occurs in many individuals… …and.there is a chance of 1 in 30 that this fragment occurs in many individuals, but… 14 15 Probability of a match …the probability of all 4 bands matching in any person other than the suspect is 1 in 10 x 1 in 20 x 1 in 10 x 1 in 30 = 1 in 10 x 20 x 10 x 30 That is 1 in 60,000 When a larger number of bands is involved, the probability that the suspect is not guilty becomes one in many thousands* V S S1 S2 S3 DNA profiles V Victim S Sample from crime scene S1 Suspect 1 S2 Suspect 2 S3 Suspect 3 More than 20 fragments from Suspect 1 match those taken from the crime scene 16 17 Evidence from genetic fingerprinting Genetic fingerprinting is powerful evidence in criminal trials but… Many restriction fragments may be crowded into a single band There may be variability in the speed with which a fragment travels through the gel There is a chance of contamination with ‘foreign’ DNA e.g. from bacteria The jury may not understand the significance of genetic fingerprinting and may be dependent on conflicting claims from ‘expert’ witnesses There may be arguments about the statistical significance of a match between DNA profiles Evidence from genetic fingerprinting Limitations of DNA evidence 18 Even if there is agreement about a match between the suspect’s DNA profile and forensic samples, it shows only that the suspect was present at the scene of the crime and does not prove that he or she committed the crime DNA evidence should be considered as conclusive proof of guilt only if there is other supporting evidence In cases of paternity disputes, the genetic evidence can be conclusive Paternity can be decided on the basis of a single restriction site Paternity test position of restriction fragment 19 mother father part of DNA strand child Child will receive one copy of the restriction fragment from the mother and one from the father. It could be any one of these combinations 20 Genetic fingerprint of … 1 mother 2 child 3 possible father A 4 possible father B There is a match between one of the child’s restriction fragments and one of the mother’s. There is also a match between the child’s other fragment and one from possible father A. 1 2 3 4 Starting position of sample Neither of the child’s restriction fragments match those of possible father B Paternity test The Human Genome Project 21 An organism’s genome is its entire genetic make-up The genome includes … all the chromosomes all the genes on the chromosomes and all the DNA of the chromosomes The human genome project set out to … identify the genes in the human genome (about 25,000*) discover the sequence of the base pairs (about 2.8 billion) 99% of the gene-containing part of human DNA had been analysed by 2003 Human genome project 22 Mapping is the identification of genes and their positions in the chromosome Modern biochemical techniques are used to identify genes and their positions in the chromosome Special staining methods reveal bands in the chromosomes These do not necessarily represent genes but help to identify the position of genes Chromosome 7 position of gene for cystic fibrosis Chromosome 11 position of gene for sickle cell anaemia Mapping Giant chromosomes 23 By special staining techniques, bands appear in the ‘giant chromosome’ of the fruit-fly (Drosophila) © Biophoto Associates 24 The bands do not necessarily represent genes but if, in mutant flies, some of the bands are missing, there is a corresponding defect in the fly If bands are missing from this region, the fly has no colour in its eyes (normally red) Loss of this band leads to a change in the texture of the eye surface Chromosome banding If this band is missing there is an irregularity in the wing One or more of the bands in this region controls the normal development of bristles 25 Sequencing Sequencing aims to find out the sequence of nucleotides in a stretch of DNA The process can be automated to give results relatively quickly Analysis of a small piece of DNA might give results something like this GCTTATCGATTCGGTGATACCATAGTGTAGTGTAGTCGCT ATCCATCGCTTACGAGTCTGATGCGCATTAGCTAGCTAGCT AGCTAGCCTCAGTTGATCATCGAGTGAGTACTGGACCATGC Further analysis is needed to decide which sequences code for proteins and represent genes Sequencing 26 Applications of results from the Human Genome Project It is hoped that a knowledge of the human genome will enable… identification of defective genes and the chance of early treatment identification of genes which could make a person susceptible to certain diseases, and so lead to preventative measures prediction of the proteins that genes produce, giving the opportunity to enhance or inhibit these proteins by specially designed drugs Among the possible drawbacks are the possibilities that … insurance companies may refuse cover for people at risk of developing a genetic disability or disease prediction of a disease or disability could blight a person’s life Application 27 Question 1 A restriction enzyme cuts DNA (a) at random sites (b) at sites with repeat nucleotides (c) into single nucleotides (d) at specific sites 28 Question 2 The proportion of human DNA which codes for proteins is (a) 3-10% (b) 10-20% (c) 50-80% (d) 80-90% 29 Question 3 Junk DNA is DNA which (a) is functionless (b) does not code for proteins (c) codes for harmful genes (d) may have functions not yet discovered 30 Question 4 A restriction fragment is a piece of DNA which (a) contains a gene (b) contains repeated nucleotide sequences (c) breaks up DNA at specific sites (d) codes for a protein 31 Question 5 In gel electrophoresis, the restriction fragments are separated (a) by heat (b) by chemicals (c) by electricity (d) by X-rays 32 Question 6 In gel electrophoresis (a) short DNA fragments move faster than long fragments (b) long DNA fragments move faster than short fragments (c) the fragments move towards the positive end (d) the fragments move towards the negative end 33 Question 7 If, in electrophoresis, specific bands appear in the same place in 10% of the population, what are the chances of 5 of these bands occurring in one individual? (a) 1 in 100 (b) 1 in 1000 (c) 1 in 10,000 (d) 1 in 100,000 34 Question 8 In slide 19, each individual has two bands in the electrophoresis separation. This is because (a) only two fragments are being analysed (b) DNA is double stranded (c) in each individual, one of their fragments is inherited from the father and one from the mother (d) the results are intended to distinguish between two possible fathers 35 Question 9 The human genome includes (a) all the genes (b) all the DNA (c) all the nucleotides (d) all the bases 36 Question 10 Mapping is (a) identifying the genes (b) finding the position of genes in the chromosome (c) finding the sequence of nucleotides (d) finding the number of genes in a chromosome 37 Question 11 Sequencing aims to find (a) the sequence of nucleotides in DNA (b) the sequence of genes in DNA (c) the sequence of events in DNA replication (d) the timing of the stages in replication Answer Correct Answer Incorrect