Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Gene Substitution
Document related concepts
no text concepts found
Transcript
Phylogenetic Tree Construction Outgroup) Taxon 1) Taxon 2) Taxon 3) Taxon 4) ATGTCAGGGACTCAGATCGAATGGGATCTAG .....G......T.................. .....G......T........C......... .....G...........A............. .....G...........A........G.... Phylogenetic Tree Construction Outgroup) Taxon 1) Taxon 2) Taxon 3) Taxon 4) ATGTCAGGGACTCAGATCGAATGGGATCTAG .....G......T.................. .....G......T........C......... .....G...........A............. .....G...........A........G.... Outgroup AG Ancestor to taxa 1-4 Phylogenetic Tree Construction Outgroup) Taxon 1) Taxon 2) Taxon 3) Taxon 4) ATGTCAGGGACTCAGATCGAATGGGATCTAG .....G......T.................. .....G......T........C......... .....G...........A............. .....G...........A........G.... Outgroup Taxon 1 CT TC AG Taxon 2 Taxon 3 CA TG Taxon 4 Rates of Nucleotide Substitution Basic quantity in studying molecular evolution – Among genes – Within genes – Among organisms – Among codon positions or 2nd structure r = rate of nucleotide substitution It is defined as the number of substitutions per site per year. Ancestor T Seq1 T Seq2 K r 2T Calculating the rate of nucleotide substitution (r) Ancestral sequence T = years since divergence K = substitutions that occurred since divergence T T Sequence A Sequence B r = K/2T Different Gene Regions Coding regions – Nondegenerate sites – Twofold degenerate sites – Fourfold degenerate sites Noncoding regions – 5’ & 3’ untranslated regions – Introns – Psuedogenes Table 4.1 Rates of synonymous and nonsynonymous nucleotide sustitutions (± standard errors) in various mammalian protein-coding genesa Gene Number of codons compared Nonsynonymous rate Synonymous rate S14 150 0.02 ± 0.02 2.16 ± 0.42 S17 134 0.06 ± 0.04 2.69 ± 0.53 Actin α 376 0.01 ± 0.01 2.92 ± 0.34 Myosin β heavy chain 1933 0.10 ± 0.01 2.15 ± 0.13 Glucagon 29 0.00 ± 0.00 2.36 ± 1.08 Insulin 51 0.20 ± 0.10 3.03 ± 1.02 Interleukin-1 265 1.50 ± 0.15 3.27 ± 0.46 Relaxin 53 2.59 ± 0.51 6.39 ± 3.75 153 0.57 ± 0.11 4.10 ± 0.85 106 2.03 ± 0.30 5.56 ± 1.18 136 3.06 ± 0.37 5.50 ± 1.45 Aldolase A 363 0.09 ± 0.03 2.78 ± 0.33 Amylase 506 0.63 ± 0.06 3.42 ± 0.38 0.74 (0.67) 3.51 (1.01) Ribosomal proteins Contractile system proteins Activators, factors, and receptors Blood proteins Myoglobin Immunoglobulins Ig κ Interferons γ Enzymes Averageb Table 4.2 Rates of transitional and transversional substitutions (per site per 109 years) at nondegenerate, twofold degenerate, and fourfold degenerate codon sitesa Type of substitution Nondegenerate Twofold degenerate Fourfold degenerate Transition 0.40 1.86 2.24 Transversion 0.38 0.38 1.47 Total 0.78 2.24 3.71 aThe rates are averages over the genes in Table 4.1. Noncoding regions Causes of Rate Variation Functional constraints Causes of Rate Variation Synonymous vs. Nonsynonymous rates – Should be similar in rate (Ka/Ks=1) – Why not? Selection – Advantageous – Purifying Causes of Rate Variation Variation within a gene Causes of rate Variation Variation among genes – Rate of mutation – The intensity of selection (1000 fold in Ks) • Intensity of purifying selection (functional cont) Partial loss of function – Relaxation of selection Rate variation is explained by: Mutation input Random genetic drift of nearly neutral alleles Purifying selection against deleterious alleles Positive Selection Nonsynonymous changes are far more likely than synonymous changes to improve function Advantageous mutations are fixed more quickly than neutral mutations Ka should exceed Ks if positive selection plays a major role in the evolution of the protein Detecting Positive selection Multiple methods KA KS t V ( KA) V ( KS ) Lysozyme and foregut fermentation Lysozymes - enzymes that catalyse the break up of some bacterial cell walls . Important bacterial defence. Differences in Gastric lysozymes: – They are most active at low pH. – They are unusually resistant to cleavage by pepsin. Colubine monkeys (colubus and langurs) Hoatzin E14 E21 D75 N87 K126 Lysozyme Hoatzin Pigeon Calcium-binding lysozymes Horse K14 K21 D75 Langur N87 K126 Human Chicken K14 K21 D75 N87 E126 Cow Conventional lysozymes A Pattern of nucleotide substitutions G nucDNA C T mtDNA cmos ND4 12S rRNA 16S rRNA 16 14 AC AT CG CT GT 12 10 8 6 4 1775 1705 AC 1635 1565 1495 1425 1355 1285 AT 1215 1145 1075 1005 935 865 GT CT CG 795 725 655 585 515 445 375 305 235 165 95 0 25 2 U U C A G UUU Phe UUC UUA Leu UUG CUU CUC Leu CUA CUG AUU AUC Ile AUA AUG Met GUU GUC Val GUA GUG C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG A Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG G Tyr Stop Stop His Gln Asn Lys Asp Glu UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Stop Trp Arg Ser Arg Gly U C A G U C A G U C A G U C A G Codon Usage Nonrandom Usage of Synonymous codons – should be equally used – not what is found Graph Molecular Clocks Zuckerkandl and Pauling, 62 & 65 – Similar substitution rates among various lineages of mammals – Proposed that for any given protein, the rate of molecular evolution is approximately constant over time Molecular Clocks Use sub. Rate Paleontological data for a know split Apply to unkown splits K r 2T Molecular Clock Rate of substitution = rate of mutation MOLECULAR CLOCK # differences time Number of changes is proportional to time Use number of changes to estimate relative divergence of species or genes Calculating the rate of nucleotide substitution (r) Ancestral sequence T = years since divergence K = substitutions that occurred since divergence T T Sequence A Sequence B r = K/2T Once the molecular clock is calibrated it can date other events Ancestral sequence Can now date this event T T Sequence A Sequence C Sequence B T = K/2r Molecular Clock Rate = substitutions per bp per year Rate of evolution of DNA is constant over time and across lineages Resolve history of species – Timing of events – Relationship of species Morphological evolution (fossil record) not constant Early protein studies showed approximately constant rate of evolution Different rates within a gene or genome Coding sequences evolve more slowly than non-coding sequences Synonymous substitutions are often more common than non-synonymous Some sequences are under functional constraint Different genes evolve at different rates Useless concept? There is no Universal Molecular Clock Still a very useful concept Possible to examine both short and long term evolutionary processes by choosing appropriate dataset Probably more useful than a constant clock Rates There is no single rate How do we relate molecular time to geological time? Calibrate the clock – Lineage divergences in fossil record – Major geological events causing isolation of populations • Continental drift (Panama Isthmus) • Island or lake formation Testing the Molecular Clock Estimate the number of divergences over time Are these equal for the lineages of interest? Problem: fossil dating of divergence times is often inaccurate, and not possible for all lineages Cannot measure absolute rates equal A A slower B B slower B A B A Molecular distance from A to B is the same in all cases Molecular Clock-Controversy Exceptional cases – Guinea pig – Human-Ape – Rodents-primates – Turtles – Plants Relative Rate Test KAC = KOA + KOC KBC = KOB + KOC KAB = KOA + KOB O A B C Relative Rate Test KOA = (KAC + KAB -KBC)/2 KOB = (KAB + KBC -KAC)/2 KOC = (KAC + KBC -KAB)/2 O A B C Null (HO): KOA = KOB Alt (Ha) : KOA KOB Local Clocks Within lineages or similar groups – Mice and rats Humans and African Apes – Slow-down in humans Causes of rate variation Replication dependent errors – Generation time effect (germline replications higher in rodents than primates) – Efficiency of DNA repair enzymes – Metabolic rates Causes of rate variation Replication independent errors – Metabolic rate • Lower rates in poikilotherms than endotherms – Body size – Natural history Organelle DNA substitutions Mitochondria Chloroplasts Most uniparentally inherited – Most maternal although some paternal Mammalian mtDNA 17 kb, 13 protein encoding genes 2 rDNA genes and 22 tRNA genes Substitution rate is generally thought to be higher than nuclear genes Why? A low fidelity of DNA replication process An inefficient repair mechanism High concentration of mutagens (from metabolic functions) Reduction in the intensity of selection Nucleotide Substitution rates in Eukaryotic Genomes Genome Angiosperm mt Angiosperm cp single copy inverted Repeat Angiosperm nuc. Mammalian nuc. Mammalian mt Ks rate Relative Ks rate Ka rate 0.5 1 0.1 1.5 0.3 5.4 2-8 20-50 3 0.6 12 4-16 40-100 0.2 0.1 0.4 0.5-1.3 2-3 Estimated rate of substitutions/site/10 9 years. From Palmer, 1991
Related documents