Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Web site: http://bioinfo.weizmann.ac.il/ws Mailing list: http://bioinfo.weizmann.ac.il/announce Contact: [email protected] Genomic Databases and Analysis Tools 09:00-09:45 Vered Chalifa-Caspi Genomic Databases: from primary DNA sequence to gene function 09:45-11:00 Shifra Ben-Dor States of the human and mouse genomes 11:00-11:15 Coffee Break 11:15-12:15 Nili Avidan Web-based analysis and annotation tools 12:15-13:00 Marilyn Safran GeneCards: a database of human genes, their products and their involvement in diseases 13:00-14:00 Lunch Break 14:00-16:00 Hands-on at Ebner Computer Classroom Genomic Databases: from primary DNA sequence to gene function Vered Chalifa-Caspi Bioinformatics and Biological Computing Unit Biological Services Department Weizmann Institute of Science SNPs Nucleotide sequence AAGTGCCACTGCATAAATGACCATGAGTGGGCACCGGTAAGGGAGGGTGATGCTATCTGGTCTGAAG Genes mRNA Protein primary sequence Protein 3D structure Protein Function Acts as a tumor suppressor in many tumor types. induces growth arrest or apoptosis depending on the physiological circumstances or cell type, but both activities are involved in tumor suppression. Involved in the transport of chloride ions. Defects in CFTR are the cause of cystic fibrosis. It is the most common genetic disease in the caucasian population, with a prevalence of about 1 in 2000 live births. cf, an autosomal recessive disorder, is a common generalized disorder of exocrine gland function Starting Points for Navigation http://www.ncbi.nlm.nih.gov http://www.ebi.ac.uk/ http://dapsas.weizmann.ac.il http://bioinfo.weizmann.ac.il Genomic Databases • • • • • • • • • Genomic Sequences mRNA Sequences Genome Viewers Gene Databases Genetic Variation Gene Expression Protein Databases Protein Classification Pathways Genomic Sequences Genomic sequences • All sequences are archived in GenBank/EMBL/DDBJ • Genomic sequences: - unfinished clones. - finished clones. - clone contigs. - entire chromosomes. - entire genomes. mRNA Sequences mRNA sequences • • • • Full mRNA sequences Expressed Sequence Tags (ESTs) EST clusters EST assemblies • Predicted genes Genomic, mRNA and EST sequences Clones: Genomic mRNA ESTs Genome Viewers By integrating map and sequence information, a whole-genome view can be constructed Annotation Gene A Predicted gene K Gene B Resources for whole human genome sequence assembly 1. Human Genome Project Working Draft at the University of California at Santa Cruz 2. Ensembl EMBL - EBI and the Sanger Institute 3. MapViewer at NCBI University of California at Santa Cruz http://genome.cse.ucsc.edu/ Gene Databases Genetic Variation http://archive.uwcm.ac.uk/uwcm/mg/hgmd0.html Search for BRCA1 BRCA1 - Nucleotide substitutions (missense / nonsense) . . . http://www.geneclinics.org/ http://ariel.ucs.unimelb.edu.au:80/~cotton/glsdb.htm http://www.ncbi.nlm.nih.gov/SNP/ dbSNP A central repository for both single base nucleotide subsitutions and short deletion and insertion polymorphisms. http://hgvbase.cgb.ki.se/ Gene Expression Edgar et al. Nucleic Acids Research, 2002, Vol. 30, No. 1 207-210 http://nar.oupjournals.org/cgi/content/full/30/1/207/GKF066TB1 http://www.ncbi.nlm.nih.gov/geo/ http://www.hugeindex.org Protein Databases http://www.expasy.ch/sprot/ http://www.ebi.ac.uk/interpro/ Integrated resource of Protein Families, Domains and Sites. Unifies signature databases (PROSITE, PRINTS, ProDom, Pfam, SMART, TIGRFAMs) Useful for: - Identifying distant relationships in novel sequences - Predicting protein function and structure. - Large-scale genome annotation. Protein Classification http://www.geneontology.org/ • Search for a GO term and view all gene products annotated to it. • Search for a gene product and view all its associations. Pathways http://inn.weizmann.ac.il/units/dna_array/dna_array.html http://www.genome.ad.jp/kegg/regulation.html KEGG: Kyoto Encyclopedia of Genes and Genomes Thank You! Genomic Databases and Analysis Tools 09:00-09:45 Vered Chalifa-Caspi Genomic Databases: from primary DNA sequence to gene function 09:45-11:00 Shifra Ben-Dor States of the human and mouse genomes 11:00-11:15 Coffee Break