Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Phage_StrategiesAbs
Document related concepts
no text concepts found
Transcript
Phage Strategies Timothy G. Standish, Ph. D. ©2001 Timothy G. Standish The l Regulatory Region Terminator N utilization left left tL N utilization Terminator right right nutR tR1 nutL cIII N cI Positive regulator Antiterminator Repressor cro Antirepressor cII Positive regulator “c” = clear referring to the clear plaques resulting from functional c genes ©2001 Timothy G. Standish The l Regulatory Region Promoter Promoter/ Promoter Promoter/ Represser Operator left Represser Operator right EstablishMaintainence ment tL PRM OR/PR PL/OL PRE nutR tR1 nutL cIII N cI Positive regulator Antiterminator Repressor cro Antirepressor cII Positive regulator “c” = clear referring to the clear plaques resulting from functional c genes ©2001 Timothy G. Standish The l Regulatory Region: Infection Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins tL cIII PRM OR/PR PL/OL nutR tR1 nutL N PRE cI cro STOP cII STOP Transcription Transcription ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins tL cIII PRM OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII As they are the very first genes to be expressed, N and cro are called “immediate cro early” genes. ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny pN binds to nut sites allowing transcription through tR1 and tL tL cIII PRM OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny pN binds to nut sites allowing transcription through tR1 and tL tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN Transcription PRE cI cro pN cII Transcription cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The cII and cIII proteins are produced. In vivo a protein called HflA rapidly breaks down cII unless it is combined with cIII. cII up regulates transcription from PRE. tL cIII cIII PRm OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cro cII pN cIIcIII cII ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny Transcription from PRE makes mRNA complementary to the cro mRNA thus inhibiting cro translation tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII pN cIIcIII Transcription cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The transcript from PRE provides a 3’ untranslated region with an efficient ribosome binding site before the start of the cI gene, thus cI repressor is efficiently produced. tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII pN cIIcIII Transcription ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The repressor gene product of cI binds to OR and OL preventing transcription from PR and PL. tL cIII PRm OR/PR PL/OL nutR tR1 nutL N pN cI PRE cI cI cro cII pN cIIcIII cI ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of Lysogeny The repressor up-regulates expression from PRM maintaining repressor production and preventing expression of any other proteins and establishing lysogeny. tL cIII PRM OR/PR PL/OL nutR tR1 nutL N cI PRE cI cI cro cII Transcription ©2001 Timothy G. Standish The l Repressor Protein Repressor protein has two functional domains: 1 An amino acid (residue) 1-92 N-terminal DNA binding domain which binds to OR and OL 2 A C-terminal protein binding domain essential for dimerization running from amino acids 132-236 A 40 residue connector runs Between the two domains Repressor Repressor dimer Repressor only C CC binds DNA efficiently when it is a dimer N N N ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins tL cIII PRM OR/PR PL/OL nutR tR1 nutL N pN PRE cI cro cII As they are the very first genes to be expressed, N and cro are called “immediate cro early” genes. ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins cI PRM OR/PR cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins OR/PR 5’CAT’ACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC’ATG 3’ 3’ATG’TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACTATTACCAACG’TAC 5’ cI OR3 PRM OR2 OR1 cro ©2001 Timothy G. Standish C CC N N N The l Regulatory Region: Infection - Establishment of The Lytic Cycle 5’CAT’ACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC’ATG 3’ 3’ATG’TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACTATTACCAACG’TAC 5’ cI OR3 OR2 OR1 cro The N terminus of the repressor binds to OR1 and 2 with high affinity The N terminus of the repressor binds to OR1 and 2 with high affinity The N terminus of the repressor binds to OR1 and 2 with high affinity ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Host RNA Polymerase recognizes PL and PR and begins transcription of the N and cro proteins RNA Polymerase 5’CAT’ACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC’ATG 3’ 3’ATG’TGCAATTTAGATAGTGGCGTTCCCTATTTATAGATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACTATTACCAACG’TAC 5’ cI RNAOR3 Polymerase OR2 OR1 cro ©2001 Timothy G. Standish The l Regulatory Region: Infection - Establishment of The Lytic Cycle Right and left operator sites share a common consensus sequence. OR3 CTATCACCGCAAGGGATAA OR2 CTAACACCGTGCGTGTTGA OR1 TTACCTCTGGCGGTGATAA OL3 TAACCATCTGCGGTGATAA OL2 TTATCTCTGGCGGTGTTGA OL1 ATACCACTGGCGGTGATAC CON -TAYCWCYGGCGGTGWTR©2001 Timothy G. Standish ©2001 Timothy G. Standish
Related documents