* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Protein Synthesis
Deoxyribozyme wikipedia , lookup
Paracrine signalling wikipedia , lookup
Community fingerprinting wikipedia , lookup
Western blot wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Interactome wikipedia , lookup
Magnesium transporter wikipedia , lookup
RNA interference wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Genetic code wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Gene nomenclature wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Gene expression profiling wikipedia , lookup
Proteolysis wikipedia , lookup
Point mutation wikipedia , lookup
Biosynthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene regulatory network wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Expression vector wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Epitranscriptome wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Protein Synthesis & Gene Expression • DNA provides the instructions for how to build proteins • Each gene dictates how to build a single protein in prokaryotes • The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that make up a protein nucleotide sequence of His protein Amino acid sequence of His protein Protein Synthesis & Gene Expression Protein Synthesis & Gene Expression • Protein Synthesis = Gene Expression The process in which the instructions encoded by a gene are used to build a protein Gene mRNA polypeptide transcription translation DNA in the made in nucleus, built out of nucleus exits out of a amino acids by a pore in the ribosome in the nuclear envelope cytoplasm using and finds a instructions from ribosome in the an mRNA cytoplasm protein Final resulting molecule after polypeptide is modified and folded into final shape in the rough ER Packaged into a vesicle in the golgi and shipped out to where it is needed Protein Synthesis & Gene Expression • Transcription RNA polymerase makes an mRNA (messenger RNA) copy of a gene occurs in cytoplasm of prokaryotes, nucleus of eukaryotes Enables cell to make many copies of a gene so that a lot of protein can be made at one time Enables eukaryotic cells to keep DNA protected in the nucleus, only mRNA copies of genes leave the nucleus Protein Synthesis & Gene Expression • Transcription Initiation 1) INITIATION RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene Promoters are specific to genes RNA polymerase does not need a primer Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex (eukaryotes) Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor HONORS Protein Synthesis & Gene Expression • Transcription Elongation 1) INITIATION RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil instead of thymine AGTCAT UCAGUA HONORS Protein Synthesis & Gene Expression • Transcription Elongation The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes RNA polymerase slides down the template strand connecting together RNA nucleotides Protein Synthesis & Gene Expression • Transcription Termination A region on DNA known as the terminator signals the stop of a gene RNA polymerase separates from the mRNA and the DNA HONORS 1) INITIATION Protein Synthesis & Gene Expression • Alternative Splicing (eukaryotes only) Exons are “coding” regions provide instructions for one or more proteins) Introns are removed different combinations of exons form different mRNA resulting in multiple proteins from the same gene Humans have 30,000 genes but are capable of producing 100,000 proteins HONORS Web Resources Transcription • http://www.biostudio.com/d_%20Transcription.htm • http://www.youtube.com/watch?v=WsofH466lqk • http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html Alternative Splicing • http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related Protein Synthesis & Gene Expression • Translation mRNA is used by ribosome to build polypeptides (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the polypeptide) occurs in cytoplasm of prokaryotes and eukaryotes Transcription tRNA synthesis mRNA some polypeptides feed directly into rough ER in eukaryotes where they are modified and folded into the final protein Translation Protein Synthesis mRNA • Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) Translation 5’ 3’ AUGGACAUUGAACCG… start codon Protein Synthesis & Gene Expression • Translation Initiation Start codon signals where the gene begins (at 5’ end of mRNA) Ribosome binding site on the mRNA binds to a small ribosomal subunit Then this complex binds to a large ribosomal subunit forming the complete ribosome Protein Synthesis & Gene Expression • Translation Scanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct polypeptide Protein Synthesis & Gene Expression • Translation Scanning Transcription tRNA synthesis Every three mRNA nucleotides (codon) specify an amino acid mRNA Translation Protein Synthesis & Gene Expression • Translation Scanning Each tRNA carries a specific amino acid tRNA have an anticodon region that specifically binds to its codon anticodon Protein Synthesis • Translation Termination Ribosome disengages from the mRNA when it encounters a stop codon Web Resources Translation • Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related • Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm • http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm • http://www.johnkyrk.com/DNAtranslation.html • http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html • http://www.dnalc.org/resources/3d/TranslationAdvanced.html Protein Synthesis & Gene Expression • Post-Translational Modifications Polypeptide is modified in the rough ER – this might include cutting out sections and/or cut a section from one part of the polypeptide and moving it to another part Chaperone proteins help to fold the polypeptide into its final tertiary shape. Now it is called a protein. Protein Synthesis & Gene Expression Rough Endoplasmic Reticulum (ER) • Folded membrane that forms compartments where newly synthesized proteins are processed (cut, joined, folded into their final shape) • Ribosomes bind to rough ER when they start to synthesize proteins that are intended to be exported from the cell – the proteins enter the ER directly from the ribosome Protein Synthesis & Gene Expression Golgi Apparatus • Folded membranes form compartments that each contain different enzymes which selectively modify the contents depending on where they are destined to end up • Processes and packages macromolecules produced by the cell (e.g. proteins and lipids) – sent out as excretory vesicles “labeled” for their destination Protein Synthesis & Gene Expression • Multiple RNA polymerases can engage a gene at one time • Multiple ribosomes can engage a single mRNA at one time Transcription DNA mRNAs Translation Protein Synthesis & Gene Expression • Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm • Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm Protein Synthesis & Gene Expression • There are three main types of RNA: 1. mRNA (messenger RNA) - RNA copy of a gene used as a template for protein synthesis 2. rRNA (ribosomal RNA) - part of structure of ribosomes 3. tRNA (transfer RNA) - amino acid carrier that matches to mRNA codon Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser S – Y –H– T – H – P – S – S – S - S Protein Synthesis & Gene Expression • Protein Synthesis = Gene Expression Process in which a gene is used to build a protein resulting in the presence of a particular phenotype (physical characteristic) Phenotypic variation among organisms is due to genotypic variation (differences in the sequence of their DNA bases) Differences exist between species and within a species • Different genes (genomes) different proteins (proteomes) • Different versions of the same gene = alleles • Differences in gene expression = epigenetics Web Resources Insulin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html Hemoglobin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html Collagen Example of Protein Synthesis http://www.biotopics.co.uk/JmolApplet/collagen.html